ID: 1142197402

View in Genome Browser
Species Human (GRCh38)
Location 16:88745162-88745184
Sequence GCTGCCTCTTCCAGGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 490}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142197398_1142197402 -8 Left 1142197398 16:88745147-88745169 CCGCAGGGACCCACTGCTGCCTC 0: 1
1: 0
2: 0
3: 61
4: 417
Right 1142197402 16:88745162-88745184 GCTGCCTCTTCCAGGAGCCCAGG 0: 1
1: 0
2: 7
3: 58
4: 490
1142197393_1142197402 10 Left 1142197393 16:88745129-88745151 CCGGGGATCAGGCCACCTCCGCA 0: 1
1: 0
2: 0
3: 10
4: 207
Right 1142197402 16:88745162-88745184 GCTGCCTCTTCCAGGAGCCCAGG 0: 1
1: 0
2: 7
3: 58
4: 490
1142197392_1142197402 20 Left 1142197392 16:88745119-88745141 CCAGGCTGAGCCGGGGATCAGGC 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1142197402 16:88745162-88745184 GCTGCCTCTTCCAGGAGCCCAGG 0: 1
1: 0
2: 7
3: 58
4: 490
1142197397_1142197402 -5 Left 1142197397 16:88745144-88745166 CCTCCGCAGGGACCCACTGCTGC 0: 1
1: 0
2: 0
3: 21
4: 200
Right 1142197402 16:88745162-88745184 GCTGCCTCTTCCAGGAGCCCAGG 0: 1
1: 0
2: 7
3: 58
4: 490
1142197396_1142197402 -2 Left 1142197396 16:88745141-88745163 CCACCTCCGCAGGGACCCACTGC No data
Right 1142197402 16:88745162-88745184 GCTGCCTCTTCCAGGAGCCCAGG 0: 1
1: 0
2: 7
3: 58
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142197402 Original CRISPR GCTGCCTCTTCCAGGAGCCC AGG Intronic
900191344 1:1353575-1353597 GCTGGCCCAGCCAGGAGCCCAGG + Intronic
900262711 1:1740287-1740309 GCTGCCGCTGCCGGGTGCCCAGG + Intronic
900497348 1:2982039-2982061 GCTGCCTTTTCCAGGGTCACTGG + Intergenic
900504262 1:3021472-3021494 GAGGCCTCTTCCAGGGGGCCAGG - Exonic
900536092 1:3178490-3178512 GCGGCAGCCTCCAGGAGCCCCGG - Intronic
900674613 1:3877034-3877056 GCTCCCCTTTCCTGGAGCCCTGG + Intronic
900683265 1:3930853-3930875 GCTGCCGTTGCCAGCAGCCCCGG + Intergenic
900806161 1:4769631-4769653 GCTCCCCCTTCCTGGACCCCGGG + Intronic
901617644 1:10554467-10554489 CCTGCCTCTTCAAGGTGACCTGG - Intronic
901869644 1:12130465-12130487 GCTGCCTCTCCAAGGAGCCCGGG + Intronic
902133352 1:14282745-14282767 TCTGCCTGTTCCAGGAGCTCAGG + Intergenic
902562690 1:17287645-17287667 CCTGCGGCTTCCAGCAGCCCAGG + Intergenic
902698458 1:18155800-18155822 GCTGGGCCTTCCAGGAGGCCTGG + Intronic
902724598 1:18326268-18326290 GCTGCTTCTTCCCTGAGGCCTGG - Intronic
902824342 1:18962671-18962693 GCTGCCTCTACCGGGAGGCCTGG - Intergenic
903599238 1:24522689-24522711 TCTGCTTCTCCAAGGAGCCCAGG + Intronic
904874482 1:33643752-33643774 TCTGCCTATGCCAGGATCCCTGG - Intronic
904877915 1:33670881-33670903 GTTACCTCTCCCAGGAGGCCTGG - Intronic
905267702 1:36766083-36766105 GCTCCCCCTGCCAGGTGCCCAGG - Intergenic
905371903 1:37486841-37486863 GCTGGCTTTTCCAGGAGGCATGG - Intergenic
905880462 1:41460004-41460026 CCTGCCTCTTCCAGCTCCCCTGG + Intergenic
907300636 1:53484485-53484507 CCTGCCTCTTCCAGCAGATCAGG - Intergenic
907301617 1:53490356-53490378 GCTGCTTCTGCCACCAGCCCAGG + Intergenic
907744503 1:57199345-57199367 ACTGCCTCTTCCAGAGGCACAGG + Intronic
909169873 1:72282155-72282177 GCAGATTCTTCCCGGAGCCCCGG - Intronic
909398205 1:75194357-75194379 CCTGCCTCAAGCAGGAGCCCAGG - Intergenic
911733378 1:101312230-101312252 GCTGCTTCCTCCAGCAGCCTGGG + Intergenic
912435241 1:109656899-109656921 GCTGTCCCTTCCCTGAGCCCCGG + Intronic
912436951 1:109668612-109668634 GCTGTCCCTTCCCTGAGCCCTGG + Intronic
912439642 1:109688357-109688379 GCTGTCTCTTCCCTGAGCCCCGG + Intronic
912860480 1:113209668-113209690 GCTGCCTCTCCCAGGAGCACTGG - Intergenic
913257529 1:116967247-116967269 GCTGCCCCTGACAGGAGACCAGG - Exonic
913530280 1:119729160-119729182 TCTGCCTCTCTCAGGAGTCCAGG - Intronic
913532698 1:119743882-119743904 CCTGCCTCTGCCAGGAGGCCTGG - Exonic
915594562 1:156888699-156888721 CCGGCCCCTTCCAGGAGCCTAGG + Intergenic
915740842 1:158117222-158117244 ACAGACTGTTCCAGGAGCCCAGG - Intergenic
915748203 1:158181303-158181325 GCTGCCTCTCCCCGGAGCCAGGG - Intronic
916782030 1:168044056-168044078 ACTGCTTCTTCCTGAAGCCCAGG - Intronic
917119127 1:171630450-171630472 GCTGCTTCTTGCTTGAGCCCAGG + Intergenic
917680099 1:177356798-177356820 TCTGCCTCAACCATGAGCCCAGG - Intergenic
917843101 1:178998812-178998834 GCTGCCTGTTAGAAGAGCCCTGG + Intergenic
918795185 1:188885386-188885408 CCTTCCTCTCCCATGAGCCCTGG - Intergenic
919811482 1:201411551-201411573 GCTGCCTCTCCAGTGAGCCCCGG - Intronic
920401627 1:205680056-205680078 GCGGCCCCTCCCCGGAGCCCCGG - Intronic
920795023 1:209129429-209129451 GCTGCCTCTTCCGGGAGGTGAGG + Intergenic
920960195 1:210656815-210656837 GATGCCTCTTCCTGGTGCCCAGG + Intronic
922226274 1:223648549-223648571 GGCCCCTGTTCCAGGAGCCCAGG + Intronic
922342149 1:224666207-224666229 GATGCCCTTTCCATGAGCCCAGG + Intronic
922550501 1:226490884-226490906 ACTGCCTCATCCAGGGTCCCAGG + Intergenic
922717560 1:227885256-227885278 GCTGCCTGTTCCCTGTGCCCTGG + Intergenic
922784161 1:228274877-228274899 GGTGCCTGTGCAAGGAGCCCTGG - Intronic
923542829 1:234900972-234900994 GATGCCTCATCCAGAACCCCTGG + Intergenic
1062915790 10:1240571-1240593 GCTGCCTCCCCCAGGACCCTTGG + Intronic
