ID: 1142197405

View in Genome Browser
Species Human (GRCh38)
Location 16:88745173-88745195
Sequence CAGGAGCCCAGGAGACCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 1, 1: 2, 2: 4, 3: 57, 4: 516}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142197396_1142197405 9 Left 1142197396 16:88745141-88745163 CCACCTCCGCAGGGACCCACTGC No data
Right 1142197405 16:88745173-88745195 CAGGAGCCCAGGAGACCCAGTGG 0: 1
1: 2
2: 4
3: 57
4: 516
1142197398_1142197405 3 Left 1142197398 16:88745147-88745169 CCGCAGGGACCCACTGCTGCCTC 0: 1
1: 0
2: 0
3: 61
4: 417
Right 1142197405 16:88745173-88745195 CAGGAGCCCAGGAGACCCAGTGG 0: 1
1: 2
2: 4
3: 57
4: 516
1142197401_1142197405 -7 Left 1142197401 16:88745157-88745179 CCACTGCTGCCTCTTCCAGGAGC 0: 1
1: 0
2: 7
3: 58
4: 546
Right 1142197405 16:88745173-88745195 CAGGAGCCCAGGAGACCCAGTGG 0: 1
1: 2
2: 4
3: 57
4: 516
1142197393_1142197405 21 Left 1142197393 16:88745129-88745151 CCGGGGATCAGGCCACCTCCGCA 0: 1
1: 0
2: 0
3: 10
4: 207
Right 1142197405 16:88745173-88745195 CAGGAGCCCAGGAGACCCAGTGG 0: 1
1: 2
2: 4
3: 57
4: 516
1142197397_1142197405 6 Left 1142197397 16:88745144-88745166 CCTCCGCAGGGACCCACTGCTGC 0: 1
1: 0
2: 0
3: 21
4: 200
Right 1142197405 16:88745173-88745195 CAGGAGCCCAGGAGACCCAGTGG 0: 1
1: 2
2: 4
3: 57
4: 516
1142197400_1142197405 -6 Left 1142197400 16:88745156-88745178 CCCACTGCTGCCTCTTCCAGGAG 0: 1
1: 0
2: 4
3: 49
4: 483
Right 1142197405 16:88745173-88745195 CAGGAGCCCAGGAGACCCAGTGG 0: 1
1: 2
2: 4
3: 57
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142197405 Original CRISPR CAGGAGCCCAGGAGACCCAG TGG Intronic
900122958 1:1056935-1056957 CAGGAGCCCAGCTACCCCAGGGG - Intergenic
900370394 1:2329584-2329606 CAGGCACCCAGGAGACCCACTGG - Intronic
900525170 1:3124949-3124971 CTGGAACCCAGGACACACAGGGG - Intronic
900556601 1:3283886-3283908 CAGGAGCCCAGGTGCCTCCGCGG + Intronic
900638440 1:3676711-3676733 GTGGAGGCCAGGAGGCCCAGTGG - Intronic
900956836 1:5891506-5891528 GAGGAGCCCGGGATACCCACGGG - Intronic
901315857 1:8307795-8307817 CAGGAGCACAAGAGAGCAAGGGG + Intergenic
901506662 1:9689658-9689680 CAGTTGCCCAGGGGACACAGCGG - Intronic
902235764 1:15056328-15056350 CAGGAGGCCATCTGACCCAGTGG + Intronic
902406990 1:16189833-16189855 CTGGACACCAGGAGACCCACTGG - Intergenic
903314450 1:22490520-22490542 CCACAGCCCAGGAGAGCCAGAGG + Exonic
903773243 1:25777327-25777349 CAGGAGCCCTGGGGACCAAGGGG - Intronic
904391371 1:30188476-30188498 CAGGAGGCCAGAAGCCACAGGGG - Intergenic
904403593 1:30272606-30272628 CAGGAGGCCAGGAGAGGCTGAGG - Intergenic
904975285 1:34451523-34451545 CAGGTGCACAGGACACCGAGTGG - Intergenic
905352844 1:37359450-37359472 CAGGGGCACAGGAGCCACAGAGG + Intergenic
906400451 1:45500490-45500512 CAGGAACCCAGGAGGATCAGAGG - Intronic
907633429 1:56107448-56107470 CAGGAGCCCAGGAGCCCCAGTGG + Intergenic
909943298 1:81635130-81635152 AAGGAGCCCCAGAGCCCCAGGGG + Intronic
910455873 1:87396784-87396806 CAGGAGACCCGCTGACCCAGAGG - Intergenic
910787666 1:91018132-91018154 GAAGATCACAGGAGACCCAGAGG - Intronic
911101872 1:94101784-94101806 GGGGAGCCCAGAAGGCCCAGAGG + Intronic
914048324 1:144108507-144108529 CAGGGGCCCCGGAGAGCGAGAGG + Intergenic
914130860 1:144856941-144856963 CAGGGGCCCCGGAGAGCGAGAGG - Intergenic
914972001 1:152314441-152314463 CAAGAGCCCAAGAGAAACAGGGG - Exonic
915212617 1:154321883-154321905 AGGGAGCCCAGGAGACCAACAGG - Intronic
915227408 1:154421170-154421192 CAGGAGCCAAGGAGGGGCAGGGG + Intronic
916108707 1:161448106-161448128 AGGGGGCCCAGGAGGCCCAGGGG + Intergenic
916110295 1:161455487-161455509 AGGGGGCCCAGGAGGCCCAGGGG + Intergenic
916111880 1:161462897-161462919 AGGGGGCCCAGGAGGCCCAGGGG + Intergenic
916113467 1:161470278-161470300 AGGGGGCCCAGGAGGCCCAGGGG + Intergenic
916682290 1:167115676-167115698 AAAGACCCCAGGAGAGCCAGGGG + Intronic
918083048 1:181222059-181222081 CAGGACCCTAGGAAGCCCAGAGG + Intergenic
919619657 1:199850459-199850481 CAGGAGCCCAGGAATGCAAGAGG - Intergenic
919660680 1:200242239-200242261 GAGGAGCCAACGAGACTCAGAGG + Intergenic
919878007 1:201884699-201884721 CAGGAGCCCAGCCCAGCCAGTGG - Intergenic
920081809 1:203380173-203380195 CAGGGGCCCAGGAGGGTCAGTGG - Intergenic
921159433 1:212462777-212462799 CAGGACCCCAGGAGGAGCAGAGG - Intergenic
921866668 1:220094140-220094162 CAGGACCCCAGGAAACCAAGGGG - Exonic
922183467 1:223254402-223254424 TAGGAGTCCAGGAGAGACAGAGG + Intronic
922503015 1:226110533-226110555 GGGGCGCCCAGGAGGCCCAGGGG - Intergenic
922570558 1:226632307-226632329 CAGGACCCAAGGAGTCCCTGTGG + Exonic
922586323 1:226737238-226737260 GAGGAGCCCCGGAGCCCCGGGGG - Exonic
922612909 1:226943359-226943381 CAGGAACTCGGGAGAGCCAGTGG + Intronic
922764612 1:228150535-228150557 CTGAAGCCCAGCAGACCCTGTGG + Intronic
922795394 1:228337188-228337210 CCTGAGCCCTGGAGAGCCAGAGG + Intronic
922898916 1:229121456-229121478 CAGGTGCCGAGGATACCCTGGGG - Intergenic
923056009 1:230426264-230426286 CGGGCGCCGAGGAGACGCAGCGG - Intergenic
923849645 1:237779876-237779898 CAGGAGCTCAGTAGAGTCAGAGG + Intronic
924557443 1:245130027-245130049 ACGGAGCCCAGGAGTCCCTGTGG + Intergenic
1065509686 10:26466180-26466202 TAGAAGCCCAGGACACCCGGAGG - Intronic
1066080668 10:31928366-31928388 CAGGAAGTCAGGAAACCCAGGGG + Intronic
1067164544 10:43854947-43854969 CTGGAGCCCAGGAAAGCCAGTGG - Intergenic
