ID: 1142197406

View in Genome Browser
Species Human (GRCh38)
Location 16:88745174-88745196
Sequence AGGAGCCCAGGAGACCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 1, 2: 4, 3: 36, 4: 312}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142197398_1142197406 4 Left 1142197398 16:88745147-88745169 CCGCAGGGACCCACTGCTGCCTC 0: 1
1: 0
2: 0
3: 61
4: 417
Right 1142197406 16:88745174-88745196 AGGAGCCCAGGAGACCCAGTGGG 0: 1
1: 1
2: 4
3: 36
4: 312
1142197393_1142197406 22 Left 1142197393 16:88745129-88745151 CCGGGGATCAGGCCACCTCCGCA 0: 1
1: 0
2: 0
3: 10
4: 207
Right 1142197406 16:88745174-88745196 AGGAGCCCAGGAGACCCAGTGGG 0: 1
1: 1
2: 4
3: 36
4: 312
1142197400_1142197406 -5 Left 1142197400 16:88745156-88745178 CCCACTGCTGCCTCTTCCAGGAG 0: 1
1: 0
2: 4
3: 49
4: 483
Right 1142197406 16:88745174-88745196 AGGAGCCCAGGAGACCCAGTGGG 0: 1
1: 1
2: 4
3: 36
4: 312
1142197397_1142197406 7 Left 1142197397 16:88745144-88745166 CCTCCGCAGGGACCCACTGCTGC 0: 1
1: 0
2: 0
3: 21
4: 200
Right 1142197406 16:88745174-88745196 AGGAGCCCAGGAGACCCAGTGGG 0: 1
1: 1
2: 4
3: 36
4: 312
1142197401_1142197406 -6 Left 1142197401 16:88745157-88745179 CCACTGCTGCCTCTTCCAGGAGC 0: 1
1: 0
2: 7
3: 58
4: 546
Right 1142197406 16:88745174-88745196 AGGAGCCCAGGAGACCCAGTGGG 0: 1
1: 1
2: 4
3: 36
4: 312
1142197396_1142197406 10 Left 1142197396 16:88745141-88745163 CCACCTCCGCAGGGACCCACTGC No data
Right 1142197406 16:88745174-88745196 AGGAGCCCAGGAGACCCAGTGGG 0: 1
1: 1
2: 4
3: 36
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142197406 Original CRISPR AGGAGCCCAGGAGACCCAGT GGG Intronic
900367059 1:2315607-2315629 AGGAGACCATGAGACACAGGCGG + Intergenic
900370393 1:2329583-2329605 AGGCACCCAGGAGACCCACTGGG - Intronic
900731882 1:4267484-4267506 GGGACCCCAGGGGACCCAGCAGG + Intergenic
900766521 1:4509618-4509640 AGGAGCCCGGGGGAGCCAGGTGG - Intergenic
900956835 1:5891505-5891527 AGGAGCCCGGGATACCCACGGGG - Intronic
900979070 1:6035900-6035922 AGAAGCCCAGGAGACTGAGAAGG + Intronic
902235765 1:15056329-15056351 AGGAGGCCATCTGACCCAGTGGG + Intronic
902406989 1:16189832-16189854 TGGACACCAGGAGACCCACTGGG - Intergenic
902917312 1:19646444-19646466 GTGAGCCCAGGAAACCCGGTTGG + Intronic
903183162 1:21615176-21615198 AGGAGCCCCCGGGACACAGTGGG + Intronic
903366146 1:22806601-22806623 AGGAGCCAAGCACACGCAGTAGG - Intronic
903396584 1:23006285-23006307 AGTTGCCCAGGGGACCCTGTGGG + Intergenic
904316485 1:29669522-29669544 AGCAGCCCGGCAGACCCAGGAGG + Intergenic
904961113 1:34333767-34333789 AGGAGTGCAGGAGAACCAATTGG - Intergenic
907388464 1:54141046-54141068 AGGAGCCCAGTAGGCACAGGAGG + Intronic
907633430 1:56107449-56107471 AGGAGCCCAGGAGCCCCAGTGGG + Intergenic
910021183 1:82591583-82591605 AGGAGTCCAGGAGTACAAGTAGG - Intergenic
910787665 1:91018131-91018153 AAGATCACAGGAGACCCAGAGGG - Intronic
912449874 1:109762076-109762098 AGGAGCCCAGGAAACCTGGATGG + Intronic
912473923 1:109923969-109923991 AGGAGCCCCGCAGAGCCAGAAGG + Exonic
912585173 1:110756773-110756795 AGCATCCCAAGAGAACCAGTTGG + Intergenic
915163477 1:153935111-153935133 AAGAGCCCAGAAGAGACAGTAGG + Intronic