1063168905 10:3488085-3488107 GGTGCCTCTTCTCGCAGCCCAGG - Intergenic
1063243276 10:4192901-4192923 GCTTCCTCCTCTAGGAGCACTGG - Intergenic
1063339808 10:5252526-5252548 GCTGCTTCTTCCAGGGACCCCGG + Intergenic
1063343923 10:5294125-5294147 GCTGCTTCTTCCAGGGACCCCGG - Intergenic
1063598029 10:7454916-7454938 ATTGCCTCTCCCGGGAGCCCTGG + Intergenic
1066203503 10:33164561-33164583 GCTGCATCTTCCTGTACCCCGGG + Intergenic
1066446826 10:35491422-35491444 CCAGCCTCTTCCAGGACCCCTGG + Intronic
1067992667 10:51232821-51232843 GCTGACACTTCTAGGAGCCAAGG - Intronic
1068673253 10:59744428-59744450 GCTGCCCCTTCCGGGAGGCGGGG + Intergenic
1069387356 10:67896218-67896240 GCCTCCTGTTCAAGGAGCCCAGG - Intronic
1070548236 10:77469669-77469691 GCTGCCTCAGCAAGGAGCCAGGG + Intronic
1070644979 10:78195495-78195517 GCCTCCTCTCCCAGGGGCCCTGG + Intergenic
1071521664 10:86335203-86335225 TCTGCCTCCTCCAGGATGCCAGG + Intronic
1072782802 10:98261743-98261765 GCTCCCTCATCCATGAGGCCTGG - Intronic
1073105771 10:101031413-101031435 GGTGGCAATTCCAGGAGCCCCGG - Exonic
1074203681 10:111261542-111261564 ACTGCCCCTCCCAGCAGCCCTGG + Intergenic
1074763153 10:116682542-116682564 GCTGCCTTTTCCATGAACACAGG + Intronic
1075576373 10:123580613-123580635 GCTGCCCCCTCCAGCTGCCCAGG + Intergenic
1076656140 10:132024949-132024971 TTTGCTTCTTCCAGGCGCCCAGG + Intergenic
1076725541 10:132411268-132411290 GCTGCCTCTTCGAAGTACCCTGG + Intronic
1076774146 10:132684839-132684861 GCGGCCTCACGCAGGAGCCCAGG - Intronic
1076789836 10:132771013-132771035 CCTGCCTCTTCCAGCAGCAGCGG - Intronic
1077196277 11:1282119-1282141 GCTGTTTCTCCCAGGAGCCCTGG - Intronic
1077226288 11:1440334-1440356 GCAGCCGCATCCAGGGGCCCAGG - Intronic
1077342987 11:2034290-2034312 GCTGCCTTCTCCAGGAAGCCAGG + Intergenic
1077394925 11:2316058-2316080 GCTGCCTTTCCCTAGAGCCCTGG + Intronic
1077679037 11:4222568-4222590 GCAGCCACTTCCAGAACCCCTGG - Intergenic
1077688474 11:4319209-4319231 GCAGCCACTTCCAGAACCCCTGG - Intergenic
1078108373 11:8372829-8372851 GCGGCCTCTTCCGGGGGCTCTGG + Intergenic
1078108481 11:8373410-8373432 TCTACCCCTACCAGGAGCCCTGG + Intergenic
1078340596 11:10495706-10495728 GCTGGATCATCCAGGTGCCCCGG + Exonic
1079333491 11:19552098-19552120 GCTGCCTTCTCCAGGGGCCCAGG - Intronic
1079370720 11:19849661-19849683 GTTGCCTCTTCCCTGGGCCCTGG + Intronic
1080060338 11:27949998-27950020 GCTTCTACTTTCAGGAGCCCTGG - Intergenic
1080739663 11:35052023-35052045 GCTGCCTCTCTTAGAAGCCCTGG + Intergenic
1081487594 11:43543779-43543801 TTTGCCTCTTCCAGCATCCCTGG - Intergenic
1081672386 11:44949549-44949571 TCCGCCTCTTCCTGGAGCCCGGG - Intronic
1081692580 11:45088284-45088306 GATGCCTCTCCCAGCACCCCTGG - Intergenic
1081693225 11:45092349-45092371 CCTGACTCCTCCAGGACCCCAGG + Intergenic
1081742988 11:45453971-45453993 GCTGGCTCTTCCAGGAGACCTGG + Intergenic
1083221946 11:61258551-61258573 GCTCCCTCCTGCAGGGGCCCTGG - Exonic
1083267467 11:61553439-61553461 GCTGCCCCTTCCCCGAGGCCAGG + Intronic
1083299047 11:61730738-61730760 GCAGCCCCTGCCCGGAGCCCTGG + Intronic
1084155511 11:67310703-67310725 GCTGGCTCACCCAGGAGCCTTGG - Intronic
1084266289 11:68007080-68007102 TTTGCCTCTTCAAGGAGCCAGGG + Intergenic
1084564685 11:69922221-69922243 GCTGCCCCTTCCAGGGACTCAGG + Intergenic
1084950066 11:72659928-72659950 ACTGCCTCTGCCAGGAACCAAGG + Intronic
1085523755 11:77152803-77152825 GATGCCTCCTCCAGGAAGCCAGG - Intronic
1086150956 11:83610140-83610162 GCTGCATAGTACAGGAGCCCAGG - Intronic
1087052063 11:93896255-93896277 GATACCTCTTCCAGGATCACGGG - Intergenic
1088133579 11:106526151-106526173 GACGCCTCTGCAAGGAGCCCTGG + Intergenic
1088601126 11:111477006-111477028 GCCACCTCTCCCAGGGGCCCTGG - Intronic
1088849907 11:113696058-113696080 GCTGACTCCTCCAGGAGAGCCGG - Intronic
1089879815 11:121762840-121762862 GCTGCCTGTTCGAGCAGCCTGGG - Intergenic
1089942707 11:122436290-122436312 GCTGCCTCTTCCCAGATGCCTGG + Intergenic
1090068585 11:123525058-123525080 TCTGCATCTTCTTGGAGCCCAGG + Intergenic
1090608938 11:128452909-128452931 TCTGTCTCTCCTAGGAGCCCTGG - Intergenic
1091240230 11:134047202-134047224 GCTGCCTCGGCCAGCAGCACCGG + Intergenic
1202825973 11_KI270721v1_random:89479-89501 GCTGCCTTCTCCAGGAAGCCAGG + Intergenic
1091707733 12:2710457-2710479 GCAACCTCTTCCTGGAGCCGAGG - Intergenic
1091711358 12:2742716-2742738 GCTGGCACGTCCAGGAGTCCAGG + Intergenic
1093979532 12:25460226-25460248 GCTTCGTCTTCTAGGGGCCCAGG + Intronic
1096405842 12:51343706-51343728 CCTTCCCCTTCCAGGGGCCCAGG + Intronic
1096514021 12:52146603-52146625 GATGCCACCTCCTGGAGCCCTGG - Intergenic
1098881966 12:75926411-75926433 TCTGGCTCTTCCTGGAGACCAGG + Intergenic
1099614138 12:84913014-84913036 GCGGCGTCTTCCCAGAGCCCGGG + Intronic
1099961334 12:89400094-89400116 GCTCCCAGTTCCAGGAGCTCTGG + Intergenic
1100349104 12:93761611-93761633 GCTGTGTCTTCTAGGAGCCCAGG - Intronic
1100721041 12:97358447-97358469 GGTTCCTCTTCCAGGAGGCAAGG - Intergenic
1101345519 12:103882658-103882680 GCAGCCTTGTCCAGAAGCCCAGG + Intergenic
1101822145 12:108192349-108192371 CCTGCCTCTTCCATTACCCCAGG - Intronic