1067181141 10:43986718-43986740 CAGGAGCTCAGCAGCCACAGGGG - Intergenic
1067532767 10:47086473-47086495 CAGGAGATCAGGAATCCCAGGGG + Intergenic
1067572267 10:47380213-47380235 CAAGAGCCAAGGAGAACAAGAGG - Intronic
1069068112 10:63966525-63966547 CAGGAGCTCAGGAGTTCCATGGG + Intergenic
1069635401 10:69921904-69921926 CAGGAGGCCAGGAAGCCCAGGGG - Exonic
1069751784 10:70749716-70749738 CAGGAGCCCAGAAGGCTCACTGG + Intronic
1069811021 10:71159821-71159843 CAGGAGCACAGCAGACCAGGAGG + Intergenic
1069825474 10:71252823-71252845 CAGGAGCCCCAGAGACCCCCAGG + Intronic
1069923336 10:71831065-71831087 CTGGGGCCCAGGAGAGGCAGTGG - Intronic
1070618500 10:77988036-77988058 CAGGAGCCCAGGCAGCCAAGGGG + Intronic
1070802422 10:79251437-79251459 CAGGAGGACAAGTGACCCAGAGG - Intronic
1071425546 10:85545514-85545536 CTGAAGCCCAGGAGACAAAGCGG - Intergenic
1071450705 10:85789727-85789749 CAGGAACCCAGGAGATTTAGGGG + Intronic
1072322425 10:94263608-94263630 CTTGAGCCCAGGAGTCACAGAGG + Intronic
1073082753 10:100870299-100870321 CAGGGGCTCAGAAGACCCTGGGG - Intergenic
1074232081 10:111547545-111547567 CAGGTTCCTAGGGGACCCAGAGG - Intergenic
1074707700 10:116150155-116150177 CAGGAATGCAGCAGACCCAGAGG - Intronic
1075174261 10:120144610-120144632 CAGGAGCCCTGGGGACCCTGTGG - Intergenic
1075349021 10:121707186-121707208 CAGGAGCCTAGGAGAGCCAGAGG - Intergenic
1075465656 10:122648477-122648499 CAGGAGCCCAGGAGCCCAGGAGG + Intergenic
1075710842 10:124529875-124529897 CAGGATCCCAGCTGCCCCAGCGG + Intronic
1075724517 10:124604592-124604614 CAGGAGCCCAAGACCCCCGGGGG - Intronic
1076369081 10:129940370-129940392 GACTAGCCCAGGAGGCCCAGGGG - Intronic
1076384936 10:130049062-130049084 AAGGAGCCCCGGAGTCCTAGGGG - Intergenic
1076462723 10:130657320-130657342 CAGGTGCTCAGGGGACACAGGGG + Intergenic
1076483716 10:130802039-130802061 CGGGAGCCCGGGAGACCGAGCGG - Intergenic
1076660953 10:132055848-132055870 CAGAAGCCCAGGAACCCCATGGG - Intergenic
1076839526 10:133039197-133039219 CAGGAGACCAGGAGCCGCCGGGG + Intergenic
1077068107 11:653819-653841 CAGGAGCCCCGGATTCCCAGAGG + Intronic
1077560339 11:3256580-3256602 CAGCAGCGCCGGAAACCCAGAGG - Intergenic
1077661640 11:4073877-4073899 CAGAAGCTCAGGAGTCCAAGAGG + Intronic
1078519692 11:12053058-12053080 CAGAAACCCGGGAGACTCAGAGG - Intergenic
1078744144 11:14095525-14095547 CGGAGACCCAGGAGACCCAGTGG + Intronic
1078827207 11:14940578-14940600 CTGGAGCCCAGGTGGGCCAGTGG + Intronic
1079078081 11:17395955-17395977 CAGCAGCCCCAGAGTCCCAGTGG - Intronic
1080783926 11:35457404-35457426 CTGGAGACCAGGAAAGCCAGTGG - Intronic
1080892785 11:36423927-36423949 GAGTAGCCCAAGACACCCAGGGG - Intronic
1083330654 11:61896952-61896974 CTGGATGCAAGGAGACCCAGGGG + Intergenic
1083843153 11:65315786-65315808 CGGGACCCCGGGAGACCCAGCGG + Intronic
1083960345 11:66011867-66011889 AGGGAGCCCAGGAGGCCGAGGGG - Exonic
1084421822 11:69064168-69064190 CCTGAGCCCAGGAGACCCCAGGG - Intronic
1084425383 11:69081349-69081371 GAGGAGCCCAGGAGCCCCACAGG - Intronic
1084517271 11:69643697-69643719 CAGGACCGCACGAGACGCAGGGG + Intronic
1084727194 11:70949568-70949590 CTGGAGCCCAGGTCACCCTGTGG - Intronic
1084756956 11:71245883-71245905 CAGGAGCCCGGCTGGCCCAGGGG + Intronic
1084773302 11:71357979-71358001 CTGGAGACCAGCAGACCCTGAGG + Intergenic
1085425776 11:76403391-76403413 CTGGAGCCCAGGAAAGCCAATGG + Intronic
1086983745 11:93226537-93226559 CAAGAGCCCAGAGGAACCAGAGG - Intergenic
1087327700 11:96743583-96743605 CAAGAGTACAGGAGACTCAGTGG - Intergenic
1089378604 11:118012111-118012133 CAGGAGCCCAATAGAGCAAGTGG - Intergenic
1089747844 11:120629553-120629575 CAGGTGCCCATGTGGCCCAGAGG - Intronic
1091560492 12:1609176-1609198 CAGGAGCCCAGGATCCCAGGAGG - Intronic
1093762858 12:22929686-22929708 CAGGAGCCCAGGAGCGCAAGAGG - Intergenic
1094511631 12:31100797-31100819 CAGGGGCGGAGGAGACCCCGGGG + Intronic
1095955457 12:47803221-47803243 CAGGAGGCCAGGAGACCCAGAGG + Intronic
1096244138 12:49974964-49974986 CAGTTGCCCAGGATACCCAGTGG + Intronic
1096460592 12:51819821-51819843 CAGGAGCTCTGGAGGCCCAGGGG - Intergenic
1096554294 12:52393995-52394017 CAGAGGCCCTGGAGCCCCAGTGG + Exonic
1096784580 12:54009742-54009764 CTGGAGCGCGGGAGACCAAGGGG - Intronic
1097052150 12:56230093-56230115 CAGGAGACAAGGACACCCAGAGG - Intronic
1097251004 12:57632320-57632342 AAGGAGGCCGGGAGACCCTGGGG - Intronic
1097394994 12:59062265-59062287 CAGGAGCCTGCCAGACCCAGTGG + Intergenic
1101233467 12:102765431-102765453 CAAGGGTTCAGGAGACCCAGAGG + Intergenic
1102190697 12:110985794-110985816 GAGGAGGCCAGGAGACACAGTGG - Intergenic
1102737377 12:115174737-115174759 CAGAAGCCCAGTAAACCCTGTGG - Intergenic
1102765190 12:115426870-115426892 CAAGGGATCAGGAGACCCAGAGG - Intergenic
1103400147 12:120638485-120638507 CAGGAGCCAATGAGAGGCAGAGG - Intergenic
1103539919 12:121658948-121658970 GAGGAGCCCACGAAACCCTGCGG - Intronic
1104058817 12:125250698-125250720 AGTGAGCCCAGAAGACCCAGTGG + Intronic
1104665865 12:130646892-130646914 CAGCAGCCCAGGAGCCACATTGG + Intronic
1104904142 12:132204565-132204587 CAGGCGCCCAGGAGAGCCGGTGG - Intronic
1105707020 13:22974114-22974136 CAGTAACACAGGAGACCAAGAGG - Intergenic
1105871234 13:24507425-24507447 GTGGTGCCAAGGAGACCCAGAGG - Intronic
1105913312 13:24891228-24891250 CAGGAGGCCAGGAGTCCGTGTGG - Intronic
