ID: 1142197399

View in Genome Browser
Species Human (GRCh38)
Location 16:88745154-88745176
Sequence GACCCACTGCTGCCTCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 1, 2: 2, 3: 47, 4: 419}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142197392_1142197399 12 Left 1142197392 16:88745119-88745141 CCAGGCTGAGCCGGGGATCAGGC 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1142197399 16:88745154-88745176 GACCCACTGCTGCCTCTTCCAGG 0: 1
1: 1
2: 2
3: 47
4: 419
1142197393_1142197399 2 Left 1142197393 16:88745129-88745151 CCGGGGATCAGGCCACCTCCGCA 0: 1
1: 0
2: 0
3: 10
4: 207
Right 1142197399 16:88745154-88745176 GACCCACTGCTGCCTCTTCCAGG 0: 1
1: 1
2: 2
3: 47
4: 419
1142197396_1142197399 -10 Left 1142197396 16:88745141-88745163 CCACCTCCGCAGGGACCCACTGC No data
Right 1142197399 16:88745154-88745176 GACCCACTGCTGCCTCTTCCAGG 0: 1
1: 1
2: 2
3: 47
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142197399 Original CRISPR GACCCACTGCTGCCTCTTCC AGG Intronic
900175728 1:1290615-1290637 GACACCCGGCTGTCTCTTCCAGG + Exonic
900249412 1:1659620-1659642 GGCTCACTGCAGCCTCCTCCCGG + Intronic
900260349 1:1724931-1724953 GGCTCACTGCAGCCTCCTCCCGG + Intronic
901083543 1:6597202-6597224 CACCCACTGCTGACCTTTCCAGG - Intronic
901089280 1:6630644-6630666 GGCGCACTGCAACCTCTTCCAGG + Intronic
901462369 1:9399455-9399477 GGTCCTCAGCTGCCTCTTCCAGG - Intergenic
901749683 1:11398055-11398077 CCCGCGCTGCTGCCTCTTCCTGG + Intergenic
901768661 1:11519543-11519565 GACCCAGCGCTGCCTCTGCCAGG + Intronic
902391504 1:16109741-16109763 GAGTCACTGCTGACTCTCCCAGG - Intergenic
902872030 1:19319829-19319851 GGCTCACTGCAGCCTCTGCCTGG - Intronic
902872051 1:19319966-19319988 GGCTCACTGCAGCCTCTGCCTGG + Intronic
902923217 1:19679507-19679529 GACCCCCTGCTGCCATCTCCAGG + Exonic
902985107 1:20150126-20150148 GCCACACTGCCGCCTCTTGCTGG + Exonic
903022117 1:20401753-20401775 AACCCACTGCTGCTTCCTTCTGG + Intergenic
903304407 1:22402497-22402519 GACCCACTGATCCCTCTCCAGGG - Intergenic
904256358 1:29257454-29257476 CACCCAGCGCTGCCTCCTCCCGG - Intronic
905934559 1:41813216-41813238 GTCCCACTTCTGCTTCTTACTGG - Intronic
906364718 1:45197213-45197235 CACCAACAGCTGCATCTTCCTGG + Intronic
908215737 1:61949828-61949850 GGCTCACTGCAGCCTCTGCCAGG - Intronic
908869456 1:68592194-68592216 GACCCCATGCTACCTCTTCAAGG + Intergenic
909117038 1:71550362-71550384 GTCCCAGTGCTGCCATTTCCTGG + Intronic
910414024 1:86978934-86978956 GGCTCACTGCAGCCTCTACCAGG + Intronic
912681929 1:111734263-111734285 ATTCCAATGCTGCCTCTTCCCGG + Intronic
912782622 1:112565937-112565959 GACTCACTGCAGCCTCAGCCTGG - Intronic
914958641 1:152187139-152187161 CTCCCACTGCTCACTCTTCCTGG - Intergenic
915397812 1:155599104-155599126 GGCTCACTGCAGCCTCCTCCTGG - Intergenic
915917964 1:159952409-159952431 GACCTACAGCTGGCTCTCCCGGG - Exonic
916430794 1:164726210-164726232 AACCCACGGTTGCCTCCTCCAGG + Intronic
916549885 1:165839992-165840014 GGCCCACTGCAGCCTCTGCCGGG + Intronic
918037789 1:180892743-180892765 GATCAACTGCTGCCTCTAACTGG + Intergenic
918902592 1:190443589-190443611 GACCCACTGCTCCCTCATGCAGG - Intronic
919537179 1:198802058-198802080 TACCCGCTGCTGCCTTTTGCAGG - Intergenic
920201549 1:204262738-204262760 GGCCCACCCCTGCCTCTTGCTGG - Intronic
920965457 1:210697384-210697406 GACCCCGTGCTGCCTCCTGCAGG + Intronic
922008990 1:221562341-221562363 AAAGCACTGCTGTCTCTTCCCGG + Intergenic
922798761 1:228354308-228354330 CACCCAGGGCTGCCTCTTGCTGG + Intronic
922824983 1:228511696-228511718 GACATACTGCTGCCGCTTCAAGG - Intergenic
923520647 1:234732778-234732800 GACCAGCTGCTCCCTCCTCCTGG - Intergenic
923537990 1:234867735-234867757 GACTTTCTGCTGCCGCTTCCAGG - Intergenic
1063904255 10:10766467-10766489 GACACACTGCTGCCTCCATCGGG + Intergenic
1064147780 10:12839249-12839271 GACCAACAACTGCCTTTTCCTGG - Intergenic
1065880043 10:30030062-30030084 TGCCCACTGCTGCCCCTTCTTGG - Intronic
1066457798 10:35586802-35586824 GACTCAGAGCTGCCTCTTCCAGG - Intergenic
1066991821 10:42522475-42522497 AGCTCACTGCAGCCTCTTCCTGG + Intergenic
1067725041 10:48763532-48763554 AATCCACTGCGGCCTCTTACAGG + Intronic
1068782750 10:60939348-60939370 AACCCACTTCCTCCTCTTCCTGG - Intronic
1068952412 10:62790571-62790593 CATCCACTGCTGGCTATTCCGGG + Intergenic