1101999551 12:109548416-109548438 GCTGCCTCTCCCAGAGGCCACGG + Intergenic
1102482531 12:113233527-113233549 CCTTCCTGCTCCAGGAGCCCTGG + Intronic
1102655766 12:114481074-114481096 GCTGCCTGTTCAGGAAGCCCGGG + Intergenic
1103191631 12:119006641-119006663 GCTGCTTCCTTCAGGAGCCTGGG + Intronic
1103951113 12:124551675-124551697 GGAGTCTCTTCCAGCAGCCCAGG + Intronic
1104192324 12:126493977-126493999 ACTGCCTCTTCCAGCAGCATGGG - Intergenic
1104598438 12:130136128-130136150 GCTGCCCCTTAGAGGAGGCCTGG + Intergenic
1106543793 13:30713542-30713564 GCTGCCCCTCCCTGGAGTCCGGG - Intronic
1107315987 13:39132729-39132751 GCTGCTTCTTCCATGAGGCATGG - Intergenic
1108188935 13:47917400-47917422 GCTGCTTCTTACAGGTCCCCAGG - Intergenic
1110900126 13:80811700-80811722 GCTGCCTCTTCCAATATCCGAGG + Intergenic
1112388399 13:98961041-98961063 CCTGGCTCTTCCACTAGCCCAGG - Intronic
1112569645 13:100582187-100582209 GCTGTTTCTCCAAGGAGCCCTGG - Intronic
1113945691 13:114042912-114042934 GCTCCCTCTCCCTGCAGCCCCGG - Intronic
1114219878 14:20686700-20686722 GTTGCCTCTTCCTGGAGACGTGG + Intronic
1114269530 14:21092352-21092374 GCCGCTGCTTCAAGGAGCCCTGG - Exonic
1114710275 14:24770421-24770443 ACTGCTTCCTTCAGGAGCCCTGG - Intergenic
1116617241 14:47154789-47154811 TCTGCCTCTTCATGGCGCCCTGG - Intronic
1117089470 14:52235695-52235717 GCTGCCCATTCCAGGACCCTTGG - Intergenic
1117620129 14:57577037-57577059 ACTGCCTCTTCCAGGAAGCATGG + Intronic
1118760855 14:68879475-68879497 GCTGCCCCTTCCCAGTGCCCTGG - Intronic
1119004173 14:70908452-70908474 GCGGCCTCTCCCGGGAGCCCCGG - Intronic
1119314890 14:73685271-73685293 ACTGCCTCTTCCCTGATCCCTGG + Intronic
1120928980 14:89828014-89828036 GATAACTCTTCCAGGTGCCCTGG - Intronic
1121566556 14:94914466-94914488 GCTGCCACTTCCAGAGGGCCTGG + Intergenic
1121871020 14:97407456-97407478 GCTGCCATTTCCAGGAGTACTGG + Intergenic
1122090987 14:99340376-99340398 GCTTTCTCTTCCAGCAGCTCAGG - Intergenic
1122222704 14:100251156-100251178 TCTCCCTATTCCAAGAGCCCTGG - Intronic
1122255340 14:100472187-100472209 GATTCCTCTTCCTGGAGCCCTGG + Intronic
1122261008 14:100523027-100523049 ACTGGCTCTCCCAGGACCCCCGG - Intronic
1122281403 14:100624605-100624627 GCTCCCTCTTCTGGGATCCCAGG + Intergenic
1122814660 14:104306589-104306611 GCTGCTTCTGCCATGAGGCCTGG + Intergenic
1122905043 14:104797742-104797764 GCTGCCTCCTCCCAGAGCTCAGG + Intergenic
1123008971 14:105338118-105338140 GCTTCCTCCTCCAGGAAACCGGG - Intronic
1123105039 14:105837338-105837360 TCTGCCTGGTCCAGGATCCCTGG + Intergenic
1124252226 15:28114235-28114257 GCAGCCTTTGCCAGGCGCCCAGG - Intronic
1125501639 15:40243348-40243370 GCTGCCTCTTCCTGGTGACTCGG + Intronic
1126935344 15:53700881-53700903 GCTGCCTGTTCTAGAAGCCGTGG - Intronic
1127733353 15:61819855-61819877 GCTCCCTCTCCCCGGAGCTCAGG - Intergenic
1127931773 15:63601524-63601546 ACCGCCACCTCCAGGAGCCCCGG + Exonic
1128543885 15:68554820-68554842 GGGGCCTCTTCCTGCAGCCCTGG - Intergenic
1128646106 15:69380035-69380057 CCTGTCTCCTTCAGGAGCCCTGG + Intronic
1129087750 15:73114113-73114135 GCTGTCTGTCCCAGGTGCCCAGG - Intronic
1129116772 15:73368974-73368996 GCTGCCCCTTTAAGAAGCCCAGG - Exonic
1129228656 15:74184443-74184465 GCTGCCCCTTCCACCTGCCCTGG + Intronic
1130067254 15:80615101-80615123 GGTGCCTTTTCCAGGATGCCAGG + Intergenic
1130097136 15:80864144-80864166 GCTTACTGTTCCAGGACCCCAGG + Intronic
1130273401 15:82464090-82464112 GCTGCGTCTTCCACGTGGCCTGG + Intergenic
1130465752 15:84191461-84191483 GCTGCGTCTTCCATGTGGCCTGG + Intergenic
1130486941 15:84403363-84403385 GCTGCGTCTTCCATGTGGCCTGG - Intergenic
1130498513 15:84482075-84482097 GCTGCGTCTTCCATGTGGCCTGG - Intergenic
1130588041 15:85196057-85196079 GCTGCGTCTTCCACGTGGCCTGG + Intergenic
1130905245 15:88235549-88235571 GCTGCTCCTCCCAGGGGCCCAGG - Intronic
1131095499 15:89652213-89652235 GCAGCCTCTTCCAGGACACACGG + Intronic
1132309943 15:100849963-100849985 GCTGCCTCTTCCCGGGGACCCGG + Intergenic
1132581139 16:685168-685190 GCTCCCTCCCCCAGGAGCACTGG - Exonic
1134075620 16:11289327-11289349 GCTGTTTCTGCAAGGAGCCCTGG + Intronic
1134090743 16:11390455-11390477 GCTGCCTGTTGCAGGGCCCCTGG - Exonic
1136526599 16:30834996-30835018 GCTGCCTCCCCCGGGAGCTCTGG + Exonic
1136737383 16:32476548-32476570 GCTGCCTTCCCCAGCAGCCCAGG + Intergenic
1141667798 16:85474773-85474795 GCTCCCCCTTCCAGGGGTCCTGG - Intergenic
1141673044 16:85502882-85502904 GCTGCCTGTTCCAGGAGGCCAGG + Intergenic
1141681587 16:85547368-85547390 CCTGCCTCTTCCAGCACCCGGGG + Intergenic
1141950163 16:87334788-87334810 GCAGCATGTGCCAGGAGCCCTGG + Intronic
1142113541 16:88344752-88344774 GCGGCCCCTCCCAGGAACCCAGG - Intergenic
1142161009 16:88557590-88557612 ACGGCCTCTTCCAGGTTCCCAGG - Intergenic
1142197402 16:88745162-88745184 GCTGCCTCTTCCAGGAGCCCAGG + Intronic
1203015687 16_KI270728v1_random:353029-353051 GCTGCCTTCCCCAGCAGCCCAGG - Intergenic
1203034022 16_KI270728v1_random:626187-626209 GCTGCCTTCCCCAGCAGCCCAGG - Intergenic
1142854689 17:2723161-2723183 GCTGCCACTTCCAAGAAGCCAGG + Intergenic
1143153052 17:4818852-4818874 TCTCCCTCTCCCAGGGGCCCAGG - Intronic