1106272286 13:28166505-28166527 CACCAGCCTAGGAGAGCCAGAGG - Intronic
1106303410 13:28489594-28489616 CAGGAGAGGAGGAGACACAGAGG + Intronic
1106312085 13:28563282-28563304 CAGGAGGCCAGGAAGCCCAGAGG + Intergenic
1108498374 13:51046352-51046374 CAGCAGCCCAGGAAACACAAAGG + Intergenic
1108543546 13:51467621-51467643 CTGGAGACCAGGAGAGTCAGTGG - Intergenic
1108758483 13:53532797-53532819 CAGGAGCCAAGGAGTGCAAGTGG + Intergenic
1112159680 13:96854381-96854403 CAAGAGCCCAGGAGAAACTGAGG - Intergenic
1113785055 13:112998051-112998073 CAGGTGCCCAGTGGACCCCGGGG - Intronic
1113950626 13:114069489-114069511 CGGGGGACCAGGAGACTCAGGGG + Intronic
1113950632 13:114069506-114069528 CAGGGGGCCAGGAGACACAGGGG + Intronic
1114317922 14:21524684-21524706 CAGGAGCCCTGGGGAGGCAGTGG + Exonic
1114810809 14:25896882-25896904 CAGGAGCTCAGGTTACTCAGGGG - Intergenic
1115853370 14:37604497-37604519 CAGGAGCCCAGGAAAGGCACAGG - Intronic
1116869088 14:50054809-50054831 GAGGAGCCCATGAGACACACAGG + Intergenic
1117162933 14:53006899-53006921 CAGCAGCCCAGGAGATTCAGGGG - Intergenic
1117778513 14:59207694-59207716 GAGGAGTCCTGGAGAGCCAGAGG - Intronic
1118879000 14:69810368-69810390 CTGGAGCCCTGCAGACCCACAGG + Intergenic
1119652689 14:76394847-76394869 CAGGAGCCACGCAGAGCCAGAGG + Intronic
1121299685 14:92860751-92860773 CAGGACCCAAGGACTCCCAGGGG + Intergenic
1122073755 14:99222396-99222418 CAGGTGCCCAGGAGATGCTGGGG - Intronic
1122125993 14:99579153-99579175 CAGGAGCCCAGGGGACTGTGTGG - Intronic
1122329882 14:100904872-100904894 CAGGCGCCCAGGAAGCCGAGGGG + Intergenic
1122651268 14:103228467-103228489 CAGGGGCCCAGGAGACAGAATGG + Intergenic
1122743217 14:103883529-103883551 CAGGAGGCCAGGAGACTCCCAGG - Intergenic
1122789235 14:104177360-104177382 CAGGAGCCCTGGCGGCCCTGTGG + Exonic
1122817007 14:104318892-104318914 CAGGAGGCCAGGAGGGACAGTGG - Intergenic
1122919329 14:104873624-104873646 CAGGAGCTCTCGAGGCCCAGCGG + Intronic
1122987652 14:105219935-105219957 CAGGAGCCCACTTCACCCAGCGG + Intronic
1124226862 15:27902592-27902614 CAGGTTCCCAGGACACGCAGGGG + Intronic
1124640269 15:31392487-31392509 GAGGAGCGCAGGGGACCCGGGGG - Intronic
1126773778 15:52082385-52082407 CAGGAGCCCTGGATATGCAGCGG - Intergenic
1126785445 15:52174750-52174772 CTGCACCCCAGGAGACCCTGCGG - Intronic
1126847629 15:52775993-52776015 AAGGAGCCCTGAAGAACCAGTGG - Intronic
1128311055 15:66632035-66632057 TTGGATCCCAGGAGCCCCAGTGG + Intronic
1128792799 15:70445414-70445436 CAGGAACCCAGGGTGCCCAGAGG - Intergenic
1129385385 15:75193359-75193381 CAGGAGCCCTGGGGAGCCAATGG - Intergenic
1129689685 15:77706164-77706186 CAGGAGCCCTGGAGAAGGAGTGG - Intronic
1130101499 15:80897915-80897937 AAGGAGCCCAGAAGACCAAGAGG + Intronic
1130687723 15:86053728-86053750 TAGGATCCAAAGAGACCCAGGGG - Intergenic
1130988442 15:88860170-88860192 CAGGTGCCCAGGAGGGACAGAGG + Intronic
1132304873 15:100803780-100803802 CAGGAGCTGAAGACACCCAGAGG + Intergenic
1132480852 16:165453-165475 AAGGACCCCAGGAGACGCCGCGG - Intronic
1132484437 16:183148-183170 TTGGAGCCCAGGAGGCTCAGGGG + Intergenic
1133133947 16:3696251-3696273 GAGGAGCCTAGGACACCCAGTGG + Intronic
1134156127 16:11844699-11844721 CAGGAGCCGTGCAGACCCAGTGG - Intronic
1134207846 16:12252369-12252391 CAGGGGCTCAGAGGACCCAGAGG - Intronic
1134610672 16:15605741-15605763 GAAGCTCCCAGGAGACCCAGTGG + Intronic
1136024720 16:27462149-27462171 CAGGAGCCCAGGACAAGCTGGGG + Intronic
1136131596 16:28225378-28225400 CAGGAGGCCCGGAGTCCCAAAGG - Intergenic
1136276144 16:29180469-29180491 CAGGAGCCCAGAAAACCCCATGG - Intergenic
1136479542 16:30533057-30533079 CTTCAGCCCAGGAGACCCGGCGG + Exonic
1136483318 16:30556016-30556038 CTTCAGCCCAGGAGACCCGGCGG + Exonic
1136664970 16:31802764-31802786 CAGAAACCCAGGACACTCAGCGG + Intergenic
1137299418 16:47133357-47133379 CTTGAGCCCAGGAGTTCCAGAGG + Intronic
1137529616 16:49270189-49270211 CAGGAGCTCAGGAGAAGCTGAGG - Intergenic
1137690695 16:50425123-50425145 CAGGAGCCCCAGAGTTCCAGGGG - Intergenic
1137789046 16:51159171-51159193 CCCCAGCCCAGGAGACCCACAGG - Intergenic
1138193276 16:55033822-55033844 CAGGAGCCCAGGAAAATAAGTGG + Intergenic
1138421769 16:56903635-56903657 CTGGAGACCAAGAGACCGAGGGG - Intronic
1138600711 16:58052245-58052267 CAGGAGCTCAGCAATCCCAGTGG - Intergenic
1139248259 16:65469699-65469721 AAGGAGACAAGGAGACTCAGAGG - Intergenic
1140476918 16:75243726-75243748 CAGGAGCCAAGCAGTCCGAGAGG + Intronic
1141187580 16:81798849-81798871 CAGGAGCAGAGAAGACGCAGTGG - Intronic
1141700006 16:85638036-85638058 CTGGGGCCCAGGGCACCCAGAGG - Intronic
1141762234 16:86036223-86036245 CAAGAGCCCCGGAAAGCCAGAGG + Intergenic
1141919792 16:87128044-87128066 CAGGAGCCCTTGAGAAGCAGAGG - Intronic
1142027937 16:87824405-87824427 CAGGGGTGCAGGAGCCCCAGAGG - Intergenic
1142080521 16:88146527-88146549 CAGGAGCCCAGAAAACCCCACGG - Intergenic
1142132441 16:88437217-88437239 CGGGAGCCCGGGAGACCCGTGGG + Exonic
1142197405 16:88745173-88745195 CAGGAGCCCAGGAGACCCAGTGG + Intronic
1142271218 16:89090424-89090446 CAGGAGGCCAGGAGAGGCCGTGG + Intronic
1142580210 17:937312-937334 GAAGAGCCCAGGAGTCCAAGAGG + Intronic
1142918177 17:3161000-3161022 CAGGAGCCAAGGATCCCCTGCGG + Intergenic
1143305999 17:5947134-5947156 CAGAAGCTCAGGAGATACAGAGG + Intronic
1143608425 17:8003718-8003740 CTGGAGCCCGGGAGGCCCTGAGG + Exonic