1069622115 10:69844092-69844114 GAGCAAATGCCGCCTCTTCCGGG - Intronic
1070571711 10:77644693-77644715 GACTTACTCCTGCCTCTTCCTGG + Intergenic
1071450774 10:85790092-85790114 GGACCACTGCTGCATGTTCCTGG + Intronic
1073345149 10:102777273-102777295 CACCCTCTGCTGCCTGTTCCTGG + Intronic
1074221157 10:111439412-111439434 GCCCCACTGCTGACACTGCCTGG - Intergenic
1075492055 10:122879888-122879910 GCCCCACGCTTGCCTCTTCCTGG + Intergenic
1075618832 10:123910847-123910869 GATCCACTCTTGCCTCTTCCAGG + Intronic
1075737882 10:124675182-124675204 GACTCACTGCAGCCTCCGCCTGG - Intronic
1076272137 10:129162990-129163012 AACCCACTCCTGGCTCCTCCAGG - Intergenic
1077259309 11:1607323-1607345 GACCTGCTGCCGCCTCTCCCCGG - Intergenic
1077329818 11:1979348-1979370 GCCCCACTGAAGCCCCTTCCGGG + Intronic
1077439374 11:2560851-2560873 CATCCACTGCTGCCTCTGCTGGG - Intronic
1077448500 11:2617576-2617598 GACCCACTAATCCCTCTTCTAGG - Intronic
1077634790 11:3835006-3835028 GCACCATTGCTGCCTCTTCCAGG + Intronic
1078102153 11:8336312-8336334 CACCCACTGCAGGCTCCTCCGGG - Intergenic
1078354935 11:10626265-10626287 GACCCACTCCTGCCGCATCCTGG + Exonic
1078529594 11:12126805-12126827 CACCCACCGCTGCCTCCTTCAGG - Intronic
1078655854 11:13238494-13238516 GCCCCCGTTCTGCCTCTTCCTGG - Intergenic
1080283387 11:30584403-30584425 GGCTCACGGCTGGCTCTTCCCGG + Intronic
1080785233 11:35469393-35469415 CAGCCACTGCTGCCCCTACCTGG + Intronic
1081704132 11:45170813-45170835 AAGCCACTACTCCCTCTTCCCGG - Intronic
1083732466 11:64660260-64660282 GACCCACACCTGCCTCTGTCTGG - Intronic
1083736381 11:64683836-64683858 GACCCTCGGCTGCTTCTTCCTGG - Intronic
1083885216 11:65570193-65570215 GACCCCCTGAGGCCACTTCCAGG + Intergenic
1084190291 11:67495567-67495589 GACGCACTCCAGCCTCTTTCTGG - Exonic
1084581528 11:70026934-70026956 CACTTGCTGCTGCCTCTTCCTGG + Intergenic
1084686458 11:70698661-70698683 GACGCGCTGCTTTCTCTTCCAGG - Intronic
1084800253 11:71538943-71538965 GACCTGCTGCCGCCTCTCCCCGG + Exonic
1085036127 11:73301156-73301178 GACCCTTTGCTTACTCTTCCAGG + Intergenic
1085179279 11:74520001-74520023 GACCCACTATTCCCTCTACCTGG + Intronic
1085683112 11:78596577-78596599 CACCCACTGCTTCCTCTACCTGG - Intergenic
1088984210 11:114891187-114891209 TCCACACTGCTCCCTCTTCCTGG + Intergenic
1089082570 11:115789192-115789214 GCCCCACTGCTGGGCCTTCCGGG + Intergenic
1089547953 11:119244917-119244939 AGCTTACTGCTGCCTCTTCCAGG + Intronic
1089615710 11:119693588-119693610 GAGCACCTGCTGCCACTTCCTGG - Intronic
1089783650 11:120892583-120892605 GACACACTGCAGCCTCTGTCAGG + Intronic
1091093317 11:132793190-132793212 GACCCAGTGCTGCCCTTCCCGGG + Intronic
1091363706 11:134999701-134999723 GCCTCACTGCTGCCTCCACCTGG - Intergenic
1202812796 11_KI270721v1_random:34527-34549 GCCCCACTGAAGCCCCTTCCGGG + Intergenic
1092806264 12:12225906-12225928 TACCCACTGCTGCCTGTGCAAGG + Intronic
1093620149 12:21278405-21278427 GGCCCACTGTTACCTCTACCTGG - Intronic
1093812145 12:23504209-23504231 GATCCACTACTGCCTCCTCCTGG - Intergenic
1096160801 12:49375502-49375524 AGCCCACTGCTGGCTCTTCCTGG + Intronic
1096469544 12:51867641-51867663 CACACACTGCTCCTTCTTCCTGG + Intergenic
1096684860 12:53281512-53281534 GGCTCGATGCTGCCTCTTCCAGG - Exonic
1096799359 12:54099383-54099405 GACCCCCTGCTGACTCTTAGAGG - Intergenic
1096976746 12:55703700-55703722 GACCCACTGCCCCCTCATCAGGG + Intronic
1097781667 12:63713858-63713880 GTCTCACCTCTGCCTCTTCCTGG - Intergenic
1097901639 12:64879543-64879565 AAGAGACTGCTGCCTCTTCCAGG - Intronic
1098142357 12:67463188-67463210 GTCCCACTGCTGCTGCTTTCAGG + Intergenic
1098235829 12:68417233-68417255 GGCTCACTGCAGCCTCCTCCCGG - Intergenic
1099197931 12:79640673-79640695 GGCTCACTGCAGCCTCATCCTGG - Intronic
1099782946 12:87223107-87223129 GACCCAGTCATGCCTCTTCTGGG - Intergenic
1101230656 12:102737813-102737835 GACCCAGTCCTCCCTATTCCTGG + Intergenic
1101421870 12:104557246-104557268 AACTCACTTCTGCCTCTTTCTGG + Intronic
1101952830 12:109189680-109189702 GACCCACAGCTGACTTTTCATGG + Intronic
1102003287 12:109572153-109572175 ATCCCACTCCTGCCTCTTCTTGG - Intronic
1103139670 12:118537489-118537511 AACCCACTGCTGCCTCAGCTTGG + Intergenic
1103197552 12:119058058-119058080 CACCTACTGTTCCCTCTTCCAGG - Intronic