1143158615 17:4854352-4854374 GCTGCCTCAGACAGGGGCCCTGG - Intronic
1143245107 17:5477966-5477988 GCTGTTTCTTCAAGGAGCCCTGG - Intronic
1143467512 17:7147614-7147636 GCTGCCTCCTTCAAGGGCCCAGG - Intergenic
1143686774 17:8523683-8523705 GGTGACCCTTCCAGGAGTCCAGG + Intronic
1143961606 17:10725837-10725859 GCTGCCTATACAAGGAGCCCAGG + Intronic
1144685331 17:17222371-17222393 GCTGCCTCTGTGAGGAGCACTGG - Intronic
1144789482 17:17849501-17849523 GCTGGCTCCTCAAGGAGCCATGG + Intronic
1147042659 17:37730477-37730499 ACTGCCTCTTCCAGGGCCTCTGG - Intronic
1147183564 17:38702063-38702085 GCAGCCTCTTCCCCGAGCCTGGG + Intergenic
1147442169 17:40453930-40453952 GCTCGCTCTGGCAGGAGCCCTGG - Exonic
1147791234 17:43015453-43015475 GCTGCCTCTTCCAACAGGGCGGG - Exonic
1148027049 17:44595595-44595617 GCTGCCTCTGCCAGCAGGACAGG + Intergenic
1148460231 17:47835567-47835589 GCTGCCTAGCCCAGGGGCCCCGG + Intronic
1148910189 17:50938367-50938389 GCCATCTCTCCCAGGAGCCCCGG + Intergenic
1150180126 17:63110578-63110600 GCTGCATCTTCCAGGAGGGAGGG + Intronic
1150383532 17:64739678-64739700 GCTGCCTCTTGCTGAAGCCTGGG + Intergenic
1150577487 17:66442970-66442992 GGTGACTCTGGCAGGAGCCCTGG + Intronic
1151562867 17:74879978-74880000 GCTTCCTCTGCCAGGTGCTCAGG + Intronic
1151678669 17:75613000-75613022 TCTGCCTCTGCCAGGACTCCAGG - Intergenic
1151983801 17:77529187-77529209 GCTGGCTGTTCCGGGGGCCCGGG + Intergenic
1152025012 17:77803174-77803196 GCTGCCTTTTTAAGGCGCCCTGG + Intergenic
1152033738 17:77859154-77859176 GCTGGCTCTCCCTTGAGCCCGGG - Intergenic
1152082585 17:78197592-78197614 GCTGACTCAGACAGGAGCCCAGG + Intronic
1152092367 17:78254200-78254222 GCTGCCGCCTCCACGACCCCCGG + Intergenic
1152449110 17:80365211-80365233 GCTGCCTCTTCCAGACCCCCTGG - Intronic
1152486854 17:80600184-80600206 ACAGCCTCTTCTGGGAGCCCAGG + Intronic
1152642902 17:81456603-81456625 GTGGCCACTGCCAGGAGCCCCGG + Intronic
1152920293 17:83063187-83063209 GCTGCCTCATCCTGGCGCCGCGG - Intergenic
1153003942 18:480885-480907 GCCGCCTCTTCCAGAAAGCCTGG - Intronic
1154197923 18:12279680-12279702 GCTGCCTCCTCCCTGAGGCCTGG - Intergenic
1155264966 18:24083229-24083251 GAAGACTCTTCCAGGAACCCAGG + Intronic
1156251900 18:35359629-35359651 GCTGCCACTTCCAGAGCCCCTGG - Intergenic
1156457850 18:37304802-37304824 GCTGCCCCTTCCATCAGCCCTGG + Intronic
1156478688 18:37422528-37422550 GCTCCCTCCTCCAGGCTCCCAGG - Intronic
1156919780 18:42507499-42507521 CCTTCTACTTCCAGGAGCCCAGG - Intergenic
1160076973 18:75686714-75686736 ACTGCTTCTTTCAGGAGCTCTGG - Intergenic
1161333742 19:3700169-3700191 GCCGCCGGTTCCAGGAGCCTGGG - Intronic
1161404090 19:4082080-4082102 CCTTCCTCCTCCAAGAGCCCAGG + Intergenic
1161428191 19:4216092-4216114 GCTCCGTCTTCCAGGGCCCCAGG - Intronic
1161545157 19:4876010-4876032 CTTGCCTCTTCCAGAACCCCTGG + Intergenic
1162310446 19:9903719-9903741 TCTGGCTATTCCAGGAGTCCAGG - Intronic
1162378536 19:10318731-10318753 TCTTCCTCCTCCAGGAACCCAGG + Intronic
1162496290 19:11025003-11025025 CCTTCCTCATCCTGGAGCCCAGG + Intronic
1163297361 19:16420997-16421019 GCTGGCTCTAACAGGAGGCCTGG - Intronic
1163427405 19:17246795-17246817 GATGTCTCTTCCAGGCGCCCTGG + Intronic
1163634680 19:18432545-18432567 GCGGTCTCTTCCAGGGGCCCAGG + Exonic
1164400991 19:27902053-27902075 GCTGCCGCTTCCAGGAAGCCTGG - Intergenic
1164446446 19:28321652-28321674 TCTGCCTCTTCCAGGCCACCAGG + Intergenic
1164579010 19:29422867-29422889 GCTGTCTCCTCCTGGAGCCAGGG - Intergenic
1164586760 19:29480607-29480629 CCTGCCTCTTCCTGGATTCCGGG - Intergenic
1164722818 19:30444698-30444720 GCCGGCGCTTCAAGGAGCCCTGG + Exonic
1164805140 19:31110523-31110545 GCTGCCTCCCACAGGAGCTCTGG - Intergenic
1164821088 19:31251711-31251733 GCTGCATCTTCCGGGGGCCTTGG - Intergenic
1165246481 19:34500922-34500944 GCTCCCTCTTCCAGGGCTCCTGG + Exonic
1165361230 19:35338154-35338176 GCCCCCTCTTCCAGATGCCCCGG + Exonic
1165371097 19:35406716-35406738 GCAACCTCTTCCCTGAGCCCAGG - Intergenic
1165710029 19:38004441-38004463 GCTGGCTGGTCCAGGAGCCTGGG + Intronic
1165733956 19:38164113-38164135 GCTGCCCCTGCCAAGAGCCGTGG - Intronic
1166072375 19:40394757-40394779 CCTGTCTCTGCCTGGAGCCCAGG - Exonic
1166976622 19:46608665-46608687 GCTACCACTTCCAGGAGGTCCGG + Intronic
1167317643 19:48774756-48774778 GCTGTTTCTCCAAGGAGCCCTGG + Intergenic
1167414673 19:49363784-49363806 CCGGCCTCACCCAGGAGCCCGGG - Exonic
1167452995 19:49583376-49583398 CCTTCCTCTTCCAGGAGTCCAGG + Intronic
1167474590 19:49692357-49692379 GATGCCTTTTCCAGGAGCGCAGG - Exonic
1167566282 19:50259238-50259260 GCATCCTCTTCCAGGAGTTCCGG + Exonic
1168288102 19:55344413-55344435 TCTGCCCCTTCCAGGACCCGTGG - Intronic
1168321527 19:55513115-55513137 GCTGGCACCACCAGGAGCCCAGG + Exonic
1168350640 19:55674053-55674075 GCCGCCTCTACCAGAAGTCCCGG - Exonic
1168630087 19:57949728-57949750 TGTGGCTCTTCCGGGAGCCCAGG - Intergenic
925184195 2:1836029-1836051 GCCTCCTCTTTCAGGATCCCAGG - Intronic
925274421 2:2638616-2638638 GCTTCCTCTTCCATCAGGCCTGG - Intergenic
925528284 2:4829481-4829503 TCTGTCTCTGCCAGGAGCTCTGG - Intergenic