915212616 1:154321882-154321904 GGGAGCCCAGGAGACCAACAGGG - Intronic
915886488 1:159727769-159727791 AGAAGCCCAGGAGACTGAGTAGG - Intergenic
916108708 1:161448107-161448129 GGGGGCCCAGGAGGCCCAGGGGG + Intergenic
916110296 1:161455488-161455510 GGGGGCCCAGGAGGCCCAGGGGG + Intergenic
916111881 1:161462898-161462920 GGGGGCCCAGGAGGCCCAGGGGG + Intergenic
916113468 1:161470279-161470301 GGGGGCCCAGGAGGCCCAGGGGG + Intergenic
917199869 1:172503068-172503090 AGAAGCCCAAGAGACCCCTTGGG - Intergenic
918538827 1:185605129-185605151 AGTAGCCCAGGAGACTGACTTGG - Intergenic
919844695 1:201634487-201634509 GGGAGGCCAGGAGAGGCAGTGGG + Intronic
919861204 1:201740368-201740390 AGGCGCCCAGGAGACCTGGACGG + Intronic
919878006 1:201884698-201884720 AGGAGCCCAGCCCAGCCAGTGGG - Intergenic
920081808 1:203380172-203380194 AGGGGCCCAGGAGGGTCAGTGGG - Intergenic
922171796 1:223161817-223161839 GGGACCCAAGGAGACCCAGGTGG - Intergenic
922183468 1:223254403-223254425 AGGAGTCCAGGAGAGACAGAGGG + Intronic
922891790 1:229067413-229067435 AGGAGCCCTGGAGAACCTGGAGG - Intergenic
923656627 1:235922522-235922544 AGCAGCCCAGTAGACTCAGGTGG - Intergenic
1062769561 10:88094-88116 AGGAGGCCAGGACACCCCCTGGG + Intergenic
1063233738 10:4090891-4090913 AAGAGGCCAGAAGACCCTGTGGG + Intergenic
1063350325 10:5348173-5348195 AGGAGCCCCGGGGGCTCAGTGGG + Intergenic
1063960801 10:11304115-11304137 AGGAACCCAGCAGACTCACTGGG + Intronic
1064930072 10:20615233-20615255 AGGAAACCAGAAGACCCACTTGG + Intergenic
1065509685 10:26466179-26466201 AGAAGCCCAGGACACCCGGAGGG - Intronic
1068348590 10:55814584-55814606 GGGAGCTGAGCAGACCCAGTAGG + Intergenic
1068934420 10:62622183-62622205 AGGAAGCCTGGAGACACAGTTGG - Intronic
1069327924 10:67253822-67253844 ATGGGCCCAGGAGGCCCAGAAGG + Intronic
1069751785 10:70749717-70749739 AGGAGCCCAGAAGGCTCACTGGG + Intronic
1070659215 10:78292939-78292961 AGGAGCCCAGAGGCCACAGTGGG - Intergenic
1070671153 10:78378203-78378225 TGGAGGCAGGGAGACCCAGTGGG - Intergenic
1070783855 10:79151963-79151985 AGCAGCCCAGGGGGCCCAGATGG - Intronic
1070813209 10:79308626-79308648 AGGACCCCAGGAGTCCAAGTCGG + Intronic
1072422005 10:95297113-95297135 AGGACCCCAGGAGACCATTTAGG + Intergenic
1072578315 10:96719986-96720008 CGGAGCCCAGGAGACGCGTTTGG + Intronic
1072983268 10:100117524-100117546 AGGATCCCAGGAGGCCGAGGCGG + Intergenic
1073297438 10:102449875-102449897 TTGAGCCCAGGAGACCAGGTTGG - Exonic
1075174260 10:120144609-120144631 AGGAGCCCTGGGGACCCTGTGGG - Intergenic
1076369080 10:129940369-129940391 ACTAGCCCAGGAGGCCCAGGGGG - Intronic
1076483715 10:130802038-130802060 GGGAGCCCGGGAGACCGAGCGGG - Intergenic
1076868334 10:133180336-133180358 TGGAGCCCAGAGGACGCAGTCGG - Intronic
1077068108 11:653820-653842 AGGAGCCCCGGATTCCCAGAGGG + Intronic
1077402547 11:2366329-2366351 AGGAGCCCAGCTGACCCAGAAGG - Intergenic
1079301704 11:19284377-19284399 AGGATACCAGGAGACACAGGAGG - Intergenic
1080849035 11:36051849-36051871 AAGAGCCCAGGAGCCCAAGGTGG - Intronic
1083387442 11:62322019-62322041 AGGAGCCCAGGATAACCTGGAGG + Intergenic
1083960344 11:66011866-66011888 GGGAGCCCAGGAGGCCGAGGGGG - Exonic