1104944209 12:132408409-132408431 GACCCCCTGGTACCTCTACCTGG - Intergenic
1105202657 13:18193417-18193439 TTCCCATTCCTGCCTCTTCCTGG - Intergenic
1107011730 13:35677109-35677131 GCCCCAGTGCTTCCTCCTCCAGG + Intergenic
1107145628 13:37058017-37058039 CACCCGCTTCTGCCTCTTACAGG - Intronic
1108258500 13:48633263-48633285 GACCCATTGTGGGCTCTTCCAGG + Intergenic
1110351409 13:74512759-74512781 TACCCACTGAGGCCTCTTCTTGG + Intergenic
1110634608 13:77752032-77752054 GACTCTCTGCTGCCTCTTGGTGG + Intronic
1111880916 13:93956030-93956052 GAGCCACTCCTGTCTCATCCTGG + Intronic
1113862358 13:113495709-113495731 GACCCACTGCCGGCTCTGCATGG - Exonic
1114544125 14:23486058-23486080 TACTCACTGCTGACTCTTACAGG + Intronic
1117574562 14:57085110-57085132 GACTGACTGCTTCCTCTTCCAGG - Intergenic
1118726440 14:68632442-68632464 GAAACACTGCAGCCTTTTCCAGG + Intronic
1118833559 14:69458524-69458546 GAACCAGGGCTGCCACTTCCAGG - Exonic
1119380523 14:74225397-74225419 GCCCCACTGCTGCCTCCTCTAGG + Intergenic
1119419719 14:74501342-74501364 GAGCCACTGCTGCCTCCTAGTGG - Intronic
1119706954 14:76788971-76788993 GCCCCCCTTCTGCCTCTCCCAGG + Exonic
1120019721 14:79515097-79515119 GACACACTGGTGCCTGTTACAGG + Intronic
1120080915 14:80215309-80215331 GTCCTACTGTTGCCTCTTTCTGG + Intronic
1120950037 14:90032409-90032431 GACCAACTCCTGCCCCTTCGTGG - Intronic
1121441847 14:93954483-93954505 GACCCACTCCTTCCTCTCACAGG - Exonic
1122052837 14:99071734-99071756 GACCCAGGGCAGCCTGTTCCAGG - Intergenic
1122141310 14:99664505-99664527 GTCTCACTGGTGCCTCCTCCTGG - Intronic
1122788720 14:104175593-104175615 CACTCACTGCAGCCTTTTCCGGG - Exonic
1122852636 14:104545339-104545361 GTCTCACTGCTGCCCTTTCCTGG + Intronic
1122906178 14:104802599-104802621 GAGAGAATGCTGCCTCTTCCTGG + Exonic
1123212624 14:106775315-106775337 TACCCACTCCAGCCCCTTCCCGG + Intergenic
1124147766 15:27144330-27144352 AAACCCATGCTGCCTCTTCCAGG - Intronic
1124375263 15:29125538-29125560 GACCCACTGCGCCCTCTTCAGGG + Intronic
1124527973 15:30474982-30475004 GACTCACTGCAACCTCCTCCAGG + Intergenic
1124770685 15:32532726-32532748 GACTCACTGCAACCTCCTCCAGG - Intergenic
1125501636 15:40243340-40243362 GGCCCGGTGCTGCCTCTTCCTGG + Intronic
1125720119 15:41841346-41841368 GGCCCACCGCTGCCTCAGCCTGG + Intronic
1125874809 15:43134199-43134221 CTCCCCATGCTGCCTCTTCCTGG + Intronic
1126925474 15:53580515-53580537 GGCCCACTGCAGCTACTTCCTGG + Intronic
1127017754 15:54708134-54708156 GAATTACTGGTGCCTCTTCCAGG - Intergenic
1127262772 15:57338030-57338052 GACTCACGGCTGCTTCCTCCTGG + Intergenic
1128868858 15:71136973-71136995 GGCCTGCTGCTGCCTCCTCCTGG + Intronic
1129372800 15:75108721-75108743 AAACCACAGCTGCCTCTTGCTGG - Intronic
1129566014 15:76624711-76624733 GGCCCACTGCTGCCACTACTGGG - Intronic
1130441053 15:83954978-83955000 GACCCACTGCAGCCACTATCTGG + Intronic
1130657071 15:85799169-85799191 GACCCACTGATCCCTTTTCAAGG + Intergenic
1131524735 15:93143740-93143762 GCCCCAGTGCTTCCTCCTCCAGG - Intergenic
1132040829 15:98523470-98523492 GCCCCAGTGCTGCCCCTTACTGG - Intergenic
1132298459 15:100761800-100761822 CAGCGTCTGCTGCCTCTTCCGGG + Intergenic
1132311669 15:100862046-100862068 GGCCCTCTGGAGCCTCTTCCTGG - Intergenic
1132939816 16:2501106-2501128 GACCTGCTGCTGCCTCTACCTGG + Exonic
1133007750 16:2894211-2894233 GACCAACTGCTGTATCTTGCAGG + Intronic
1133700409 16:8303082-8303104 GGCTCACTGCAGCCTCTGCCTGG - Intergenic
1134688210 16:16173233-16173255 CACCCACTGCTGCCACCTCCAGG - Intronic
1135042067 16:19125284-19125306 GGCTCACTGCAACCTCTTCCAGG + Intronic
1135111073 16:19691277-19691299 GACACACGGCTGCCTCTCCCTGG + Intronic
1135133977 16:19874287-19874309 GCCCCTCTGCTCCCTCTGCCTGG + Intronic
1135656018 16:24250183-24250205 AACCCACAGCTGCCCCTTCCAGG - Intergenic
1135934983 16:26771968-26771990 GGCTCACTGCAGCCTCTGCCTGG + Intergenic
1137722261 16:50634122-50634144 GCCCCACCCCAGCCTCTTCCAGG + Exonic
1137746641 16:50825539-50825561 GACCCAGTGATTCCACTTCCAGG - Intergenic
1139314316 16:66055627-66055649 GACCCTCCCCTGCCTCTCCCCGG + Intergenic
1139687633 16:68616697-68616719 GCCTCACTGGTGCCTCTCCCAGG - Intergenic
1140948826 16:79796529-79796551 GACCCATTGGTGCTTCTTCTTGG - Intergenic
1141246544 16:82313019-82313041 GACCCACTATGGCCTCTTTCAGG + Intergenic
1141617214 16:85216829-85216851 AACCCACTCCTGTCTCTTGCCGG + Intergenic