1143967588 17:10767848-10767870 CAGGAGCTGAGGAGACCAACAGG - Intergenic
1143994417 17:10994248-10994270 CAAGAGCCCAGCAGAGCCAATGG - Intergenic
1144165166 17:12603800-12603822 CGGAAGCCCTGGAGACTCAGCGG + Intergenic
1144650370 17:17003315-17003337 CAGGATCTCAGGAGCCCAAGAGG + Intergenic
1145028895 17:19489635-19489657 CTGGAGCCCATCAGGCCCAGAGG - Intergenic
1145246461 17:21272988-21273010 CAGGAACCCAGAGGAGCCAGTGG + Intergenic
1145791787 17:27632134-27632156 CAGGAGCCCAGGAGACTTCAGGG + Intronic
1147266349 17:39237097-39237119 GAGCAGCCCAGGAGCTCCAGTGG - Intergenic
1147669200 17:42167064-42167086 CAGGAGCCCAGGGGGACCAAGGG - Intronic
1147906992 17:43829974-43829996 CCCCATCCCAGGAGACCCAGAGG + Intronic
1148811760 17:50297535-50297557 CAGAAGACAAGGAGTCCCAGAGG - Intergenic
1149302588 17:55318636-55318658 CAGGAGCCCAGGAGGCGAAGGGG - Intronic
1150433908 17:65139503-65139525 CAGGAGCCCAGGGGTGCCTGTGG - Intronic
1150877553 17:68986272-68986294 CAGTACCCCAGGAAGCCCAGGGG + Exonic
1151116795 17:71745019-71745041 CAGGGAGCCAGGAGACCCAGTGG - Intergenic
1151238550 17:72739546-72739568 CAGTGGCCCAGGAGTCACAGTGG - Intronic
1151358431 17:73573842-73573864 CTGGAGCACAGGAGAGCCAGGGG - Intronic
1151444386 17:74153664-74153686 CAGGAGCTGAGGAGGCACAGGGG + Intergenic
1151444809 17:74156268-74156290 CAGGGGCTGGGGAGACCCAGCGG - Intergenic
1151632663 17:75321522-75321544 AAGGAGCACAGAAGCCCCAGCGG + Intronic
1151727504 17:75893284-75893306 CAGTGGCCCAGGAGGCCCTGGGG + Intronic
1152199997 17:78939733-78939755 CAGCTGCCCAGGAGACACAGTGG - Intergenic
1152584197 17:81181828-81181850 TAGAAGCCCAGGAGGCTCAGAGG + Intergenic
1152588406 17:81199282-81199304 CAGCAGCACAGGAGGCCGAGAGG + Intronic
1152627067 17:81392722-81392744 GAGGAGACCAGGACTCCCAGGGG + Intergenic
1152728062 17:81957401-81957423 CAGGAGACCAGGAGACAAATGGG - Intronic
1153661515 18:7330358-7330380 GAGGAGGTCAGGAGACCCAGAGG - Intergenic
1156475644 18:37403808-37403830 CACTAGCCCAGGAGGCCCAGTGG - Intronic
1156700610 18:39820115-39820137 CAGGAAGCCAGGGGAGCCAGGGG - Intergenic
1158064848 18:53394343-53394365 CAGGATCTCAGGTGACCCAATGG + Intronic
1158141554 18:54261323-54261345 CAGAGGCCCAGGAGAGCCAGTGG - Intergenic
1160490658 18:79334729-79334751 CTGGCCCCCAGGAGACCCACCGG + Intronic
1160505575 18:79424413-79424435 CACAAGCCCAGAAGACCCAGAGG + Intronic
1160983234 19:1826317-1826339 CACGGGGCCAGGAGACCCAGGGG + Intronic
1161379239 19:3955944-3955966 CAGGAGACCAGGACCCCCGGGGG - Intergenic
1162299252 19:9835083-9835105 CAGGAGCCGAGGAGAGCGAGTGG + Intergenic
1162498382 19:11036124-11036146 CAGGAGCCCAGGTGACAGACAGG + Intronic
1163002800 19:14379231-14379253 CAGGAGCCCAGGACAGGAAGGGG + Intergenic
1163346299 19:16744650-16744672 CTGGAGCCCAGGAGGCCCGGAGG + Exonic
1163834888 19:19567230-19567252 CAGGGGCCTTGAAGACCCAGAGG + Intronic
1165166995 19:33863727-33863749 CAGGAGGCCAGTGGACACAGTGG + Intergenic
1165175813 19:33929076-33929098 CAGCAGCCCAGGAAAACTAGAGG + Intergenic
1165247395 19:34505259-34505281 CAGGATCCCAGGCCACCCTGGGG - Exonic
1165505840 19:36228653-36228675 CAGAAGGCCAGGAGACCCCAGGG + Intronic
1165600973 19:37055770-37055792 CAGGATTCCAGGAGACACGGAGG + Intronic
1166067430 19:40367962-40367984 CTGCAGCCCAGGAGACAGAGGGG + Intronic
1166267001 19:41690621-41690643 AAGGAGACCTGGGGACCCAGGGG - Intronic
1166852049 19:45765789-45765811 CAGGAGGCCAGGGGAGTCAGGGG + Exonic
1167619484 19:50552849-50552871 CACTAGCCCAGGACACCCATGGG + Intronic
1167756797 19:51417784-51417806 TGGGCCCCCAGGAGACCCAGAGG - Intronic
1167926336 19:52823979-52824001 CTTGAGCCCAGGAGACACGGAGG + Intronic
1168137029 19:54359067-54359089 CAGCAGCCCAGGAGCCTCTGAGG + Intronic
1168161052 19:54510062-54510084 CAGCAGCCCAGGAGCCTCTGAGG - Intronic
1202687776 1_KI270712v1_random:61402-61424 CAGGGGCCCCGGAGAGCGAGAGG + Intergenic
925107826 2:1308327-1308349 CAGGGTCCCGGGAGACCCACAGG - Intronic
925493485 2:4421563-4421585 CAGGAGCCAAGGGGCCCAAGGGG - Intergenic
925640936 2:5985370-5985392 AAGGAGCCCCGGAGGCCCTGGGG - Intergenic
925905438 2:8537173-8537195 CAGGAGGCCAAGAGGCCAAGAGG - Intergenic
926697418 2:15780453-15780475 CAGGAGCTCAGTGGGCCCAGGGG - Intergenic
926744479 2:16139489-16139511 CAGAAGCTCATGAGACTCAGGGG + Intergenic
927313967 2:21660778-21660800 CAGGAGCTCAGGGGATGCAGAGG - Intergenic
927522739 2:23709998-23710020 CAGGAGTCCATGAGACAAAGGGG + Intergenic
927826983 2:26315981-26316003 CAGTAGCCCAGGATACCTGGGGG - Intronic
927937614 2:27084436-27084458 CTGCAGCCCAGGAGGCCCTGGGG - Exonic
928016498 2:27663002-27663024 CTTGAGCCCAGGAGTTCCAGAGG - Intronic
928041673 2:27884335-27884357 GAGGATCGCTGGAGACCCAGAGG - Intronic
928396681 2:30947990-30948012 CAGTGGCCCAAGAGCCCCAGAGG - Intronic
928683856 2:33728234-33728256 CTGCGGCCCAGGAAACCCAGCGG + Intergenic
928842368 2:35625577-35625599 CACTGGCCCAGGAAACCCAGAGG - Intergenic
929598741 2:43191901-43191923 CAGGATCCCCAGAGATCCAGAGG - Intergenic
929954349 2:46444048-46444070 CAGGAGACCTGGAGACACTGGGG - Intronic
930088425 2:47514731-47514753 CTGGAGTCCAAGAGACTCAGGGG - Intronic
931819266 2:65935168-65935190 GAAGAGCCCAGGACACACAGAGG + Intergenic
931882168 2:66578647-66578669 CAGGAGCCCAGGGGCTCCGGGGG - Intergenic
932021043 2:68087043-68087065 CTTGAGCCCAGGAGGTCCAGAGG + Intronic
932309362 2:70727402-70727424 CTGGAGCCCAGGAGAGGGAGAGG - Intronic