1084288393 11:68146468-68146490 TGGAGCCCAGGAGGCCATGTTGG - Intergenic
1084330072 11:68425022-68425044 CGGAGCCCAGGGCACCCAGCTGG - Intronic
1084425382 11:69081348-69081370 AGGAGCCCAGGAGCCCCACAGGG - Intronic
1084557717 11:69884796-69884818 AGGGGTCCAGGAGACCAAGGTGG - Intergenic
1084727193 11:70949567-70949589 TGGAGCCCAGGTCACCCTGTGGG - Intronic
1084727857 11:70953593-70953615 AGGAAGCCAGGAGACCCAGCAGG + Intronic
1084733984 11:71092713-71092735 GGGAGCCCAGGAGAAGCACTGGG - Intronic
1087970474 11:104474913-104474935 AGGAGCCCATGAGACTCTTTTGG - Intergenic
1088742097 11:112775558-112775580 TGGAACCCAGGTGACCCACTTGG - Intergenic
1088905988 11:114155905-114155927 ACGAGCCCATGGGACCCAGGAGG - Intronic
1089378603 11:118012110-118012132 AGGAGCCCAATAGAGCAAGTGGG - Intergenic
1089400232 11:118160194-118160216 AGAAGGCCAGGAGACCTAGTAGG + Intergenic
1090411899 11:126515049-126515071 ATGCTCCCAGGAGACCCGGTGGG + Intronic
1090725339 11:129520786-129520808 TGGAGACCAGGAGACCATGTGGG - Intergenic
1090997058 11:131876354-131876376 ATGAGTGGAGGAGACCCAGTGGG - Intronic
1091360841 11:134977541-134977563 AGGAGAACAGGAGGCCCAGGTGG - Intergenic
1096554295 12:52393996-52394018 AGAGGCCCTGGAGCCCCAGTGGG + Exonic
1097865661 12:64557328-64557350 TGGAACCCATGTGACCCAGTTGG - Intergenic
1100355255 12:93822522-93822544 AGGAGCCCAGGATCACCACTAGG - Intronic
1101129391 12:101673087-101673109 TGGAGACTAGGAGACCCAGCTGG + Intronic
1101659990 12:106757299-106757321 GGAAGCCCAGGAGTTCCAGTGGG + Intronic
1102190696 12:110985793-110985815 AGGAGGCCAGGAGACACAGTGGG - Intergenic
1102737376 12:115174736-115174758 AGAAGCCCAGTAAACCCTGTGGG - Intergenic
1104951812 12:132444494-132444516 TGGAGCCCAGCAGACCCCCTGGG - Intergenic
1106651744 13:31698392-31698414 AGGAATCCAGGAAACCCAGCTGG + Intergenic
1107903820 13:45044084-45044106 AGGTGCAGAGGAGACCCAGATGG - Intergenic
1109927732 13:69168116-69168138 AGGAGAAGAGGAGACGCAGTTGG + Intergenic
1110267839 13:73558521-73558543 AGGAGCCCAGGAGTTCAAGGCGG + Intergenic
1113054803 13:106256733-106256755 AGGACCCCAGGCTACCCTGTAGG + Intergenic
1115365565 14:32553249-32553271 TTGAACCCAGGAGACCCAGGAGG - Intronic
1117020259 14:51563149-51563171 AGTATCCCAGGAGAACCAGGAGG + Intronic
1118005282 14:61559867-61559889 GGGAGCCCTGGAGCCCCTGTTGG + Intronic
1118469781 14:66065235-66065257 AAGAGCCCAGGAGTCCTATTTGG + Intergenic
1119009871 14:70973318-70973340 AGAAGTCCAGGAGACTGAGTAGG + Intronic
1121219905 14:92277505-92277527 AGGAGGCCAGAGGACACAGTCGG - Intergenic
1121842475 14:97145734-97145756 GGGAGTCCTGGAGCCCCAGTAGG - Intergenic
1122125992 14:99579152-99579174 AGGAGCCCAGGGGACTGTGTGGG - Intronic
1122169976 14:99864729-99864751 TTGAACCCAGGAGACCGAGTTGG + Intronic
1122471274 14:101968370-101968392 GGGAGCCCAGGAGGCCGAGGTGG - Intronic
1122651269 14:103228468-103228490 AGGGGCCCAGGAGACAGAATGGG + Intergenic
1122703093 14:103603447-103603469 TTGAACCCAGGAGACCCAGGAGG + Intronic
1122817006 14:104318891-104318913 AGGAGGCCAGGAGGGACAGTGGG - Intergenic
1123405702 15:20018411-20018433 AGAAGCCCAGGAGGCCCGGAAGG - Intergenic