926226166 2:10968341-10968363 GCTGCGTCCTCCAGACGCCCTGG - Intergenic
927496600 2:23555471-23555493 CCTGCCTCTCCCAGGTGCTCTGG + Intronic
927728400 2:25447300-25447322 GCTGCTTCTACCAGGTGCCTTGG + Intronic
928432774 2:31234399-31234421 GCTGCTGCATCCAGCAGCCCAGG - Exonic
928537175 2:32252032-32252054 GCTGTCTTTACCAGGAGGCCTGG + Intronic
928838712 2:35579433-35579455 GCTGACTCTTTAAGGAGCTCTGG + Intergenic
929756353 2:44768673-44768695 GCGGCCGCGTCCCGGAGCCCCGG - Intronic
929783544 2:44973170-44973192 GCTGCTTTTTCCAGGAGCAGTGG + Intergenic
932220355 2:69994481-69994503 GCTAGCTCTTCAAGGAACCCGGG + Intergenic
932303766 2:70687037-70687059 GCTGACTCATCCAGGAGCAACGG + Intronic
932462847 2:71894461-71894483 GGTGCCCCTTCTAGGCGCCCAGG + Intergenic
932839447 2:75067975-75067997 GCAGCCTCTTACCGGGGCCCAGG - Intronic
932878208 2:75474975-75474997 GCTTCCTTGACCAGGAGCCCAGG + Intronic
934041399 2:88130259-88130281 GCTCCCTCATGCAGGAGACCAGG + Intergenic
934165882 2:89293677-89293699 GCAGCCTACTCCAGGAGCCCAGG - Intergenic
934201395 2:89888779-89888801 GCAGCCTACTCCAGGAGCCCAGG + Intergenic
935138401 2:100328810-100328832 GCTGTTTCTCCAAGGAGCCCTGG + Intergenic
935147407 2:100405314-100405336 GCCTCATCCTCCAGGAGCCCTGG - Intronic
935492136 2:103734091-103734113 GCTTCCTCTTCCTTCAGCCCAGG + Intergenic
935739775 2:106137377-106137399 GCTGCTTCTACCTGCAGCCCTGG - Intronic
937319810 2:120954377-120954399 GCTGCATCTCCCAAGAGTCCGGG - Intronic
937369741 2:121288918-121288940 GCTGCCTCTGCAGGGACCCCGGG - Intergenic
938071277 2:128309760-128309782 GCTGCCTCTCACTGAAGCCCTGG + Intronic
938205811 2:129422039-129422061 GCTGCCTATTCCATGAGATCTGG - Intergenic
938256297 2:129862181-129862203 CCTGCCTCTCCCATTAGCCCTGG - Intergenic
938305726 2:130252982-130253004 GCTGCCTCTGGAGGGAGCCCGGG + Intergenic
938341475 2:130539358-130539380 GCGGCATCTTCCAGGTGCGCAGG - Exonic
938348355 2:130581351-130581373 GCGGCATCTTCCAGGTGCGCAGG + Intronic
938448420 2:131394802-131394824 GCTGCCTCTGGAGGGAGCCCGGG - Intergenic
941718580 2:168789067-168789089 GCTACTTCTTCAAGGAGCCCTGG - Intronic
942405427 2:175648629-175648651 AGTGCTTCTTTCAGGAGCCCTGG - Intergenic
944210075 2:197198009-197198031 GCTGCGTCTTTCAGGAGGCCAGG - Intronic
945080732 2:206085132-206085154 GCTGTCTCTCCGGGGAGCCCTGG - Intronic
945487745 2:210417468-210417490 GCTTCCTCTTCCTTCAGCCCAGG + Intergenic
947717574 2:232349607-232349629 GCTGCCTTTCTCAGGACCCCAGG + Intergenic
947767938 2:232649371-232649393 GAAGCCTTTTCCAGGAGACCTGG + Intronic
947812172 2:233011440-233011462 GCTGGCTCTACCAGGGGCGCAGG - Intronic
948147251 2:235716926-235716948 GCCGTCTCTCCCAGCAGCCCTGG + Intronic
948476227 2:238221489-238221511 CCTGCCGCTGCCAGGAGCCGGGG - Intergenic
948653301 2:239462375-239462397 GCTGGCTCTGTCAGGAGCTCAGG - Intergenic
948703256 2:239774020-239774042 AATGCCTCTTCCAGGACCCCCGG + Intronic
948732748 2:239977439-239977461 GCTGCCTCTTCTAGGTGTCTGGG - Intronic
948818178 2:240524196-240524218 GCGGCCACTTCCAGGACACCGGG - Exonic
948819237 2:240530183-240530205 GCGGCCACTGCCAGGTGCCCAGG + Intronic
948840616 2:240647107-240647129 GCTGCCTCTTCCTGGAGCCAAGG - Intergenic
1168767884 20:394460-394482 GCTGTCTCCTCCAGGAGGTCCGG - Intronic
1168914679 20:1476240-1476262 GCTACCTCTCGGAGGAGCCCTGG - Exonic
1168921185 20:1537549-1537571 CCTTCCTCATCCAGGAGCCCAGG + Intronic
1169557946 20:6769018-6769040 GCTCCCACTTCCAGCTGCCCCGG + Intronic
1170886050 20:20340610-20340632 GCTGCCTGTTCCAACAGCCCAGG - Intronic
1170952256 20:20947591-20947613 GATGCTTCTCCCAGGTGCCCTGG + Intergenic
1170996555 20:21365667-21365689 GCTGCCTGATCCAGGTGCACAGG - Exonic
1172788499 20:37486298-37486320 GCTGATTCTTCCAGGAGACATGG + Intergenic
1172997547 20:39082500-39082522 GCAGCCCCTTCCTGGAGCCCTGG + Intergenic
1173217231 20:41096440-41096462 GCTGCCTCTTTCAGGGAACCAGG - Intronic
1173261772 20:41442772-41442794 GCTGCCTATTCCATGAGCTTAGG - Intronic
1173850749 20:46216386-46216408 GCTGCCTCTGCCTAGATCCCTGG + Intronic
1173908652 20:46647570-46647592 GCTGCCGCTTCCAGCACCACTGG - Intronic
1174057846 20:47810716-47810738 GGAGCCACTTCCAGGACCCCTGG - Intergenic
1174168900 20:48604255-48604277 CCTGCCTCCTGCAGAAGCCCCGG - Intergenic
1174388690 20:50203308-50203330 GCCACTTCTCCCAGGAGCCCTGG + Intergenic
1174517575 20:51104552-51104574 GCTGAATCTTCCAGTAGCCCGGG - Intergenic
1174550828 20:51360295-51360317 GATGCCTCTCCCAAGACCCCAGG - Intergenic
1175350792 20:58316481-58316503 GGTCCCTCTTCCAGGATTCCAGG + Intronic
1175495960 20:59414453-59414475 CCTGCCTTTTCCAGGATCCAGGG + Intergenic
1175772040 20:61630047-61630069 GCTGCCTCTGCCAGGCTCCCTGG - Intronic
1176137795 20:63532489-63532511 GCTGCCTCCAGCAAGAGCCCCGG + Intronic
1176218354 20:63958636-63958658 GCCACCTCTTCCAGGCACCCTGG + Exonic
1176427612 21:6558540-6558562 GCTGCCTATTCCCGGGGCACAGG - Intergenic
1176512536 21:7759590-7759612 CCAGCCTTTGCCAGGAGCCCTGG + Intronic
1177161387 21:17551674-17551696 ACTGTCTCTTAAAGGAGCCCTGG - Intronic
1178561598 21:33643170-33643192 GCCGCCTCTGCCTGGAGCCCCGG + Intronic