1141768746 16:86075762-86075784 GACCCAGTGCTGCCCCTGGCTGG + Intergenic
1142194122 16:88731766-88731788 GCCCAACTACTGCCTCTTCCTGG - Exonic
1142197399 16:88745154-88745176 GACCCACTGCTGCCTCTTCCAGG + Intronic
1142267786 16:89072482-89072504 GGCCCACTCCTCCCTCTCCCTGG - Intergenic
1143174361 17:4947958-4947980 GGCCCACTTCCGCCTCTCCCAGG - Intronic
1143376682 17:6471320-6471342 CACCCACAGCCCCCTCTTCCTGG - Exonic
1143504666 17:7356980-7357002 CACCCCCTTCTGCCTGTTCCGGG + Exonic
1143632755 17:8148194-8148216 CACACCCAGCTGCCTCTTCCAGG - Exonic
1143666286 17:8363250-8363272 GACTCACTTATGCCTCTTCCAGG - Intergenic
1143697432 17:8630723-8630745 AACCCACCGCTGCCTCCGCCGGG + Exonic
1143897473 17:10147297-10147319 GCCCCACTGCTGGCTTTGCCTGG - Intronic
1143920221 17:10325582-10325604 GACTCACTGCAGCATCTTCTGGG - Intronic
1143965100 17:10751419-10751441 CACCCACTGCTCTCTCTCCCTGG + Intergenic
1144387277 17:14760606-14760628 GACCCATTTCTGCCTGTGCCTGG + Intergenic
1144457555 17:15431502-15431524 CACCCAGTGCTGCCTGTGCCAGG - Intergenic
1144543994 17:16175291-16175313 GACTCACTGCAACCTCTGCCTGG - Intronic
1144632289 17:16880410-16880432 TGAACACTGCTGCCTCTTCCCGG - Intergenic
1144949598 17:18986802-18986824 GCCCCACTGGGGTCTCTTCCTGG + Intronic
1145208719 17:20997789-20997811 TGAACACTGCTGCCTCTTCCCGG + Intergenic
1147474896 17:40701296-40701318 GCCTTACTGCTGCCCCTTCCAGG - Exonic
1147894707 17:43742981-43743003 GACCCACTGCCTACTCCTCCTGG - Intergenic
1148756953 17:49978209-49978231 GTCCCCCTCCTGCCTCCTCCTGG - Intergenic
1149571138 17:57673244-57673266 AATCCACTTCTGGCTCTTCCAGG + Intronic
1151418238 17:73980796-73980818 TACACAATGCTGCCTCTGCCCGG - Intergenic
1152458748 17:80430592-80430614 GGCTCTCTGCTCCCTCTTCCTGG - Intronic
1152542268 17:80982277-80982299 GACCCACGGCTGCCTGGCCCAGG - Intergenic
1152693128 17:81730329-81730351 GACCCACTGCTGCCCTGTCCAGG - Intergenic
1152732272 17:81978052-81978074 GCTCCACTCCTCCCTCTTCCCGG - Intronic
1152767591 17:82149454-82149476 GAGACACTGCTGCCTTTACCTGG + Intronic
1152903330 17:82957460-82957482 GACCCACCGCGTCCGCTTCCTGG - Exonic
1152926290 17:83089227-83089249 TACCCACTGCTCCCTGTTCTTGG + Intronic
1153920337 18:9783293-9783315 GGGCCTCTGCTTCCTCTTCCTGG + Intronic
1153985870 18:10350596-10350618 GAGCCTCTGCCGCCTTTTCCAGG + Intergenic
1155471501 18:26196767-26196789 GGCTCACTGCAGCCACTTCCTGG - Intergenic
1156366707 18:36435139-36435161 AACCCACTACTGCCTATTCAAGG - Intronic
1156667270 18:39423680-39423702 GACCCACTGCTGACTGACCCAGG + Intergenic
1157185873 18:45539629-45539651 GAAATACGGCTGCCTCTTCCTGG + Intronic
1157506188 18:48228396-48228418 GACCCAGTGCTGTCTGTGCCAGG - Intronic
1157541693 18:48515356-48515378 GAGCCATTGCTTCCTCATCCTGG - Intergenic
1157581081 18:48774517-48774539 AACCCTCTGCTGGCCCTTCCAGG + Intronic
1159687177 18:71437099-71437121 GACCCAGTGCTCCTTCTGCCAGG + Intergenic
1160243238 18:77137534-77137556 CACCCCCTGCTGCCTGTGCCTGG + Intergenic
1160690141 19:457930-457952 GACCCACTTCCGCCTCCCCCGGG - Intronic
1160991758 19:1863101-1863123 GAGCCACCGCTGTCCCTTCCCGG - Exonic
1161625123 19:5322079-5322101 GGCTCAGTGCTGCCTCTTGCCGG - Intronic
1161699856 19:5788617-5788639 GTCCCAATGCCCCCTCTTCCAGG + Intronic
1161700411 19:5791469-5791491 GACTCACCGCAGCCTCGTCCTGG + Intergenic
1162452364 19:10762853-10762875 CACCTACTCCTGCCTCCTCCAGG - Intronic
1162866861 19:13554578-13554600 GACCCAATGCTTCCTCCTCTGGG + Intronic
1163123619 19:15232545-15232567 CACCCGCTGCTGAGTCTTCCTGG - Intronic
1164586763 19:29480615-29480637 GACGCTTTCCTGCCTCTTCCTGG - Intergenic
1164633820 19:29778524-29778546 GACACACTCCTGCCTCACCCGGG - Intergenic
1164742821 19:30589300-30589322 GACCCTCTGTTGGCTCTTACAGG + Intronic
1164792634 19:31001370-31001392 GTCCCACAGCTGCCTCTGTCCGG + Intergenic
1164839408 19:31381105-31381127 GACCCACTGCTGCCAGTCCAAGG - Intergenic
1165246476 19:34500914-34500936 GCCGCCCTGCTCCCTCTTCCAGG + Exonic
1165378585 19:35461410-35461432 TACACCCTGCTGCCCCTTCCTGG - Intergenic
1165737402 19:38185415-38185437 TACACACTGCTTCCTCTGCCTGG + Intronic
1166048245 19:40242312-40242334 GACCCACTGCAGGTTCGTCCTGG - Intronic
1166745827 19:45141460-45141482 GAGCCTGAGCTGCCTCTTCCTGG - Intronic