1123515032 15:21025059-21025081 AGAAGCCCAGGAGGCCCGGAAGG - Intergenic
1128311056 15:66632036-66632058 TGGATCCCAGGAGCCCCAGTGGG + Intronic
1129385384 15:75193358-75193380 AGGAGCCCTGGGGAGCCAATGGG - Intergenic
1130101500 15:80897916-80897938 AGGAGCCCAGAAGACCAAGAGGG + Intronic
1130687722 15:86053727-86053749 AGGATCCAAAGAGACCCAGGGGG - Intergenic
1131230343 15:90654614-90654636 GGGAGCCCAGGAGCCCAGGTGGG - Intergenic
1132458692 16:38640-38662 AGGAGCCCAGGACACTCCCTAGG + Intergenic
1132480851 16:165452-165474 AGGACCCCAGGAGACGCCGCGGG - Intronic
1132502985 16:292857-292879 CGGAGCCCAGAAGACCAAGGAGG + Intronic
1132656613 16:1044248-1044270 AGGAGCCCAGGGGTCCCAGGAGG - Intergenic
1133885943 16:9827737-9827759 GGGATCCCAGGAGATCCAGGTGG + Intronic
1134181511 16:12051492-12051514 ATGAGACCAGGAGAACCAGCTGG - Intronic
1134610673 16:15605742-15605764 AAGCTCCCAGGAGACCCAGTGGG + Intronic
1135033379 16:19056718-19056740 AGGAGCCCACGTGCCTCAGTGGG - Intronic
1135308240 16:21385190-21385212 ATGAGACCAGGAGAACCAGCTGG - Intergenic
1135664515 16:24324771-24324793 AGGAACAGAAGAGACCCAGTAGG - Intronic
1135974138 16:27096212-27096234 AGGAGGCAGGGAGACCCATTAGG + Intergenic
1136276143 16:29180468-29180490 AGGAGCCCAGAAAACCCCATGGG - Intergenic
1136304984 16:29364316-29364338 ATGAGACCAGGAGAACCAGCTGG - Intergenic
1136569631 16:31088855-31088877 TGGAGCCAGGGAGACCCAGGTGG - Exonic
1137587576 16:49673019-49673041 TGGAGCCCAGGAGCCCAAGGCGG + Intronic
1138194918 16:55044879-55044901 ATGAGCCAAGGAGACCAAGGAGG + Intergenic
1139436621 16:66940329-66940351 AGAAGCCCAGGACACCCAGGCGG - Exonic
1139848417 16:69936287-69936309 GGGGGCACAGGAGACCAAGTGGG - Intronic
1141187579 16:81798848-81798870 AGGAGCAGAGAAGACGCAGTGGG - Intronic
1141870377 16:86781294-86781316 AGCATCCCAGGAGATCCAGGAGG + Intergenic
1142062861 16:88041987-88042009 AGGAGCGTGGGAGACGCAGTAGG + Intronic
1142197406 16:88745174-88745196 AGGAGCCCAGGAGACCCAGTGGG + Intronic
1142271219 16:89090425-89090447 AGGAGGCCAGGAGAGGCCGTGGG + Intronic
1142426701 16:90005440-90005462 TGGAGCCCATGGGACCCCGTGGG - Exonic
1142580211 17:937313-937335 AAGAGCCCAGGAGTCCAAGAGGG + Intronic
1143411232 17:6710511-6710533 AGGAGTCAAGCAGACCCACTAGG + Intronic
1144764209 17:17724128-17724150 CGGCGCCCGGGAGACCCAGGAGG + Exonic
1144858089 17:18281792-18281814 AGGAGCACAGCAGTCCCAGGTGG + Intronic
1145013388 17:19382227-19382249 ATGGGCCCAGGAGGGCCAGTGGG - Exonic
1147266348 17:39237096-39237118 AGCAGCCCAGGAGCTCCAGTGGG - Intergenic
1147338621 17:39740996-39741018 AGGAACCCAGCAGACCCCTTTGG - Intronic
1150143579 17:62750217-62750239 AGGGCCCCAGAAGGCCCAGTAGG - Intronic
1150634856 17:66905743-66905765 AGGAGCCCAGGATAGCAAGCAGG + Intergenic
1150654888 17:67033151-67033173 AGGGTCCCCGGAGACCCAGCTGG - Exonic
1151016332 17:70557968-70557990 ATCAGCCCAGTAGGCCCAGTAGG - Intergenic
1151226987 17:72655110-72655132 AGGAGCCCAGGAGTGTCAGGAGG - Intronic
1151929330 17:77221615-77221637 TGGAGCCCAGGAGGTCAAGTTGG - Intergenic
1152962622 18:88888-88910 AGGAGGCCAGGACACCCCCTGGG + Intergenic
1153437110 18:5079414-5079436 AGATGCCCAGGCCACCCAGTAGG + Intergenic
