ID: 1142197396

View in Genome Browser
Species Human (GRCh38)
Location 16:88745141-88745163
Sequence GCAGTGGGTCCCTGCGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142197396_1142197405 9 Left 1142197396 16:88745141-88745163 CCACCTCCGCAGGGACCCACTGC No data
Right 1142197405 16:88745173-88745195 CAGGAGCCCAGGAGACCCAGTGG 0: 1
1: 2
2: 4
3: 57
4: 516
1142197396_1142197399 -10 Left 1142197396 16:88745141-88745163 CCACCTCCGCAGGGACCCACTGC No data
Right 1142197399 16:88745154-88745176 GACCCACTGCTGCCTCTTCCAGG 0: 1
1: 1
2: 2
3: 47
4: 419
1142197396_1142197406 10 Left 1142197396 16:88745141-88745163 CCACCTCCGCAGGGACCCACTGC No data
Right 1142197406 16:88745174-88745196 AGGAGCCCAGGAGACCCAGTGGG 0: 1
1: 1
2: 4
3: 36
4: 312
1142197396_1142197402 -2 Left 1142197396 16:88745141-88745163 CCACCTCCGCAGGGACCCACTGC No data
Right 1142197402 16:88745162-88745184 GCTGCCTCTTCCAGGAGCCCAGG 0: 1
1: 0
2: 7
3: 58
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142197396 Original CRISPR GCAGTGGGTCCCTGCGGAGG TGG (reversed) Intronic
No off target data available for this crispr