1167468131 19:49660928-49660950 GGCCCTCTGCTGCCTCGACCAGG + Intronic
1167498415 19:49832096-49832118 GGGCCACTGCTCCGTCTTCCTGG - Exonic
1167696048 19:51016109-51016131 GACCACCTGCTGCTTCTTCAGGG - Exonic
1167732152 19:51266134-51266156 GACTCGCTGCTGCCTTTTCCAGG - Intronic
1168094248 19:54105669-54105691 ACCCCACTGCTGCCTCCTCCAGG + Intronic
1168292503 19:55363302-55363324 GACACACAGGGGCCTCTTCCAGG + Intergenic
925128232 2:1476878-1476900 CAACCCCTGCAGCCTCTTCCAGG + Intronic
925503220 2:4530060-4530082 CAGCCTCTGCTGTCTCTTCCAGG - Intergenic
926105191 2:10145572-10145594 GACTCACAGCAGCCTCTGCCTGG - Intronic
926306495 2:11640624-11640646 CACCCACTGCGGAGTCTTCCTGG - Exonic
927222755 2:20729163-20729185 GACCTCCTACTGCATCTTCCAGG - Intronic
927289964 2:21395541-21395563 GTCCCAGAGCTGCCTCTTCCTGG - Intergenic
927819065 2:26246412-26246434 GGCTCACTGCAGCCTCCTCCCGG + Intronic
927844186 2:26462952-26462974 TACCACCTCCTGCCTCTTCCAGG + Intronic
929823035 2:45288727-45288749 GACTCACTGCTGTCATTTCCGGG - Intergenic
930543280 2:52734675-52734697 GAACCCCTGCTGCCTCTGACAGG - Intergenic
931652727 2:64483103-64483125 GTCCCAGCGCTGCCACTTCCTGG + Intergenic
931709236 2:64974011-64974033 GACACACTGCTACCTATTCTTGG - Intergenic
932239766 2:70147423-70147445 GACCCATTTCTGCCTCTCTCTGG - Intergenic
932446600 2:71785626-71785648 AAGCCACAGCTGCCTCTTCCAGG - Intergenic
932822910 2:74916512-74916534 CACCCACTGTTTCTTCTTCCTGG - Intergenic
933297409 2:80506248-80506270 GCCCAAGTGCTGCCTCCTCCAGG - Intronic
934561257 2:95314720-95314742 GAACCCCTGCTGCCTCCTGCTGG + Intronic
934663858 2:96157108-96157130 GCACCAATGCTGCCTCCTCCAGG + Intergenic
935125200 2:100216808-100216830 CACCCACTGCCACCTCTTCTTGG - Intergenic
936027616 2:109045671-109045693 GACCCAGTGCTGCCACTTCCCGG + Intergenic
936062721 2:109306233-109306255 GCCCCACTGCTGACACTTCCTGG - Intronic
936166630 2:110126279-110126301 GTCTCACGGCTGCCTGTTCCAGG + Intronic
936892855 2:117392586-117392608 GAGCCACAGCAGCCACTTCCAGG - Intergenic
937255825 2:120554776-120554798 TACCCACTGCTGTCTTTCCCTGG - Intergenic
937262922 2:120597899-120597921 GACCCTCTGCAGCCTCTGCCTGG - Intergenic
937911689 2:127078717-127078739 TCCCCACTGCTGCCCCTCCCTGG + Intronic
938103607 2:128514605-128514627 GACCCACTGCTGCCCAGTCCCGG + Intergenic
938115255 2:128598141-128598163 AACACCCTGCTGCCTTTTCCTGG - Intergenic
938480206 2:131657030-131657052 GCCCCACCCCTGCCTCTCCCTGG - Intergenic
938930403 2:136081784-136081806 GACACAGAGCAGCCTCTTCCTGG - Intergenic
939281939 2:140074949-140074971 GACCCAGTGATCCCTCTTCTGGG - Intergenic
940055536 2:149509079-149509101 AATCCACTGCTACCCCTTCCTGG - Intergenic
941866659 2:170342458-170342480 CTTCCACAGCTGCCTCTTCCTGG - Intronic
942800833 2:179873392-179873414 GACTCACTGCAACCTCTGCCAGG - Intergenic
943993455 2:194728993-194729015 GAACCTCTGCTGCATCTTCTAGG - Intergenic
945232508 2:207607312-207607334 GGCACACTGCAGCCTCTGCCTGG - Intronic
946249156 2:218402413-218402435 AGCCCACCACTGCCTCTTCCTGG - Intronic
946865642 2:224039227-224039249 GCGCCACCGCTGCCTCTTTCCGG - Intronic
947488716 2:230575684-230575706 GAGCCACTTCTCCCTCTCCCAGG + Intergenic
948135789 2:235635200-235635222 GACCCACTGCTGCCACACACAGG - Intronic
948225406 2:236305906-236305928 GATCCACTGCTGTCTCTTCGTGG + Intergenic
948279360 2:236734666-236734688 GATCCTTTCCTGCCTCTTCCTGG - Intergenic
1168750222 20:276901-276923 GGCCCCCAGGTGCCTCTTCCTGG + Intronic
1168790486 20:572766-572788 CACCCACTGCTCCCTCTGCCTGG - Intergenic
1169134850 20:3190999-3191021 CTCCCACTGCTGCCACCTCCAGG + Intronic
1170238078 20:14130470-14130492 GACTCACTGCAACCTCCTCCTGG - Intronic
1171149125 20:22811246-22811268 ATTCCATTGCTGCCTCTTCCTGG + Intergenic
1171154323 20:22858623-22858645 TACGCACTGCTCCCTCTGCCTGG - Intergenic
1171458810 20:25287023-25287045 GACTCCCTGCTGCCTCACCCAGG + Intronic
1171797072 20:29574957-29574979 GACCCCCTGCTGACTCTTAGAGG + Intergenic
1171851178 20:30309207-30309229 GACCCCCTGCTGACTCTTAGAGG - Intergenic
1172775384 20:37403894-37403916 GACCCTCTGCCGCTGCTTCCAGG + Exonic
1173403564 20:42745567-42745589 GAAACACTGCAGCCTCTGCCTGG - Intronic
1175701070 20:61137533-61137555 GCCCCGCTGCTGAATCTTCCAGG + Intergenic
1175738274 20:61402464-61402486 GGCTCACTGCAGCCTCCTCCCGG + Intronic