933737099 2:85504056-85504078 CAGAAGTCCCGCAGACCCAGAGG - Intergenic
933901048 2:86850273-86850295 CCAGAGCTCAGGAGACCCTGAGG - Intronic
933958578 2:87394183-87394205 CAGGGGCCCCGGAGAGCGAGAGG - Intergenic
934242707 2:90286189-90286211 CAGGGGCCCCGGAGAGCGAGAGG - Intergenic
934270468 2:91530494-91530516 CAGGGGCCCCGGAGAGCGAGAGG + Intergenic
934308593 2:91844483-91844505 CGGGACCCCAGGGGACTCAGAGG - Intergenic
934661236 2:96144772-96144794 CAGGAGCCCTGGAGTCGGAGCGG + Exonic
934750323 2:96789641-96789663 CAGGAACCCTGAAGTCCCAGAGG + Intronic
935332538 2:101987739-101987761 CAGGAGCTGAGAAGATCCAGTGG + Intergenic
935779497 2:106498959-106498981 CCAGAGCTCAGGAGACCCTGAGG + Intergenic
936028752 2:109054304-109054326 TAGGAGCCCAGGATGCCCTGGGG - Intergenic
936160690 2:110082107-110082129 CAGGATCCTGGGAAACCCAGGGG + Intergenic
936183974 2:110289247-110289269 CAGGATCCTGGGAAACCCAGGGG - Intergenic
938226271 2:129619117-129619139 CATGAGGCCAGGAGCCCCAAAGG + Intergenic
938266344 2:129930863-129930885 GTGGAGCCCAGAAGCCCCAGGGG + Intergenic
938317485 2:130340120-130340142 AAGGAGTCCAGGAGAGCCTGCGG - Intronic
938373938 2:130791901-130791923 CAGCAGCCCAGGAGAGCATGGGG - Intergenic
938754928 2:134370962-134370984 TAGGAGCCCATGGGACCCGGGGG + Intronic
939700703 2:145387080-145387102 CATGACCCCTGGAGCCCCAGAGG - Intergenic
940933837 2:159468410-159468432 CAGGTACAGAGGAGACCCAGAGG + Intronic
941753757 2:169162830-169162852 CAGCAGCACAGGAGACACGGAGG - Intronic
941765821 2:169295198-169295220 CAGGAGCCCTGGCGGCCCAGAGG + Intronic
942146587 2:173032898-173032920 CAGGAGTCTCTGAGACCCAGGGG + Intronic
944512290 2:200476667-200476689 CATGACCCCTGGAGCCCCAGAGG + Intronic
944684064 2:202102766-202102788 CTGGATCCCAGGAGACCAAGTGG + Intronic
945047943 2:205798468-205798490 CATGACCCCTGGAGCCCCAGAGG + Intergenic
945201684 2:207288230-207288252 CAGGACCCCAGAAGACCCCTCGG - Intergenic
945253323 2:207782917-207782939 GAGCAGCCCAGCTGACCCAGAGG + Intergenic
945457880 2:210070114-210070136 CAGGGGCCAAGCAGACACAGTGG - Intronic
945974309 2:216258793-216258815 AATGAGCCCAGGAGCCCCAAAGG + Exonic
946147913 2:217744644-217744666 CTGGAGGCAAGGAGGCCCAGTGG + Intronic
946196050 2:218033599-218033621 CAAGGGCACAAGAGACCCAGGGG + Intergenic
947793359 2:232879971-232879993 CACGAGCCCAGGAGACCCCAAGG + Intronic
948117575 2:235504992-235505014 CAGGAGCCAAGGAGAGCCAAAGG - Intronic
948551773 2:238777814-238777836 CCGGAGGCCCAGAGACCCAGAGG + Intergenic
948643259 2:239388535-239388557 CAGGCACCCAGGTCACCCAGAGG - Intronic
948769943 2:240246578-240246600 CAGCAGCCAAAGAGACCCTGTGG + Intergenic
948870989 2:240797985-240798007 CAGGAGCCCAGCGGGACCAGTGG + Intronic
948933470 2:241147907-241147929 CAGATGCCCAGGAGGCACAGCGG - Intronic
948948362 2:241233315-241233337 CAGGAGGCCATGAGGGCCAGTGG + Intronic
1168960657 20:1867199-1867221 CAGGAGAACAGGAAACACAGGGG - Intergenic
1168970859 20:1929883-1929905 AAGGGGCCCAGGAGCCTCAGGGG - Intronic
1169217610 20:3802536-3802558 CAGGAGACAAGGAGGGCCAGAGG - Intronic
1169939940 20:10925993-10926015 CAGGAGTCCCGGAGAACAAGTGG - Intergenic
1169967209 20:11231201-11231223 CAGGAGGCCAAGAGACTCAAGGG + Intergenic
1171391495 20:24804333-24804355 TCAGAGCCCTGGAGACCCAGTGG + Intergenic
1171724868 20:28607145-28607167 CAGGAGACCAAGTGAGCCAGGGG + Intergenic
1172081230 20:32342391-32342413 CAGGAGCAGACGAGACACAGCGG - Intergenic
1172151349 20:32792658-32792680 CAGCAGCCCTGGAGACTCATTGG + Exonic
1172950599 20:38721104-38721126 GAAGAGCCCAGGAGACCAACAGG - Intergenic
1174708826 20:52684261-52684283 CAGGAACCCAGCAGAGCCACAGG - Intergenic
1175981000 20:62738592-62738614 TAGGAGCCCATGAAAGCCAGAGG - Intronic
1176047964 20:63102544-63102566 CAGGAGCCCAGGGCGCCCCGGGG + Intergenic
1176168993 20:63688714-63688736 CAGGAGCCCTGAAGAGGCAGCGG - Intronic
1176245020 20:64093362-64093384 CAGGAGCCCTGGAGCCTGAGAGG - Intronic
1176252254 20:64131094-64131116 CTGGAGCCCAGGATTGCCAGTGG - Intergenic
1176386205 21:6139700-6139722 CAGGAGCCAGAGAGCCCCAGGGG + Intergenic
1176658615 21:9613005-9613027 CTGGAGCCCAGTAGCCCCACTGG - Intergenic
1178091689 21:29170277-29170299 CTGGAACCCAGAAGACTCAGCGG - Intronic
1179078662 21:38149034-38149056 CTGGAGACCAGGAGAGCCAATGG - Intronic
1179584755 21:42367447-42367469 CAGGAGTCCAGGGGACCAACTGG - Intergenic
1179626087 21:42650345-42650367 TAGGATACCAGGAGACCCTGGGG + Intergenic
1179626597 21:42652927-42652949 GAGGAGCCCAGGAGAACTGGGGG + Intergenic
1179737268 21:43398552-43398574 CAGGAGCCAGAGAGCCCCAGGGG - Intergenic
1179921684 21:44510840-44510862 CAGGGGCCCAGGACACCTGGCGG + Intronic
1180079641 21:45480836-45480858 CGGGAGGCCAGGAAACCCGGGGG - Exonic
1180145687 21:45917408-45917430 CAGGGCACCAGGAGCCCCAGGGG - Intronic
1180298423 22:10965836-10965858 CAGGAGACCAAGTGAGCCAGGGG + Intergenic
1180843268 22:18969096-18969118 CAGGAGGCCAGGGGACAGAGTGG + Intergenic
1180874344 22:19168193-19168215 CAGCAGCCCTCCAGACCCAGAGG - Intergenic
1180986933 22:19910451-19910473 CAGGAGCCCTGGGGTTCCAGTGG - Intronic
1181058202 22:20269639-20269661 CAGGAGGCCAGGGGACAGAGTGG - Intronic
1181350369 22:22250814-22250836 CAGGGGCCCCGGAGAGCGAGAGG + Intergenic
1181460623 22:23083854-23083876 CAGGATCCCTGGAACCCCAGTGG - Intronic
1181688243 22:24543692-24543714 CAAGAGCCCAGGAGGAGCAGGGG + Intronic
1182027600 22:27132745-27132767 CAGAGGCCCAGCAGGCCCAGCGG + Intergenic