1153661514 18:7330357-7330379 AGGAGGTCAGGAGACCCAGAGGG - Intergenic
1154494463 18:14945416-14945438 AGGAGAACAGGAGGCCCAGGTGG + Intergenic
1155202415 18:23528734-23528756 TGGAGCCCAGCAGACCGTGTGGG - Intronic
1157519166 18:48333704-48333726 TGGGGCCCAGGAGAGCCAGCAGG + Intronic
1160559014 18:79744862-79744884 AGGAACGCAGGAGACCCTGGAGG + Intronic
1160956969 19:1698340-1698362 AGGAGCCCATGAGCCCCGGCTGG + Intergenic
1160979468 19:1810345-1810367 TTGAACCCAGGAGACCCAGGAGG - Intronic
1161085337 19:2332629-2332651 AGGAGCCCTGCAGCCCCAGAAGG + Intronic
1161220527 19:3116082-3116104 TGGAGCCCCGGAGGCCCAGCAGG - Intronic
1161312673 19:3603605-3603627 AGGAGACCCTGAGACCCAGGAGG - Intronic
1161943932 19:7422627-7422649 AGGAGCCCAGGTGATCCAGGAGG - Intronic
1162299253 19:9835084-9835106 AGGAGCCGAGGAGAGCGAGTGGG + Intergenic
1165166996 19:33863728-33863750 AGGAGGCCAGTGGACACAGTGGG + Intergenic
1165622375 19:37259030-37259052 AGGAACCCAGGAGATTCAGCAGG - Intergenic
1165906137 19:39196114-39196136 AGGCCCCCAGAACACCCAGTTGG + Intergenic
1165945783 19:39441415-39441437 GGGACCCCAGGAGATCCAGCAGG - Intronic
1166916215 19:46197486-46197508 AGGAGGACAGGAGAGCCAGGAGG - Intergenic
1168115122 19:54218061-54218083 AGGAGCCCAGGGGACGGAGGTGG + Intronic
1168592204 19:57646708-57646730 AGGAGCAAAAGAGACCCAATAGG - Intergenic
925091531 2:1160550-1160572 AGTAGCCCAGGACACGAAGTTGG - Intronic
925961255 2:9018943-9018965 AGGAGCCCACGAGAGCCGGATGG - Intergenic
926795683 2:16617214-16617236 AGGAGCACAGATGACCAAGTGGG + Intronic
927208094 2:20622674-20622696 AGGAGTCCATGTGTCCCAGTGGG - Intronic
927572664 2:24173808-24173830 AGGAATCCAGGTGCCCCAGTTGG - Intronic
927683520 2:25155451-25155473 AGGAGCCATGGAGACCCCTTTGG + Exonic
927945966 2:27135329-27135351 AGGTGCCCAGGAGGCTCAGGCGG + Intergenic
929443735 2:41986779-41986801 AGGATCCCAAGAGACCCGGGTGG + Intergenic
929621733 2:43361498-43361520 AGGAGAACAGGAGAACCAGATGG - Intronic
930582392 2:53228184-53228206 AGGGGCCCAAGAGCACCAGTGGG + Intergenic
931188028 2:59972459-59972481 AGGGGCAGAGGAGACCCGGTTGG + Intergenic
932405521 2:71510486-71510508 AGCATCCCAGGAGACCCAGGAGG - Intronic
935332539 2:101987740-101987762 AGGAGCTGAGAAGATCCAGTGGG + Intergenic
936487703 2:112940660-112940682 AGGAGCCTAGGAGAGCCAGATGG - Intergenic
936497465 2:113034870-113034892 AGGAGCCAAGGTGAGCCTGTGGG - Intronic
936598655 2:113874073-113874095 ATGAGCCCAGGAAATGCAGTTGG + Intergenic
937660637 2:124426654-124426676 AGGAGCCCAGCTGGCCCACTTGG + Intronic
937854939 2:126665601-126665623 GGGAGCCCTGGAGACCCTCTGGG + Intronic
937905934 2:127052782-127052804 CAGAGCCCAGGAGACCCTGTTGG + Intronic
938101413 2:128500299-128500321 AGGAGCCCAGAAGACCGGGGTGG + Intergenic
938375928 2:130806698-130806720 AGGAGGCATGGAGACCCAGAAGG - Intergenic
938406721 2:131036926-131036948 AGGAGCCCACCAGCCACAGTGGG - Intronic
938639732 2:133266356-133266378 AGGGGTCAAGGAGACCCAGGCGG + Intronic
940710738 2:157160454-157160476 GGAAGCCCAGGAGACCCAGTAGG - Intergenic
943063756 2:183065374-183065396 AGGAGCTCAGGAGACTGAGACGG + Intergenic
944223744 2:197328435-197328457 AGGGGCTCAGCAGACTCAGTAGG - Intergenic