1178646649 21:34390114-34390136 CCAGCCTTTGCCAGGAGCCCTGG + Intronic
1179052124 21:37896993-37897015 CCTGGCTCTGGCAGGAGCCCCGG - Intronic
1179703104 21:43166857-43166879 GCTGCCTATTCCCGGGGCACAGG - Intergenic
1179804718 21:43829918-43829940 ACTGCCTGTTTCAGGAGCACTGG - Intergenic
1179880964 21:44293199-44293221 GTGGGCTCTTCAAGGAGCCCAGG + Intronic
1179954369 21:44729950-44729972 GCTGCCTCGGTCAGGAGTCCCGG - Intergenic
1180028295 21:45181526-45181548 CCTGCCTCTTCCAGCAGCATGGG + Intronic
1180113080 21:45674847-45674869 GATCCCTGTTCCAGGAGCCGAGG - Intronic
1180133202 21:45841209-45841231 GCTGCATCTTCCAAGAGCGTGGG - Intronic
1180198183 21:46209617-46209639 GCTGTCTCTTCCAGGCGGGCGGG - Exonic
1181068217 22:20316492-20316514 CCTGCCTCCTCCAGCTGCCCTGG - Intronic
1181372073 22:22426542-22426564 GCAGCCTGTTCCAGGAACCAAGG - Intergenic
1182048589 22:27296323-27296345 TCTGCCTCCTCCATGAGCCACGG + Intergenic
1182563933 22:31183977-31183999 GCTGCCCCGTCCGGGAGCTCGGG - Intronic
1182677508 22:32051140-32051162 GCTGGCTCTGCCAGTAGTCCTGG - Intronic
1182903673 22:33919844-33919866 GCTGCCCCGGCCGGGAGCCCTGG - Intronic
1183294611 22:37022232-37022254 TCTGACTTTTCCAGGGGCCCAGG - Intronic
1184348365 22:43926498-43926520 TCTCCCACTTCCAGAAGCCCAGG - Intronic
1184509537 22:44925627-44925649 GCTGCCTCATCCAGTGGCCGAGG - Intronic
1184518665 22:44979243-44979265 GCTGCCTCTCTGAGCAGCCCTGG + Intronic
1184808730 22:46813965-46813987 GGTGCTCCTTCCAGGAGCCTTGG + Intronic
1184955491 22:47883513-47883535 GCTGCTTCCCCAAGGAGCCCAGG + Intergenic
1185015814 22:48341954-48341976 GCTGTCCCTTTCAAGAGCCCTGG - Intergenic
1185216164 22:49601078-49601100 GCAGTGTCTTCCAGGAGCCCGGG - Intronic
1185251263 22:49802784-49802806 GCTGTCCTTTCCAGGAGCCCTGG + Intronic
1185301564 22:50083796-50083818 GCTTCCTCTGCCAGGACCCTGGG - Intronic
1185416390 22:50712606-50712628 GCTGCCTCTTGCCCCAGCCCAGG + Intergenic
1203281722 22_KI270734v1_random:135168-135190 CCTGCCTCCTCCAGCTGCCCTGG + Intergenic
950650145 3:14402208-14402230 CCTGGCTGCTCCAGGAGCCCTGG + Intergenic
950689479 3:14644151-14644173 CCTGCCTCTCCCAGGAGACAGGG - Intergenic
950997566 3:17519117-17519139 ACTGCCTCTTCCCTGAGCCCTGG - Intronic
952232041 3:31442254-31442276 TCTGCCTCTTACAGTAGGCCAGG - Intergenic
953236288 3:41110397-41110419 GTCTCCTCTCCCAGGAGCCCAGG - Intergenic
953721871 3:45363344-45363366 GCTGCCCCTTCCAGGAGTTGTGG - Intergenic
953786401 3:45914895-45914917 GCTGCCTCTTCCAAGACCTTGGG + Intronic
954283477 3:49601205-49601227 GCTGCCTTTCTCTGGAGCCCAGG - Intronic
954364866 3:50140326-50140348 GCTGGCTCTTCCAAGGGCCAGGG - Intergenic
954418071 3:50403858-50403880 TCTGCCTCCTCCAGGAATCCTGG + Intronic
954452513 3:50579431-50579453 GCTGCCCCATCCAGGACTCCTGG - Intronic
955933502 3:64080489-64080511 GATGCCTCTTTCAGGAGCTGTGG - Intergenic
955952821 3:64259428-64259450 GCTGCCTCTTCCTGGGACCGAGG + Intronic
957051648 3:75416354-75416376 GCTGCCCCACCCAGTAGCCCGGG - Intergenic
960159167 3:114331240-114331262 CCTGCCACCTCCAGGAGACCTGG + Intergenic
961329959 3:126132520-126132542 TCGGCCTCTTCCAGGTGCTCAGG + Intronic
961361720 3:126372444-126372466 CCTGCCTCTGTCACGAGCCCTGG - Intergenic
961885239 3:130092532-130092554 GCTGCCCCACCCAGTAGCCCAGG - Intronic
962239895 3:133743476-133743498 ACTGCCTCTCCCAGGAAACCAGG - Intergenic
962252218 3:133842298-133842320 GCTGCCTCTCACAGGTGCCAGGG - Intronic
962955389 3:140261522-140261544 ACTGCTTCTCCAAGGAGCCCTGG + Intronic
966942641 3:184756621-184756643 GCTGCCCCTGCTCGGAGCCCAGG + Intergenic
968044524 3:195616596-195616618 TCTGGCTTATCCAGGAGCCCCGG - Intergenic
968060312 3:195722647-195722669 TCTGGCTTATCCAGGAGCCCCGG - Intronic
968261006 3:197324123-197324145 GCAGCCTCAGCCAGAAGCCCTGG - Intergenic
968857287 4:3135808-3135830 GCAGGCTCATCCAGGTGCCCTGG - Intronic
969052859 4:4385630-4385652 GGTGCCTCTGCCAGGAGCCTGGG + Intronic
969391739 4:6895911-6895933 GCTGCCACTCACAGGAGCTCTGG + Intergenic
969439489 4:7208785-7208807 GCTGCCTCTGCCCCGGGCCCTGG + Intronic
969653136 4:8479403-8479425 GCTGTCTCATCCATGAGCGCGGG - Intronic
970171094 4:13291184-13291206 GCTTCCTCTTCCTTCAGCCCAGG + Intergenic
970431753 4:15995180-15995202 GCTGCCTCTGCCAGAAGCAATGG + Intronic
970446748 4:16129597-16129619 GCTGCCTCTCCTAGGACACCAGG - Intergenic
970539180 4:17060172-17060194 GCTGCCTCCTCCACGTCCCCTGG - Intergenic
972841650 4:42937371-42937393 GCTGTTTCTTCAAGGAGCTCTGG + Intronic
975666887 4:76741481-76741503 GCTGCAGCCTCCAGGAGCCCGGG + Exonic
975759658 4:77606663-77606685 GCTACCTCTGCCGGGAGCCATGG - Intronic
981036487 4:140174887-140174909 GCTGTCTCTTCCAGGGTTCCAGG - Intergenic
981163093 4:141522306-141522328 TTTGCCTCTTTCAGGAGCCTGGG - Intergenic
984423840 4:179558501-179558523 CCAGCCTCATCCAAGAGCCCTGG - Intergenic
985566223 5:619394-619416 GGTGACCCTGCCAGGAGCCCAGG - Intronic
985848315 5:2370665-2370687 GCTGGCTCTTCAAGGACTCCTGG - Intergenic
986337030 5:6762963-6762985 GCCGCCTCTTCTAGGAGCCATGG + Intergenic
986992443 5:13569950-13569972 GCTTCCTCTTGCAGGAGCTAGGG + Intergenic
988661772 5:33278187-33278209 GCTGCTTCTTCAAAGATCCCTGG - Intergenic