1182352961 22:29709187-29709209 CAGGAGCCCGGGAGAAGTAGGGG + Intergenic
1183383613 22:37502841-37502863 CAGGAGCACATCAGACCCACTGG + Intronic
1183427308 22:37746639-37746661 CGGGAGCCCAGGCGACCCTGAGG + Intronic
1183977151 22:41518982-41519004 CAGGAACACTGGGGACCCAGGGG - Intronic
1184120082 22:42444481-42444503 CAGGGGCCGTGGGGACCCAGGGG - Intergenic
1184261297 22:43318300-43318322 CCTGAGCCCAGGAGTTCCAGAGG + Intronic
1184322943 22:43756899-43756921 CAGGAGCTCAGCAGACCCCAGGG + Intronic
1184417927 22:44363023-44363045 TAGGAGCCCAGCAGTGCCAGGGG - Intergenic
1184427772 22:44423267-44423289 CAGGTGCCCAGCAGACGCAAGGG - Intergenic
1185016422 22:48345825-48345847 CAGGACACAAGGAGACACAGGGG - Intergenic
1185206167 22:49540382-49540404 AAGGCACCCGGGAGACCCAGAGG - Intronic
949500102 3:4671607-4671629 CTGGAGCCAAGGAGACACTGGGG - Intronic
949515092 3:4800422-4800444 CAGGAACCCTGGAGCCCCACTGG + Exonic
949792542 3:7809109-7809131 CAGGAACCAAGGGGACCAAGGGG - Intergenic
950006877 3:9697100-9697122 CATCAGCCCAGCAGACTCAGTGG - Intronic
950053184 3:10007440-10007462 CAGGAGCCCAGCAGAACAAGTGG - Intronic
950173059 3:10852589-10852611 GAGAAGGCCAGGAGTCCCAGTGG + Intronic
950256926 3:11513327-11513349 CAGGAGCCCACGGGAGGCAGAGG + Intronic
950304827 3:11909724-11909746 CAGGAGCCCAGCAGCACAAGTGG - Intergenic
950329382 3:12144368-12144390 CAGGCCCCCAGGAGAGCAAGGGG - Intronic
950416561 3:12872378-12872400 CAGGAGCCCAGCAGAACAAGTGG - Intergenic
951574130 3:24096312-24096334 GAGCAGCCAAGGAGACCCAAAGG + Intergenic
953032745 3:39188829-39188851 CGGGAGCCCAGGCGGTCCAGCGG + Exonic
953414436 3:42707516-42707538 CAGGGTCCCAGGAGCCGCAGTGG + Intronic
954424801 3:50437716-50437738 CAGGAGCCCAGGAGAGCCCAGGG + Intronic
954859358 3:53674776-53674798 CAGGATACCAGGAGGCCAAGAGG + Intronic
955619945 3:60852284-60852306 TAGGGACCCAGGAGACCCAATGG - Intronic
956734975 3:72231428-72231450 CAGGAGCTGAGGAGCACCAGGGG + Intergenic
957434988 3:80163191-80163213 CAGGGACCCTGGGGACCCAGAGG - Intergenic
957586494 3:82139199-82139221 CATGACCCCTGGAGCCCCAGAGG + Intergenic
960004432 3:112767553-112767575 CAGCAGCTGAGGAGACCTAGGGG - Intronic
961339625 3:126209324-126209346 CAGGAGGCCTGGAGACCTTGTGG - Intergenic
961347814 3:126275440-126275462 GGGGAGCCCAGGAGACCCAGGGG + Intergenic
961381495 3:126498897-126498919 CAGCAGCCCAGGACAAGCAGGGG - Intronic
961510348 3:127397215-127397237 CTGGAGCCCAAGAGCTCCAGTGG + Intergenic
961514879 3:127426301-127426323 CAGGAGGCCTGGAGAACAAGTGG + Intergenic
961572906 3:127813255-127813277 CAGGAGCCCAGGAGGCCTCTGGG - Intronic
963262428 3:143206273-143206295 CCGAAGCCCTGGAGAGCCAGGGG - Intergenic
963760624 3:149284266-149284288 CAGGAGCCCACGGGGCGCAGGGG - Intergenic
964451437 3:156816747-156816769 CAGGCGCCAAGGAGGCCGAGAGG + Intergenic
966835767 3:184048445-184048467 CAGAGGCTCAGGAGAGCCAGAGG - Intergenic
967884302 3:194322670-194322692 CAGGAGCACAGGAACACCAGAGG + Intergenic
967980099 3:195060550-195060572 GAAGAGCCCTGCAGACCCAGAGG - Intergenic
968060557 3:195723981-195724003 CAGGACACCGGGAGACCCTGAGG - Intronic
968069143 3:195775141-195775163 GAGGAGGCCAGGAGAGCCTGCGG - Intronic
968761342 4:2444030-2444052 CAGAAGACCTGGAGGCCCAGGGG + Intronic
969055310 4:4397859-4397881 CAAGAGGCCATGAGCCCCAGTGG - Intronic
969577687 4:8046183-8046205 CATCAGCCCAGGGGACACAGCGG - Intronic
970275213 4:14392239-14392261 CAGGAACGCAGAATACCCAGAGG - Intergenic
972687588 4:41365953-41365975 CTGGAGGCCAAGAGACCCAGTGG - Intronic
973789483 4:54365083-54365105 CAGGAGAGCGGGACACCCAGAGG + Intergenic
975126526 4:70788372-70788394 CAAGAGCCCAGGGAACCCAGAGG - Intronic
975481141 4:74881778-74881800 CAGAATCCCAGGAGAGGCAGAGG + Intergenic
977199459 4:94098852-94098874 GAGGGGCCCAGGAGACAAAGAGG - Intergenic
977357886 4:95969563-95969585 CATGACCCCGGGAGCCCCAGAGG - Intergenic
977562560 4:98547197-98547219 GAGGAGCCGAGGAGCCTCAGTGG - Intronic
979036516 4:115726259-115726281 CATGAGCCCACCAGACCCATAGG - Intergenic
979832452 4:125318009-125318031 CAGGCCCCCAGAGGACCCAGTGG - Exonic
980502043 4:133668700-133668722 CAGGACTCCAGATGACCCAGAGG - Intergenic
982729856 4:158944394-158944416 CAGAAGCAGAGGAGACCCTGGGG - Intronic
984144509 4:176044515-176044537 CTGGGGCCCAGTAGACCAAGGGG + Intergenic
984382927 4:179017939-179017961 CGGGACCCCTGGAGCCCCAGAGG - Intergenic
984744029 4:183196143-183196165 CAGGAGCCCAGTAGACACTGGGG + Intronic
985416792 4:189743062-189743084 CTGGAGCCCAGTAGCCCCACTGG + Intergenic
985562663 5:598736-598758 CAGTGGCACAGGAGAGCCAGGGG - Intergenic
985813661 5:2110760-2110782 CGGGAACCCAGGAGACACACTGG + Intergenic
985890355 5:2710519-2710541 CAGGTGGCCAGGAGACTCAGAGG - Intergenic
986727898 5:10613140-10613162 CGGGAGCCCACGACAGCCAGGGG - Intronic
986768031 5:10945887-10945909 CTGGAGTCCAGGGGGCCCAGAGG + Intergenic
987230899 5:15892460-15892482 CAGGAGCTCAGAAGTCACAGCGG + Intronic
987268423 5:16279880-16279902 CATGATCCCTGGAGACCCAGAGG + Intergenic
987389157 5:17359966-17359988 CAGAAGCCCTGGAGAACAAGGGG - Intergenic
988254807 5:28808464-28808486 CAGGAGCCCATGAGAGTGAGAGG + Intergenic
989115169 5:37945537-37945559 CAGGAGCCCAGGAGTTTCTGGGG + Intergenic
990695870 5:58416310-58416332 CTGGAGACCTGGAGACACAGAGG - Intergenic
992739233 5:79756365-79756387 CAGGAGCACAGGAAACAGAGGGG - Intronic