944947617 2:204707960-204707982 AGGAGACCAAGAGACCCCTTTGG + Intronic
946053799 2:216884346-216884368 AGGATCCCTGGTGGCCCAGTGGG + Intergenic
946147914 2:217744645-217744667 TGGAGGCAAGGAGGCCCAGTGGG + Intronic
946766287 2:223044116-223044138 AGGAGGACAGGAGACCAAGGAGG - Intergenic
946843470 2:223839162-223839184 AGGAGCCTGGGGGACCCAGCTGG + Intergenic
947793360 2:232879972-232879994 ACGAGCCCAGGAGACCCCAAGGG + Intronic
948117574 2:235504991-235505013 AGGAGCCAAGGAGAGCCAAAGGG - Intronic
948384391 2:237572656-237572678 AGGGGCCCAGTGGACCCAGGTGG + Intergenic
1168970858 20:1929882-1929904 AGGGGCCCAGGAGCCTCAGGGGG - Intronic
1169279360 20:4253992-4254014 GTGAGCCCTGGAGACCCTGTTGG + Intergenic
1170586518 20:17738911-17738933 AGAATTCCAGGAGAGCCAGTGGG + Intergenic
1172938398 20:38637625-38637647 AGTTGCCCAGGAGATCCTGTAGG + Intronic
1173331276 20:42078090-42078112 GGGAGGCCAGCAGGCCCAGTGGG + Exonic
1174266156 20:49333720-49333742 AGGATCCAAGCAGACCCAATCGG - Intergenic
1174453302 20:50632787-50632809 ACTAGCCCAGGAGCCCCAGCAGG + Intronic
1175980999 20:62738591-62738613 AGGAGCCCATGAAAGCCAGAGGG - Intronic
1175997311 20:62817522-62817544 AGGAGCGCAGGTGCCCCCGTGGG - Intronic
1176044049 20:63083321-63083343 AGGAGCCCAGGAGGCCCAGCAGG + Intergenic
1176658614 21:9613004-9613026 TGGAGCCCAGTAGCCCCACTGGG - Intergenic
1179584754 21:42367446-42367468 AGGAGTCCAGGGGACCAACTGGG - Intergenic
1179727326 21:43347722-43347744 GGGACCCCAGGACACCCGGTGGG + Intergenic
1180986932 22:19910450-19910472 AGGAGCCCTGGGGTTCCAGTGGG - Intronic
1181435730 22:22909741-22909763 AGGAACCCAGGAGACCTCGATGG + Intergenic
1181938272 22:26454350-26454372 AGCAGCCCAGGACACACACTAGG - Intronic
1182468449 22:30532427-30532449 AGGAGCCCAGGAGCCCAGGAAGG + Intronic
1182584235 22:31334631-31334653 AGGATCCCAGGAGACAAGGTAGG - Intronic
1183286145 22:36965417-36965439 AGGAGCCCTGGAGACCCCTGAGG - Intergenic
1183383614 22:37502842-37502864 AGGAGCACATCAGACCCACTGGG + Intronic
1183427309 22:37746640-37746662 GGGAGCCCAGGCGACCCTGAGGG + Intronic
1183493698 22:38129881-38129903 AGGAGCCATGGGGACACAGTAGG + Intronic
1183579999 22:38718642-38718664 AGGAGCCATGGAAACTCAGTGGG + Intronic
1184109743 22:42387741-42387763 AGCAGCCCAGGTGGCCCAGGAGG - Intronic
1184248392 22:43247010-43247032 GGGAGCCCTGGAGACCCAGCAGG - Intronic
1184506819 22:44908654-44908676 AGGAGCCAAGGTCAGCCAGTAGG - Intronic
1185363065 22:50420728-50420750 AGGTGCCCAGGAGATCCTATAGG + Intronic
950646817 3:14382309-14382331 AGGAGACCAGGAGACCATGGAGG + Intergenic
951086790 3:18521055-18521077 TGGAACACAGGAGACCCATTAGG + Intergenic
951846082 3:27086269-27086291 TAGAACCCAGGAGACCCAGAAGG + Intergenic
953878747 3:46680869-46680891 GGGTGCCCAGGAGACGCAGCTGG + Intronic
954082759 3:48222131-48222153 AGCAGTCAAGGAGGCCCAGTGGG + Intergenic
954104898 3:48404690-48404712 AGGAGGCCAAGAAACCCAGCCGG + Intronic
954221069 3:49154285-49154307 AGGAGCTCTGGAGACACAGATGG + Intergenic
954224801 3:49174692-49174714 AGGAGCCCAGGAGGCTTGGTGGG - Intronic
954363217 3:50133326-50133348 ATGAGCCCTGGGGACACAGTGGG - Intergenic