988702027 5:33685146-33685168 TCTGCCCCTGCCAGGGGCCCAGG - Intronic
989716491 5:44468817-44468839 GCTTCCTCTTCCTTCAGCCCGGG + Intergenic
992030005 5:72711638-72711660 GCTGCCCCATGCAGAAGCCCTGG + Intergenic
992102218 5:73418944-73418966 GCTGCCTCTTCCAGCAATTCAGG - Intergenic
994631588 5:102294791-102294813 TCTTCCTCTTCAAGGAACCCAGG - Intronic
997404855 5:133637477-133637499 GCTGCAACTTCCATGAGCACAGG - Intergenic
998034415 5:138902007-138902029 ACTGCCTATTTCAGGAGGCCTGG - Intronic
998447875 5:142212213-142212235 GCTGCCCCTCCCAGAAGCCTGGG + Intergenic
998767169 5:145500980-145501002 ACTGCAGCTTCCAGGAGGCCAGG - Intronic
999096077 5:148979230-148979252 GCTGTCTCTGCCTGGAGCCATGG - Intronic
1000318973 5:160118965-160118987 GCTGCCTCAGCCCGTAGCCCCGG - Exonic
1001296340 5:170501910-170501932 GCTCCATCTTCCAGGATTCCAGG + Intronic
1001414374 5:171534350-171534372 ACTGCCTCTTTCAGAAGCCATGG + Intergenic
1001486070 5:172120406-172120428 GGTCCCTGGTCCAGGAGCCCTGG - Intronic
1001663094 5:173411198-173411220 GCTGCCTCTCCCAGCAGCCCAGG - Intergenic
1001725204 5:173890616-173890638 CCCTCCTCTTCCTGGAGCCCGGG + Exonic
1001783392 5:174390561-174390583 TCTGGCTCCACCAGGAGCCCTGG - Intergenic
1002572944 5:180154326-180154348 GGTGCCTCACCCAGGAGCCTTGG - Intronic
1003026366 6:2558916-2558938 GCAGGCTCTTCCAGGGGGCCAGG + Intergenic
1004501012 6:16210127-16210149 GCTGCTTCTTCCAGGGGTCTCGG + Intergenic
1004815931 6:19311793-19311815 GCTGCCTCCTCAAGCCGCCCTGG - Intergenic
1005187636 6:23180912-23180934 GCAGCCTCTTTCAATAGCCCAGG - Intergenic
1006838682 6:37014632-37014654 CCTGCCCCTTTCAGAAGCCCTGG + Exonic
1007341114 6:41192123-41192145 CCTGCCTCCACCAAGAGCCCTGG + Exonic
1007421847 6:41724418-41724440 CCTGCCTTCTCCAGGAGCCACGG - Intronic
1007506253 6:42337511-42337533 GCTGCCTCTCCCAGTAGACTTGG - Intronic
1007638710 6:43318414-43318436 TCTGCCTGTTCCAAAAGCCCAGG - Intronic
1007789923 6:44303026-44303048 GCTGCCTGGCCCAGGGGCCCCGG - Intronic
1007850426 6:44797665-44797687 GCTTCCTTTTCCAGGAACCAAGG - Intergenic
1010210917 6:73362547-73362569 GCCTCCGCCTCCAGGAGCCCCGG - Intergenic
1011660465 6:89589967-89589989 GCTGCTTCCTCAAGGGGCCCTGG - Intronic
1013196369 6:107848330-107848352 GCTGCCTCTTCTTGGAGTCCCGG - Intergenic
1014795808 6:125722845-125722867 GCTCCCTCTTCCATGATACCAGG + Intergenic
1015114246 6:129629513-129629535 GATGCCTCGTCTAGGGGCCCGGG + Exonic
1016467324 6:144338695-144338717 GGTGGCTCTGCCAGGAGACCAGG + Intronic
1018040107 6:159914589-159914611 GCTGCATTTTCCACGAGCCTAGG - Exonic
1018305715 6:162453145-162453167 CCTGCCACTTCCAGGTTCCCCGG + Intronic
1018692611 6:166360786-166360808 GCTGGCTCTGCCTGCAGCCCTGG - Intergenic
1018810163 6:167293247-167293269 GCTCCCACTTCCACCAGCCCAGG - Intronic
1018947193 6:168356164-168356186 GCTGCCTCTTTCTGGAGCCCTGG - Intergenic
1019034231 6:169041280-169041302 TCTGCCACTCCCAGCAGCCCGGG - Intergenic
1019317072 7:391721-391743 GCTGCCCCTGGCAGGGGCCCGGG + Intergenic
1019344497 7:522710-522732 GCTGCTTCCGCCAGGGGCCCCGG - Intergenic
1019929238 7:4212599-4212621 GCAGCCTCGTCCAGGCCCCCTGG - Intronic
1020210923 7:6157815-6157837 GCTGCCCCTGCCAGGTGTCCTGG + Intronic
1020255598 7:6501628-6501650 AGAGCCTCTTCCAGGACCCCTGG + Intronic
1020265250 7:6556260-6556282 CCAGCCTCTCCCAGGAGGCCTGG + Intergenic
1020601308 7:10277589-10277611 GCAGCCCCTTCCAGGAGGCCTGG - Intergenic
1020671267 7:11116281-11116303 GCTGTTTCTCCAAGGAGCCCAGG + Intronic
1021133181 7:16935530-16935552 TCTGCCTCTCCCAGGTGCCAAGG + Intergenic
1022193603 7:28042025-28042047 GCTGCCTCTTTTAGGCACCCAGG - Intronic
1023830051 7:44034035-44034057 GCTGGCCCCTCCAGGAGCTCTGG - Intergenic
1023986672 7:45101120-45101142 CGGGCCTCTCCCAGGAGCCCAGG - Intronic
1024378474 7:48666334-48666356 GCTATTTCTTCCAAGAGCCCTGG - Intergenic
1025207309 7:57001241-57001263 GCGGCCCCTGGCAGGAGCCCGGG - Intergenic
1025664628 7:63575645-63575667 GCGGCCCCTGGCAGGAGCCCGGG + Intergenic
1026133088 7:67636579-67636601 GCTGCCACCTCCAGCAGCCCTGG + Intergenic
1029479129 7:100802343-100802365 GCTGGCTCTGCCAAGAGCCTGGG - Intergenic
1029740365 7:102488322-102488344 GCTGGCCCCTCCAGGAGCTCTGG - Intronic
1029758361 7:102587494-102587516 GCTGGCCCCTCCAGGAGCTCTGG - Intronic
1029776299 7:102686573-102686595 GCTGGCCCCTCCAGGAGCTCTGG - Intergenic
1030675881 7:112384873-112384895 GCAGCCACTTCCAGGAGACTTGG + Intergenic
1033950769 7:146781603-146781625 GCTGCCTCTTACAGGCTCCCAGG + Intronic
1034439974 7:151081430-151081452 CCTGCCTCTTCCCGCCGCCCTGG - Exonic
1034529704 7:151688049-151688071 GCTGACTCAGCAAGGAGCCCGGG - Intronic
1034695271 7:153047929-153047951 GCTGGTGCTCCCAGGAGCCCAGG + Intergenic
1034897780 7:154888510-154888532 GCTGCCTCGGCCAGGAGCTCTGG - Intronic
1035071042 7:156145113-156145135 GCCGATTCTTCCAGGAGCCCAGG + Intergenic
1035075977 7:156177837-156177859 GCTCCCTCTTTCAAGAGACCTGG - Intergenic
1035520653 8:273475-273497 CATGCTTCTTCCAGGACCCCTGG + Intergenic
1035567526 8:651379-651401 GCTGCTTCTCCAAGGAGCCCTGG - Intronic
1035752886 8:2008352-2008374 GCTGCATCCTCCAGGAGTCCTGG - Intergenic