993845008 5:92930637-92930659 CAGGAGCCCGGAAGACACATTGG + Intergenic
996351040 5:122542171-122542193 CAGGAGGCCAGGAGTCTGAGGGG - Intergenic
996393439 5:122988211-122988233 CAGAAGCTCAGGAGACACAAAGG - Intronic
997444979 5:133934127-133934149 CAGGATGTCAGGAGACACAGAGG - Intergenic
997658292 5:135571368-135571390 CATAAGCCCAGGAGAGCCCGTGG + Exonic
998446528 5:142203157-142203179 CAGGAGCCCACAAGATCCACAGG + Intergenic
999238618 5:150114675-150114697 CAGGAGCCCAGCTGACCCCCAGG + Exonic
999686460 5:154107687-154107709 AACAAGCCCAGGACACCCAGAGG + Intronic
1000920479 5:167131481-167131503 CTGGAGCCTAGGTGTCCCAGTGG - Intergenic
1001022437 5:168194954-168194976 CGGGTGCCCAGGAGACCCCTGGG + Intronic
1001354926 5:171010138-171010160 CAAGATTCCAGGAAACCCAGAGG + Intronic
1001407516 5:171486331-171486353 CAGGAGCCCAAGAGTCCCCAAGG + Intergenic
1001719424 5:173844410-173844432 CAGCAGGCCAAGAGTCCCAGAGG + Intergenic
1002423978 5:179165129-179165151 CTGGAGCCCAAGTGACCCACAGG - Intronic
1002574857 5:180168703-180168725 CAGGAGCCCAGAATTCCAAGAGG - Intronic
1002586604 5:180252692-180252714 CAGGGTCCCAGGCCACCCAGTGG - Intronic
1002708837 5:181181857-181181879 GAGGATCGCAGGAGCCCCAGAGG - Intergenic
1003551672 6:7107195-7107217 CAGATGCCTCGGAGACCCAGAGG + Intergenic
1004477931 6:15991253-15991275 CAGGAACCTAACAGACCCAGGGG - Intergenic
1005265936 6:24112412-24112434 GAGGGGCCCAGGAGACAAAGAGG + Intergenic
1005905149 6:30255962-30255984 GAGGGACCCAGGGGACCCAGTGG - Intergenic
1005994988 6:30925600-30925622 CAGTAGCCCAGGGTGCCCAGGGG - Exonic
1006174706 6:32114963-32114985 CTCGAGAGCAGGAGACCCAGAGG + Intronic
1006211807 6:32401691-32401713 CACGAGACCATGTGACCCAGAGG - Intronic
1006473744 6:34242461-34242483 CAAGAGCCCAGAAGACCCCTAGG - Intronic
1007693233 6:43716218-43716240 CAGCAGCCAAGGAGCCCTAGGGG - Intergenic
1007825345 6:44595718-44595740 CAGGAACCCTGGAGACCATGTGG + Intergenic
1008572780 6:52830984-52831006 CAGAAGCCCAGGTGTCCTAGGGG + Intergenic
1008579727 6:52895950-52895972 CAGAAGCCCAGGTGTCCGAGGGG + Intronic
1012490783 6:99780453-99780475 GAAGAGCCCAGCAGACCAAGGGG + Intergenic
1012761690 6:103310289-103310311 CAGGACCCCAGCAGGTCCAGAGG - Intergenic
1016977692 6:149825032-149825054 CAGGAGGCCAGCAGACCAAGGGG + Intronic
1017324505 6:153130719-153130741 CAGGGGCGCGGGAGACCCCGCGG - Intronic
1017978110 6:159375521-159375543 CAGGAGCTGAGGAGACCCGCAGG - Intergenic
1018455171 6:163945259-163945281 CAGGAGACCAGGAAACACAGAGG + Intergenic
1018503631 6:164440849-164440871 TAGGTGCCCAGGAGAGCCTGAGG + Intergenic
1018575165 6:165252106-165252128 CAGGAGACCAGGTGCACCAGTGG - Intergenic
1018640504 6:165900004-165900026 CAGGAGCCAAGGAGGCCATGAGG + Intronic
1018688156 6:166319369-166319391 GAGGAGACCAGGACAGCCAGTGG + Intergenic
1018765767 6:166931853-166931875 CAGGTGCTCAGGAGGCCCACAGG - Intronic
1019676174 7:2314094-2314116 CAGGAGGGCAGGGGACCCCGAGG + Intronic
1019815233 7:3195081-3195103 CAGGAACACAGGAGAAGCAGGGG + Intergenic
1019982485 7:4631682-4631704 CAGGAGCCCCGGAGAACAACAGG + Intergenic
1019997352 7:4733424-4733446 CAGGAGCCGAGCAGCCACAGTGG - Intronic
1020013905 7:4820305-4820327 CGGGAGCCCAGGAGCCCCAGGGG + Intronic
1021625697 7:22590937-22590959 CAGGAACCCAGGTGACCAGGTGG - Intronic
1021843944 7:24745967-24745989 CGGGAGCCCAGGAGAGCCTTGGG - Intronic
1022003214 7:26245288-26245310 CAGGAGCCCTGCAGGCCCACGGG + Intergenic
1022506033 7:30909083-30909105 CAGGAGGCCAGGGGGACCAGGGG - Intergenic
1022582058 7:31565200-31565222 CAGGGTCCCGGGAGACCAAGGGG - Intronic
1022849653 7:34247187-34247209 CCAGAACCCAGGAGACACAGGGG + Intergenic
1023302663 7:38790721-38790743 GAGGAGCCCAGGATCCACAGGGG + Intronic
1023820387 7:43977406-43977428 CAGGAGCACAGGTGCCCCAAGGG - Intergenic
1023982434 7:45077895-45077917 CAAGAGCCCAGGAGACTGTGTGG - Intergenic
1024292117 7:47812272-47812294 CAGCAGCCCAGGGGACCCTCAGG + Intronic
1024405608 7:48976022-48976044 CAGGAAAGCAGGAGACCCACAGG + Intergenic
1025819264 7:64947467-64947489 CAGGAGCCGGGGCGACCCAGAGG + Intergenic
1026828068 7:73596304-73596326 AAGGAGCCCAGGAGGGCCTGGGG + Intronic
1026848254 7:73709460-73709482 TAGGGGCCTAGGGGACCCAGAGG - Intronic
1027190302 7:75992546-75992568 CCGGCCCCCAGGAGACCCATCGG - Exonic
1028166168 7:87540528-87540550 CAGGAACCCAGGAGGCCAGGAGG - Intronic
1028360730 7:89963633-89963655 TAGAGGCCCAGGAGAACCAGTGG + Intergenic
1028531427 7:91842575-91842597 CACGACCCCTGGAGCCCCAGAGG - Intronic
1028607169 7:92667631-92667653 CTGGAGCCCAAGAGAGGCAGAGG - Intronic
1029469330 7:100744247-100744269 CAGGAGTGCAGGAGTCCAAGTGG - Intronic
1029603350 7:101583086-101583108 CAGGAGCCCAGCAGACCATGAGG + Intergenic
1029748671 7:102530927-102530949 CAGGAGCACAGGTGCCCCAAGGG - Intergenic
1029766618 7:102630011-102630033 CAGGAGCACAGGTGCCCCAAGGG - Intronic
1030187818 7:106780527-106780549 CTGGAGCCCAGGAAAGCCAATGG - Intergenic
1031976406 7:128096396-128096418 CAGAAGCCAAGCAGAACCAGGGG + Intergenic
1032928814 7:136641050-136641072 CAGGAGCCCATGAAATCCTGAGG + Intergenic
1033360591 7:140636413-140636435 CAGGAGTCCAGGAGACTGTGCGG + Intronic
1033633799 7:143189262-143189284 CATGACCCCTGGAGCCCCAGAGG + Intergenic
1033658401 7:143388226-143388248 CAGGGGCCCTGGGGCCCCAGGGG - Exonic
1034973062 7:155431257-155431279 CCTGAGCCCAGGACAACCAGAGG + Intergenic