1175821137 20:61909543-61909565 GAACCCTTCCTGCCTCTTCCGGG + Intronic
1175913892 20:62416803-62416825 GAACTCCTGCTGCCGCTTCCTGG + Exonic
1176239043 20:64067495-64067517 GACTGAAGGCTGCCTCTTCCTGG + Intronic
1176715295 21:10344592-10344614 TTCCCATTCCTGCCTCTTCCTGG + Intergenic
1179403142 21:41102661-41102683 GACCCACAGCTCCTTCTCCCAGG - Intergenic
1179521955 21:41951471-41951493 GGGACACTGTTGCCTCTTCCAGG + Intronic
1179525063 21:41970791-41970813 GCCCCACTGCTCCTTCTGCCAGG - Intergenic
1180139479 21:45884007-45884029 GGCTCACTGCAGCCTCTTCTGGG + Intronic
1180156940 21:45982488-45982510 GACGTCCTGCTGCCTTTTCCCGG + Intronic
1180603053 22:17035362-17035384 TTCCCATTCCTGCCTCTTCCTGG - Intergenic
1181102537 22:20551050-20551072 CACCCACGGCTGCCTCTGACAGG + Intronic
1181989829 22:26829040-26829062 CACTCACTGCTTCCTCTTCTTGG - Intergenic
1182344147 22:29648533-29648555 GACACACCGCTGGCTGTTCCAGG + Intronic
1182636055 22:31727905-31727927 GGCTCACTGCAGCCTCCTCCTGG - Intronic
1182660628 22:31922543-31922565 AATCAACAGCTGCCTCTTCCAGG - Intergenic
1182837050 22:33350660-33350682 GAAGCACAGCTGCCTCTCCCAGG - Intronic
1183732291 22:39625385-39625407 GACCCACACTTGCATCTTCCTGG - Intronic
1183754434 22:39747059-39747081 GACTCACTGCAGCCTCAACCTGG + Intronic
1183912584 22:41091217-41091239 TACCCACTGCCGGCTGTTCCGGG - Intergenic
1183974818 22:41505545-41505567 GCCACACTGCTGCCTCTTCGTGG + Intronic
1184162251 22:42703938-42703960 GACCCACCTCTGCCCCTCCCTGG + Intronic
1184461197 22:44639185-44639207 AAGCCACTGCTGCCTGTTCCGGG + Intergenic
1184489062 22:44798955-44798977 GACCCACACCTGCACCTTCCAGG - Intronic
1184828545 22:46969647-46969669 GAGCCTCTTCTGCCTCCTCCAGG + Intronic
1184920411 22:47601569-47601591 GGGCCACTGCTGTGTCTTCCTGG + Intergenic
1185043138 22:48515864-48515886 GGCCCACTGCTGGCTCCCCCAGG + Intronic
1185261825 22:49870339-49870361 GACCCAGTGATGCCACTACCAGG - Intronic
1185276947 22:49953931-49953953 CACCCACAGGTGCCCCTTCCTGG + Intergenic
1185359940 22:50400093-50400115 GACCCACTGCTGCTTCCCACTGG - Intronic
949982209 3:9508883-9508905 TTCCCACTCCTGCCTCTTGCTGG - Intronic
950132279 3:10555433-10555455 GAGCAAATGCTGCCTCCTCCGGG + Intronic
950569458 3:13791010-13791032 AAGCCACTGCTGACTCTACCGGG - Intergenic
952217823 3:31295252-31295274 GATCCCCTGCAGCCTCTTCCAGG - Intergenic
952763990 3:36939500-36939522 GTCCCACTGTTCTCTCTTCCAGG + Intronic
953739693 3:45526996-45527018 GACCCACTTGTGTCTCTACCTGG - Intronic
954106568 3:48412718-48412740 TACCCCCAGCTGCATCTTCCTGG - Intronic
954275034 3:49536388-49536410 GAACAACTGGTGCCTCTTCTGGG + Intergenic
954460230 3:50622402-50622424 GCCCCAGTGCCACCTCTTCCAGG + Intronic
954753505 3:52826767-52826789 TACCTGCTGCTACCTCTTCCAGG - Intronic
957959461 3:87230623-87230645 AACCCACTCCTGACTCTCCCTGG + Intronic
961033804 3:123628603-123628625 GTCCCACTGCTCCCTTTCCCTGG + Intronic
961601102 3:128062668-128062690 GACCACCTGCTACATCTTCCTGG - Intronic
961607174 3:128104924-128104946 GCCCCTCTGCCACCTCTTCCAGG - Exonic
962527850 3:136252226-136252248 GACCCACTAATTCCTCTTCTGGG - Intronic
962736518 3:138329953-138329975 GACTCCCTCCTGCCTCTCCCTGG - Intergenic
963348064 3:144119730-144119752 TACCCATAGCTGCCTCTTCCTGG - Intergenic
963363517 3:144305379-144305401 GACCCACTGATCATTCTTCCAGG - Intergenic
965609228 3:170527056-170527078 GACCCAGTGCAGCCTTCTCCTGG + Exonic
968222059 3:196947022-196947044 CTCCCACTGCTGCCTCTCCTGGG - Exonic
968645154 4:1736950-1736972 GAGCCAGTGCTGCCTCATCAGGG - Intronic
969853742 4:9982668-9982690 GATCCACTGCAACCTCATCCAGG + Intronic
970598285 4:17619586-17619608 GCCCCACTGTGGCCTCTTGCTGG - Intronic
973967739 4:56181278-56181300 CACCCACTGCTTCCTCTACCTGG - Intronic
974107182 4:57483420-57483442 GACCCACTACTTTCACTTCCGGG + Intergenic
974169832 4:58251862-58251884 GACCCAATTCTTCCTGTTCCAGG - Intergenic
975164264 4:71160230-71160252 GACCCAATACTCTCTCTTCCTGG + Intergenic
976052684 4:81028017-81028039 CATCCATTGCTCCCTCTTCCTGG + Intergenic
976842754 4:89451104-89451126 CACCAACTGCTGCCTCTGCCTGG - Intergenic
976855305 4:89597587-89597609 AAGGCACTGCAGCCTCTTCCTGG - Intergenic
978180031 4:105782655-105782677 GGCTCACTGCTACCTCCTCCTGG + Intronic
978841051 4:113212855-113212877 TGCCCACTGCTGCCTTTTCTTGG + Intronic