1035753198 8:2009829-2009851 GCTGCATCCTCTAGGAGTCCTGG - Intergenic
1036381703 8:8240095-8240117 GCTGCCCCACCCAGTAGCCCAGG + Intergenic
1036685641 8:10908173-10908195 GCAGCCTCTTCCTGGAGCATGGG - Intronic
1037245823 8:16833769-16833791 ATTGCCTCTTCCAGGAAGCCTGG - Intergenic
1037618468 8:20542705-20542727 CGTGGCTCTTCCTGGAGCCCAGG - Intergenic
1037817736 8:22120728-22120750 TCCACCTCTTCCAGGAGCACTGG - Exonic
1037985205 8:23286672-23286694 GCTGCCTAGTCCAGGGACCCTGG + Intronic
1037990330 8:23317106-23317128 GTTGGTTCTTCCAGGAGACCTGG - Exonic
1038777932 8:30547709-30547731 GGTGGCTCTTCTGGGAGCCCAGG - Intronic
1039489968 8:37940122-37940144 CCTGCCTCTTCCTGGAACCTTGG + Exonic
1039547403 8:38420043-38420065 GCTGGCCCTTGCAGGATCCCTGG - Intronic
1039552000 8:38450257-38450279 GCCGCCCCGTTCAGGAGCCCAGG + Intronic
1039840533 8:41289967-41289989 GCTGCCTTTTCCAGCTGGCCTGG - Intronic
1040279947 8:46035061-46035083 GCTGTGTCTTCCAGGGGCCCTGG - Intergenic
1040768612 8:50945956-50945978 GCAGCAGCTTCCAGGAACCCTGG + Intergenic
1041101565 8:54400963-54400985 GCTGGCTCCTGCAGGAGCCCAGG + Intergenic
1041346517 8:56904360-56904382 GATGCCTCTTCTGGAAGCCCAGG - Intergenic
1043178592 8:77053876-77053898 GCTGCCTCTTCAAGTTGACCAGG - Intergenic
1044534002 8:93339028-93339050 TCTGTCCCTTCTAGGAGCCCTGG + Intergenic
1045582647 8:103498762-103498784 GCCAGCTCTTCCAGGCGCCCTGG - Intergenic
1046080294 8:109362716-109362738 CCTGCCTCTCCCAGGACCCCGGG - Intronic
1046515024 8:115247719-115247741 GCTGCTTCTAGCAGGAGCTCTGG + Intergenic
1047393576 8:124474313-124474335 GTCGCCTCTACCAGGATCCCGGG + Intergenic
1047756446 8:127922626-127922648 TCTCCCTCTTCAAGGAGTCCTGG - Intergenic
1047951660 8:129940045-129940067 GCTGCCCCTTTAAGGAGGCCGGG - Intronic
1048989865 8:139754971-139754993 GCTGTCACTGCCAGGGGCCCTGG + Intronic
1049235618 8:141510834-141510856 GCTGCCTCCTCCAGCAGGTCAGG - Intergenic
1049339242 8:142103118-142103140 GCTGCTTCTTCCTGGAGTCAAGG + Intergenic
1049374197 8:142281314-142281336 CCTGCTGCTGCCAGGAGCCCTGG - Intronic
1049467156 8:142756835-142756857 GCTCCCTTTCCCAGGGGCCCTGG - Intergenic
1049536693 8:143185915-143185937 CCCGCCTCTCCCAGGCGCCCCGG + Intergenic
1049788471 8:144462485-144462507 CCCGCCTCGTCCGGGAGCCCAGG + Intronic
1050592225 9:7172811-7172833 TCTGCCTCTGCCAGCAGCCAGGG + Intergenic
1051371371 9:16362136-16362158 GCTGCCTCTCCCAGGGCCCTGGG + Intergenic
1052971856 9:34381436-34381458 TGTGCCGCTTCCAGGAGGCCAGG - Exonic
1054458555 9:65449792-65449814 ACCTCCTCTTACAGGAGCCCAGG + Intergenic
1055722326 9:79189588-79189610 GCTGCTTTGGCCAGGAGCCCTGG + Intergenic
1056050371 9:82762318-82762340 GGTGCATCTTCCAGCAGCCATGG - Intergenic
1056724633 9:89103889-89103911 GCTGCCTCTGTCAGGAGCAAAGG + Intronic
1056773319 9:89495408-89495430 GCTATCTCCTCCAGCAGCCCTGG + Intronic
1057207399 9:93181927-93181949 GCTCCATCTGCCAGGATCCCAGG + Intergenic
1057363756 9:94399279-94399301 GCTGTTTCTCCAAGGAGCCCTGG + Intronic
1057659578 9:96988808-96988830 GCTGTTTCTCCAAGGAGCCCTGG - Intronic
1057907286 9:98992760-98992782 GGTGCCTCTTCCAGGGTCACAGG + Intronic
1059277966 9:113111275-113111297 CCTTCCTCTTCCAGGCTCCCTGG - Intergenic
1059278285 9:113113276-113113298 CCTTCCTCTTCCAGGCTCCCTGG + Intergenic
1059448776 9:114356961-114356983 ACTGCCTCTTTCAGGAGACCTGG - Exonic
1060861295 9:126956913-126956935 ACTGCCTCTTGCAAGAGTCCGGG - Intronic
1061267258 9:129514087-129514109 CCTGCCCCTAGCAGGAGCCCAGG - Intergenic
1061361294 9:130143993-130144015 GCTTCATCTTCCAGACGCCCCGG + Intergenic
1061456032 9:130698421-130698443 GCTCCCTCTTTCGGGAGACCTGG - Intronic
1062488410 9:136792311-136792333 TCTGGCTCTTCCTGGAGACCGGG + Exonic
1062656308 9:137605883-137605905 GCAGCCGCTTCCGGGAGCCCTGG - Intronic
1185506227 X:633755-633777 GATGCCACTTCCACCAGCCCTGG + Intronic
1185603814 X:1355617-1355639 GCCGCCTCTCCCAGTGGCCCAGG - Intronic
1185647020 X:1623190-1623212 GCCGCCACGTCCAGGGGCCCTGG - Exonic
1185776850 X:2810048-2810070 GCTGTCTCTCCCAGGAGGCAGGG + Intronic
1189005117 X:36986397-36986419 GCTGCCTCTCCAAGGGGCCGAGG + Intergenic
1189043904 X:37571545-37571567 GCTGCCTCTTCAAGGGGCCGAGG - Intronic
1189808538 X:44759799-44759821 GCTGTTTCTTCAAGGAGCTCTGG - Intergenic
1189811927 X:44788833-44788855 GCTCTTTCTTCAAGGAGCCCTGG - Intergenic
1190913636 X:54794041-54794063 GCAGCAGCTTCCAGGAGCACTGG + Intronic
1193104351 X:77652240-77652262 TCTGCCTTTTCCAGGAGACTTGG + Exonic
1197555375 X:127946614-127946636 ATTGGCTCTTCCTGGAGCCCTGG + Intergenic
1197769626 X:130081939-130081961 GCTGCCTCGTCCACGAGGCCAGG - Intronic
1200132940 X:153861371-153861393 CCTGCCCCTTCCCAGAGCCCGGG - Intergenic
1200145087 X:153922206-153922228 GCTGCCACCTCCCGGAGCCTGGG - Intronic
1200224990 X:154412298-154412320 GCTGCCTTTTCATGGAGCCCTGG + Intronic
1201293145 Y:12441418-12441440 GCTGTCTCTCCCAGGAGGCAGGG - Intergenic
1202068237 Y:20962614-20962636 GCAGCTTCTACCAGGAGCTCTGG - Intergenic
1202369480 Y:24187254-24187276 GCTGCGTCTTCCATGTGGCCTGG - Intergenic
1202501305 Y:25482863-25482885 GCTGCGTCTTCCATGTGGCCTGG + Intergenic