954364967 3:50140782-50140804 GGGGGCCCAGGAGACCCAGGTGG + Intergenic
956042168 3:65155947-65155969 AGGATCGCAGGATCCCCAGTGGG + Intergenic
956296466 3:67720075-67720097 TTGAACCCAGGAGACCCAGGAGG - Intergenic
958493033 3:94802656-94802678 AGGGACCCAGGAGAACCAATAGG + Intergenic
959258284 3:104042587-104042609 AGGAGCCAAGGTGACACAGTAGG - Intergenic
960590874 3:119364151-119364173 AGGAACTCAGGAGGCCCTGTCGG + Intronic
961174273 3:124821133-124821155 AGGAGTTCCGGAAACCCAGTTGG + Intronic
961514880 3:127426302-127426324 AGGAGGCCTGGAGAACAAGTGGG + Intergenic
962320656 3:134387893-134387915 AAGGGCACAGGGGACCCAGTCGG - Intergenic
964000240 3:151762314-151762336 AGGACCCCATGGGAGCCAGTAGG - Intergenic
968069142 3:195775140-195775162 AGGAGGCCAGGAGAGCCTGCGGG - Intronic
968609139 4:1549250-1549272 AGGGGCACAGAAGACCCAGATGG + Intergenic
969300075 4:6292399-6292421 AAAGGCCCAGGAGACCCAGCAGG + Intronic
969323183 4:6425337-6425359 AGGTGCCCAGGACACACAGCAGG - Intronic
969656987 4:8504251-8504273 AGGAGCGCAGGAGACTTAGGTGG - Intergenic
970876583 4:20877673-20877695 TGGCACCCAGGAGAGCCAGTTGG - Intronic
972054939 4:34789753-34789775 AGGAGACCAGAAGAGTCAGTAGG - Intergenic
973339029 4:48985895-48985917 AGGACCGCTGGAGACCCAGATGG - Intergenic
977562559 4:98547196-98547218 AGGAGCCGAGGAGCCTCAGTGGG - Intronic
978414578 4:108461875-108461897 GGGAGCCAGTGAGACCCAGTGGG + Intergenic
982134281 4:152258778-152258800 GGGGGCCCAGGAGCCCCAGATGG - Intergenic
985092155 4:186374473-186374495 AGGAAGCCAGGAGACTCATTAGG - Intergenic
985416793 4:189743063-189743085 TGGAGCCCAGTAGCCCCACTGGG + Intergenic
985618480 5:938666-938688 TTGAGCCCAGGAGACGCAGCAGG - Intergenic
986611084 5:9567938-9567960 AGGATCTCCAGAGACCCAGTTGG + Intergenic
987268424 5:16279881-16279903 ATGATCCCTGGAGACCCAGAGGG + Intergenic
992496927 5:77302815-77302837 AGGGGCCCAGGATGCCCTGTGGG + Intronic
995730155 5:115230181-115230203 AGGAGCCAAGGTCACTCAGTTGG + Intronic
998349949 5:141494017-141494039 GGGAGCCCTGGAGACTTAGTTGG + Intronic
999052103 5:148534186-148534208 AGGTGGCCAGGGAACCCAGTTGG - Intronic
1002068532 5:176664866-176664888 AGGAGCCCAGGACACGGAGCAGG - Intergenic
1002329414 5:178431171-178431193 AGGATCCCAGGAAGGCCAGTGGG + Intronic
1002525289 5:179812259-179812281 AGGAGCCCGAGGCACCCAGTGGG - Intronic
1005905148 6:30255961-30255983 AGGGACCCAGGGGACCCAGTGGG - Intergenic
1008072729 6:47113837-47113859 CAGAGCCCTGGAGACCCAGGAGG + Intergenic
1008542609 6:52558268-52558290 AGGAGCCCGGGAGCACCAGGTGG + Intronic
1011246253 6:85324187-85324209 AGGAAACCAGGAGACCCTTTAGG + Intergenic
1012401077 6:98843397-98843419 GGGAGCCCGGGAGACCCTCTGGG + Intergenic
1014770118 6:125450710-125450732 AGTAGGCCATGACACCCAGTGGG + Intergenic
1016977693 6:149825033-149825055 AGGAGGCCAGCAGACCAAGGGGG + Intronic
1018054074 6:160036443-160036465 CGGAGTCCAGGAGAGCCAGTTGG - Intronic
1018364041 6:163100109-163100131 AGGAGCCGAGGACAGCCAGGTGG + Intronic
1018575164 6:165252105-165252127 AGGAGACCAGGTGCACCAGTGGG - Intergenic
1018688157 6:166319370-166319392 AGGAGACCAGGACAGCCAGTGGG + Intergenic
1018988737 6:168657531-168657553 AAGTGCTCAGGAAACCCAGTGGG - Intronic