980698249 4:136388963-136388985 GGCTCACTGCAACCTCTTCCAGG + Intergenic
981645233 4:146991427-146991449 TACCCACTGAAGCCTCCTCCAGG - Intergenic
982746955 4:159114026-159114048 GGCTCACTGCAGCCTCGTCCTGG + Intronic
983353951 4:166631459-166631481 GACCCACTGCAGCCTGGACCTGG - Intergenic
985628178 5:1000929-1000951 GACCCACTCCTTCCCCTGCCCGG - Intergenic
985676664 5:1234929-1234951 GACCCACTGCAGCCCATTTCTGG - Intronic
985852206 5:2397174-2397196 GTCCCACTGCCTCCTCTCCCAGG + Intergenic
989396495 5:40962778-40962800 GCCCCAGTGGTGCCTCTTCATGG + Intronic
989424280 5:41277992-41278014 TCCCCACTGTTGCCTCTTCGAGG - Intergenic
990471173 5:56117023-56117045 GACCCACTACTTCCTCTTCTAGG - Intronic
990863378 5:60353132-60353154 GAGGAACTGCTGCCTCTTCTGGG + Intronic
993484712 5:88468773-88468795 GACCCTGTCCTTCCTCTTCCTGG + Intergenic
993634825 5:90331312-90331334 AACCCACTGCTGCCACCACCAGG - Intergenic
996035322 5:118752184-118752206 GACATCCTGCTGCATCTTCCTGG - Intergenic
997565552 5:134883354-134883376 CACTCACTGCTACCTCCTCCTGG - Intronic
997745561 5:136297050-136297072 CCCCCACTGCTTCCTCTTTCTGG + Intronic
998416917 5:141952834-141952856 GAAACACTGCTTCCTCCTCCTGG + Intronic
1000195479 5:158953397-158953419 GTCCCTCTGCTGCCTTTTCCTGG - Intronic
1001482208 5:172096235-172096257 CACCCCCTGCTGCCTCACCCCGG + Intronic
1001924370 5:175625610-175625632 GCCCCACTGGTCCATCTTCCTGG - Intergenic
1002290327 5:178196036-178196058 GAGCCACTGCTGCCTCTCAGAGG + Intergenic
1002570509 5:180137044-180137066 CGCCCTCTGCTGCCGCTTCCCGG - Intronic
1002782337 6:377009-377031 AAACCACAGCTTCCTCTTCCTGG - Intergenic
1002900340 6:1405461-1405483 GGGGCACTGCTGCCTCTCCCAGG - Intergenic
1002985960 6:2191008-2191030 CCCCCAGTGCTGCCTCCTCCTGG - Intronic
1003062758 6:2875780-2875802 GGCTCACTGCAGCCTCTCCCGGG - Intergenic
1003244102 6:4369756-4369778 AACTCACTGCTTCCTCTTACAGG - Intergenic
1003359811 6:5414124-5414146 TAACCACTGCTGCCTCTGTCGGG - Intronic
1003579376 6:7325930-7325952 GGCTCACTGCAGCCTCCTCCTGG + Intronic
1004965871 6:20850510-20850532 GGCTCACTGCAGCCTCCTCCTGG + Intronic
1005460962 6:26070122-26070144 GGCTCACTGCAGCCTCCTCCTGG + Intergenic
1007133091 6:39495338-39495360 TACCAAGTGCTTCCTCTTCCAGG - Intronic
1007211962 6:40199937-40199959 GACCCAGTGATACCTCTTCTGGG - Intergenic
1007305095 6:40897598-40897620 GGCCCACTGCTGCCTCTGCCTGG + Intergenic
1007722238 6:43891833-43891855 AACCCACTGCTGCGCCTTCTTGG + Intergenic
1007916866 6:45569349-45569371 AAGCCACTGCTCCCTCTTCTCGG - Intronic
1009930523 6:70172362-70172384 GACCTGCTGTTTCCTCTTCCTGG - Intronic
1009995509 6:70891037-70891059 GACTCACTTCAGCCACTTCCAGG - Intronic
1014281918 6:119450918-119450940 CACACACTGCTTCCTCTACCTGG + Intergenic
1014494464 6:122103704-122103726 GACTCACTGCAGCCTCAACCCGG + Intergenic
1014625339 6:123718340-123718362 GTCTCTGTGCTGCCTCTTCCAGG + Intergenic
1014726510 6:124978251-124978273 TGGCCACTGCTGCCTCTGCCTGG + Intronic
1014935082 6:127377266-127377288 GTCCCACTGTGGCCTCTTTCAGG - Intergenic
1015601907 6:134918525-134918547 GACCAACTGCTGGCTCATCAGGG - Exonic
1015818489 6:137235004-137235026 TATCCACTTCTGCCTCTTTCTGG + Intergenic
1017437807 6:154433880-154433902 GGCCCACTGCTGTCTGTTCCTGG - Intronic
1018497278 6:164361717-164361739 GACCTACTGCTGCCCCTTTAAGG + Intergenic
1018971567 6:168533044-168533066 GACCTACTGCTGCCTGTCACAGG - Intronic
1019137846 6:169922339-169922361 GACCCACTCGTGCCTCTGCCAGG - Intergenic
1019139394 6:169934061-169934083 GGTCCACTGAGGCCTCTTCCTGG - Intergenic
1019564786 7:1673922-1673944 GACCCCCTCCTGCCTCAGCCTGG - Intergenic
1019587384 7:1812968-1812990 GCCCCGCCTCTGCCTCTTCCCGG + Intergenic
1019604611 7:1902163-1902185 GCCCCACACCTGCCTCCTCCTGG + Intronic
1019910389 7:4096907-4096929 GAGCCCAGGCTGCCTCTTCCTGG - Intronic
1020177531 7:5895019-5895041 GGGCCACTGCTACCTCCTCCTGG + Intergenic
1020305384 7:6829927-6829949 GGGCCACTGCTACCTCCTCCTGG - Intergenic
1022319292 7:29273535-29273557 GACCCAGTGATCCCTCTTCTGGG - Intronic
1024459595 7:49646652-49646674 GACCCACTGTTAACGCTTCCCGG - Intergenic
1024664856 7:51536354-51536376 CACCCACAGCTGCCCCTTCCCGG + Intergenic
1025806539 7:64838649-64838671 GGCCCTCCGCTGCCTCATCCAGG + Intergenic
1025998964 7:66546465-66546487 GACCCACTGCAGCCTCAACAGGG + Intergenic