1034983137 7:155491020-155491042 GAGCAGCCCAGGACTCCCAGGGG - Intronic
1035310048 7:157961881-157961903 AGTGAGCCCAGGAGACCCGGCGG + Intronic
1035476981 7:159150761-159150783 CAAGAGCCCTGGGCACCCAGAGG + Intergenic
1036184771 8:6613607-6613629 CAGGAGCCCAAGGGACCGGGGGG + Intronic
1036760822 8:11507547-11507569 CAGGAGCTTAGTGGACCCAGTGG + Intronic
1037683280 8:21116638-21116660 CTGGAGCCCTAGAGAGCCAGTGG - Intergenic
1037926962 8:22851215-22851237 CAGAAGCCCAGGAGTCTCCGTGG - Intronic
1038345514 8:26728567-26728589 CAGGAGCACAAGAGACCCAAGGG + Intergenic
1038396358 8:27248415-27248437 CAGGAACACAGGAGGCCCACTGG + Intronic
1039190792 8:34971827-34971849 CAGGAGCCCAGGCATCCCAAGGG - Intergenic
1039391021 8:37180830-37180852 TGGCAGCCCAGGAGCCCCAGAGG + Intergenic
1039772417 8:40700771-40700793 AAGGCACCCAGGAGACCCAAAGG - Intronic
1039889103 8:41672303-41672325 CAGGAGCCCAGAAGACAAAAAGG + Intronic
1040507612 8:48064928-48064950 CTGGAGCCCAGGATAGCCAAGGG - Intergenic
1041763585 8:61393692-61393714 CAGGAGCCTAGTAGCCCCAAAGG - Intronic
1045548084 8:103146233-103146255 CAGGAGCCCAGCAGAGGAAGGGG + Intronic
1046032386 8:108798641-108798663 CAGGAGTCCAGGAGAGTGAGTGG + Intergenic
1046626086 8:116578279-116578301 CTAGAGCCCAGGAGTTCCAGAGG + Intergenic
1047203646 8:122786237-122786259 CTAGGGCCCAGGAGACCCAAAGG - Intronic
1047227254 8:122967435-122967457 CTGGAGCCCAGCAGCCCCACTGG - Intronic
1047277523 8:123416953-123416975 CGGGAGCCTGGGAGACCCAGAGG - Intronic
1047283002 8:123461910-123461932 CAAAAGCCCAGGAGGCCCACGGG + Intronic
1047422194 8:124716478-124716500 CAGTGGCTCAGGTGACCCAGGGG + Intronic
1048337623 8:133514794-133514816 CAGGAACCCAGGAGATCTCGAGG - Intronic
1049256186 8:141615177-141615199 CAGGAGGACGGGAGACCCCGTGG - Intergenic
1049418242 8:142505309-142505331 CAAGAGCACAGGAGCCACAGTGG + Intronic
1049544384 8:143222815-143222837 CTGGGACCCAGGAGCCCCAGTGG + Intergenic
1049546347 8:143233228-143233250 TTGAGGCCCAGGAGACCCAGGGG + Intergenic
1050829147 9:9989759-9989781 CATGACCCCTGGAGCCCCAGCGG - Intronic
1051860658 9:21622041-21622063 CTAGAGACCAGGAGAGCCAGTGG - Intergenic
1054341238 9:63863965-63863987 CAGGAGAGCAAGAGAGCCAGGGG + Intergenic
1054798603 9:69325319-69325341 CAGGAGCCCGGGAGCACCACGGG - Intronic
1054868107 9:70024004-70024026 CTGGAGCCCAGGAAAGCCAATGG + Intergenic
1056933745 9:90899941-90899963 CAAGAGCAGAGGGGACCCAGGGG - Intergenic
1057157629 9:92857608-92857630 CAGGAGCCAGGGTGATCCAGAGG + Intronic
1057353837 9:94319777-94319799 CTGGAGCCAAGGACACCCGGAGG + Intronic
1057653914 9:96937815-96937837 CTGGAGCCAAGGACACCCGGAGG - Intronic
1057911588 9:99023943-99023965 CAGGAGGCCAGGGGAGCAAGAGG - Intronic
1057936042 9:99239727-99239749 CAGGAAAACAGGAGATCCAGGGG - Intergenic
1059345585 9:113625759-113625781 CAGGAGCTCAGGCCCCCCAGAGG + Intergenic
1059661866 9:116409401-116409423 GAAGAGCCCAGGAGACTTAGAGG + Intergenic
1060006035 9:120000706-120000728 CAGTGGCCCAGAACACCCAGTGG + Intergenic
1060033766 9:120237357-120237379 CAGGAGACAGGGAGACCGAGTGG - Intergenic
1060059197 9:120444028-120444050 CAGTTGCCCAGGAGACCCTAGGG - Intronic
1060187818 9:121574730-121574752 TTGGGGGCCAGGAGACCCAGTGG - Intronic
1060757388 9:126223426-126223448 GAGGGGCACTGGAGACCCAGAGG + Intergenic
1060930439 9:127486411-127486433 CAGGTGCCCAGCAGAGCCAGTGG + Intronic
1061390996 9:130316937-130316959 CAGGAGCCCAGGACCCTCATAGG - Intronic
1061570927 9:131477029-131477051 CAGGAGCCCAGCAAACGCAGAGG + Intronic
1061889045 9:133608129-133608151 CAGGAGCTCAGGAGAGCCAGCGG - Intergenic
1062032929 9:134370184-134370206 GAGGAGCCCCGGAGGCCCTGTGG + Intronic
1062339829 9:136089137-136089159 CTGCAGCCCGGGAGAACCAGCGG + Intronic
1062465169 9:136677673-136677695 CAGGAGACCGGGAGACACAGGGG + Intronic
1062552464 9:137095900-137095922 CGGGAGGCCTGGGGACCCAGAGG + Intronic
1062624127 9:137435339-137435361 CTGGGGCCCAGGAGACCAAGAGG + Intronic
1062696153 9:137877491-137877513 GAGGAGCCGAGGGCACCCAGGGG + Intergenic
1203636342 Un_KI270750v1:116584-116606 CTGGAGCCCAGTAGCCCCACTGG - Intergenic
1185534073 X:845918-845940 CAGGGGCCCCGGAGAGCGAGAGG - Intergenic
1187651532 X:21414013-21414035 CTGGGTCCCAGAAGACCCAGTGG - Intronic
1189007972 X:37014801-37014823 CAGGAGGCCAGCAGACTGAGAGG - Intergenic
1190110842 X:47588012-47588034 CAGGACCACAGAAGATCCAGGGG - Intronic
1190457115 X:50637267-50637289 CAGCAGCCCATGAGACCCTCAGG + Intronic
1192447639 X:71222924-71222946 GGGGACCCCAGGGGACCCAGAGG - Intronic
1192575751 X:72241895-72241917 CAGGCGCCCTGGATACCCAAAGG + Intronic
1195647520 X:107249523-107249545 CATGACCCCTGGAGCCCCAGAGG + Intergenic
1197356097 X:125438714-125438736 CAGGACCCCAGGAACCACAGAGG - Intergenic
1197955013 X:131937090-131937112 CACTAACCCAGGTGACCCAGAGG - Intergenic
1199683115 X:150241060-150241082 CAGGCGGTCAGGGGACCCAGCGG - Intergenic
1200059231 X:153476925-153476947 CAGGGGCTCAGCAGAGCCAGAGG - Intronic
1200080568 X:153574294-153574316 CAGCAGCCAGGGAGACCCATGGG - Intronic
1200874493 Y:8139099-8139121 CAGGAGCCGAGGTGATCAAGTGG - Intergenic
1201304926 Y:12542081-12542103 CAGGAGCCCAGGAGCCTCCCAGG + Intergenic
1202250468 Y:22865750-22865772 TAAGAGGCCAGGAGACCAAGGGG - Intergenic
1202403457 Y:24499498-24499520 TAAGAGGCCAGGAGACCAAGGGG - Intergenic
1202467322 Y:25170583-25170605 TAAGAGGCCAGGAGACCAAGGGG + Intergenic