1026101596 7:67388744-67388766 GACCGACAGCTGTCTCTTCCTGG + Intergenic
1026537489 7:71252013-71252035 GTGCCCCTGCTGCCTCCTCCGGG + Intronic
1026973973 7:74485192-74485214 GCCCCACTGCTGCCTCCCCTGGG - Intronic
1029081308 7:97975982-97976004 GGGCCACTGCTACCTCCTCCTGG - Intergenic
1029159237 7:98540035-98540057 GACCAAGTGCTGCCTCCTTCAGG + Intergenic
1029296491 7:99544205-99544227 GGCTCACTGCAGCCTCCTCCAGG - Intergenic
1029315866 7:99713222-99713244 CACAGACTGCTGACTCTTCCTGG + Intronic
1034432223 7:151046774-151046796 GAGCCACTGCTGCCTCTTCCAGG - Intronic
1034734068 7:153412643-153412665 GGCCCTCCGCTGCCTCATCCAGG + Intergenic
1035013781 7:155745189-155745211 AACCCACTGTTGCCCTTTCCAGG + Exonic
1037375177 8:18219419-18219441 GACAGATTGCTGCTTCTTCCTGG - Exonic
1037513108 8:19603458-19603480 CACCCACTTCCGCCTCTGCCTGG + Intronic
1037806951 8:22063315-22063337 GAACTACTGCTGCAGCTTCCGGG + Intronic
1038216082 8:25562795-25562817 GAACCAGAGCTTCCTCTTCCAGG + Intergenic
1038535869 8:28352436-28352458 CACCCCCTGGTGTCTCTTCCTGG - Intronic
1039266296 8:35827632-35827654 GACTCTCTGCTGCCCCTTCCTGG + Intergenic
1039912090 8:41833928-41833950 GTCCCTCCGCAGCCTCTTCCTGG - Intronic
1040322931 8:46327583-46327605 GAGCCAGTGCTGGCTCCTCCTGG - Intergenic
1042075873 8:64994055-64994077 AACTTACTGCTCCCTCTTCCTGG + Intergenic
1042746563 8:72114176-72114198 AAACCACAGCTGCCACTTCCTGG + Intronic
1045248137 8:100460896-100460918 GCTTCACTGCTGCTTCTTCCAGG - Intergenic
1045480535 8:102588035-102588057 GATCCAATGCTACCTCCTCCAGG - Intergenic
1046189386 8:110772225-110772247 AAGCTCCTGCTGCCTCTTCCAGG + Intergenic
1046231117 8:111359771-111359793 GACCCACTGATTCTACTTCCAGG + Intergenic
1048620182 8:136124020-136124042 CACCCACTGGTGCCTGTTGCGGG - Intergenic
1048919329 8:139213521-139213543 GCCCCGCGGCCGCCTCTTCCTGG - Intergenic
1049265960 8:141668054-141668076 GAGCCCCTGCTGCAGCTTCCTGG - Intergenic
1051638428 9:19202587-19202609 GACCCACAGCTGCCTGACCCAGG - Intergenic
1052765665 9:32637860-32637882 GACCCACTAGTCCCTCTTGCAGG - Intergenic
1053788952 9:41672487-41672509 GACCCCCTGCTGACTCTTAGAGG - Intergenic
1054156187 9:61642280-61642302 GACCCCCTGCTGACTCTTAGAGG + Intergenic
1054177234 9:61883832-61883854 GACCCCCTGCTGACTCTTAGAGG - Intergenic
1054475958 9:65573281-65573303 GACCCCCTGCTGACTCTTAGAGG + Intergenic
1054660299 9:67696973-67696995 GACCCCCTGCTGACTCTTAGAGG + Intergenic
1054785638 9:69207568-69207590 GACCCAGTGATTCCTCTACCTGG - Intronic
1055816419 9:80212529-80212551 GGTGCAGTGCTGCCTCTTCCTGG - Intergenic
1056331666 9:85526174-85526196 GACCCAATGCTCCCTCTGACTGG + Intergenic
1057157652 9:92857830-92857852 GACTCACTGCAGCCTCGACCTGG + Intronic
1057215225 9:93224208-93224230 GACCCAGTTCTGCCCCTTCAAGG + Intronic
1057234319 9:93346487-93346509 GATCCACTGCTTCCTCCTCTCGG + Intergenic
1057279503 9:93699715-93699737 CACCCACTGCTGCTATTTCCTGG - Intergenic
1057698940 9:97349016-97349038 GCCCGCCTGCTGCCTCTTCCAGG - Intronic
1059407851 9:114112995-114113017 GTCCCAATGCCACCTCTTCCAGG - Intergenic
1060081019 9:120645375-120645397 GAATCACTGCTGCCTCTGCAAGG + Intronic
1060265726 9:122110538-122110560 CACCCAAAGCTTCCTCTTCCTGG + Intergenic
1061003943 9:127917779-127917801 GACACACTGCAGCATCTGCCTGG - Intergenic
1061908876 9:133712486-133712508 CCCTCACTGCTGCCCCTTCCAGG + Intronic
1062036034 9:134382979-134383001 GTCCCACTGCAGCCCCTTCTGGG - Intronic
1062202075 9:135308767-135308789 GATCCACGGCTGCCTCATCAGGG + Intergenic
1062413258 9:136435092-136435114 CACCCTCTCATGCCTCTTCCCGG - Intronic
1062658261 9:137615137-137615159 GACCCCGTGCTGCCTTCTCCAGG + Exonic
1188404982 X:29796912-29796934 CACTCACTGTTGCCTCTGCCTGG + Intronic
1188957696 X:36453544-36453566 GACTCACTGGTCCTTCTTCCTGG - Intergenic
1189134311 X:38533038-38533060 GACCCACTACTGCTCCTCCCTGG + Intronic
1190054949 X:47175931-47175953 GCCCCAGGGCTGCCTCTGCCGGG - Intronic
1190414446 X:50167267-50167289 GCCCCCTAGCTGCCTCTTCCTGG + Intergenic
1191905291 X:66081377-66081399 AACCCACCTCAGCCTCTTCCAGG - Intergenic
1197712472 X:129681410-129681432 GACCCACAGCTGCTTCTTTAAGG - Intergenic
1200279954 X:154768699-154768721 GAGCCACCGCGCCCTCTTCCAGG - Intronic
1201311076 Y:12598542-12598564 GGCCCACTGCTGGGTCTTTCAGG + Intergenic