1019087938 6:169499755-169499777 AGGAGCTCAGGTGGCCCACTTGG - Intronic
1019104372 6:169656628-169656650 AGGAGCCAAGAAGGCCCAGGAGG + Intronic
1019268305 7:131492-131514 AGGAGCTCAGGACGCCCAGGAGG - Intergenic
1020397503 7:7733145-7733167 AGTAGCACACGATACCCAGTTGG + Intronic
1022414997 7:30170032-30170054 AGGACCCAAGGAGCCTCAGTGGG - Intergenic
1025108567 7:56193659-56193681 AGCAGCCGAGGAGAACCAGCTGG + Intergenic
1026154804 7:67817684-67817706 AGGATCCAAGGAGAGCCAGAAGG - Intergenic
1026828069 7:73596305-73596327 AGGAGCCCAGGAGGGCCTGGGGG + Intronic
1026848253 7:73709459-73709481 AGGGGCCTAGGGGACCCAGAGGG - Intronic
1026971831 7:74473229-74473251 AGGACCCCAGGAGAACCTGGTGG + Intronic
1030080996 7:105777703-105777725 TGGAGCCCAGGAGACCCGGAAGG - Intronic
1031893887 7:127325699-127325721 CTGAGCACAGGAGATCCAGTTGG - Intergenic
1035264721 7:157684691-157684713 GGGCGCGCAGGAGACCCGGTGGG - Intronic
1035737527 8:1899224-1899246 TGGAGCCCAGGTGACCCTGTAGG + Intronic
1037458665 8:19087194-19087216 AGGATGCCAGGATGCCCAGTTGG + Intergenic
1037994795 8:23344096-23344118 AGGAGCTCAGCAGACCCCGCTGG + Intronic
1038345515 8:26728568-26728590 AGGAGCACAAGAGACCCAAGGGG + Intergenic
1038396359 8:27248416-27248438 AGGAACACAGGAGGCCCACTGGG + Intronic
1038673120 8:29598134-29598156 AGGAGCCCAGATGTCCCAGGAGG - Intergenic
1039391022 8:37180831-37180853 GGCAGCCCAGGAGCCCCAGAGGG + Intergenic
1042011306 8:64248111-64248133 AGGAAGCCAGGAGAGGCAGTTGG - Intergenic
1042108035 8:65349321-65349343 AGGAGCCAAAGAAACCCAATAGG + Intergenic
1044501710 8:92965807-92965829 CGGAGTCCGGGAAACCCAGTAGG - Intronic
1047227253 8:122967434-122967456 TGGAGCCCAGCAGCCCCACTGGG - Intronic
1047293973 8:123554834-123554856 AGGAGCCTAGAAGACTCACTGGG + Intergenic
1049256185 8:141615176-141615198 AGGAGGACGGGAGACCCCGTGGG - Intergenic
1049280464 8:141741522-141741544 AGCAGCCCACAGGACCCAGTGGG - Intergenic
1049418243 8:142505310-142505332 AAGAGCACAGGAGCCACAGTGGG + Intronic
1049962601 9:750876-750898 AGGAGCCCACCAGCCCCATTTGG - Intergenic
1051819815 9:21151282-21151304 AAGACCCCAGGAGTCCCACTAGG - Intergenic
1053193988 9:36100721-36100743 AGGAGACAAGGACAGCCAGTAGG - Intronic
1055665264 9:78546649-78546671 AGGGACCCAGGAGAAGCAGTGGG - Intergenic
1055729295 9:79264238-79264260 AGGTGGCCAGGAGTCCCAGCTGG + Intergenic
1056738189 9:89227470-89227492 AAGATCCCAAGAGACCTAGTAGG + Intergenic
1059372333 9:113852506-113852528 ATGTGCACAGGAGACCCAGAAGG - Intergenic
1060187817 9:121574729-121574751 TGGGGGCCAGGAGACCCAGTGGG - Intronic
1060757389 9:126223427-126223449 AGGGGCACTGGAGACCCAGAGGG + Intergenic
1060930440 9:127486412-127486434 AGGTGCCCAGCAGAGCCAGTGGG + Intronic
1061406714 9:130396295-130396317 TGGATCCCAGGAGCCCCAGGTGG + Intronic
1061570928 9:131477030-131477052 AGGAGCCCAGCAAACGCAGAGGG + Intronic
1061671944 9:132193766-132193788 AGTAGCACACGAGACCCAGGTGG + Intronic
1061869662 9:133513936-133513958 AGGAGCCCAGGAGTCCCAGCCGG - Intergenic
1061889044 9:133608128-133608150 AGGAGCTCAGGAGAGCCAGCGGG - Intergenic
1062032930 9:134370185-134370207 AGGAGCCCCGGAGGCCCTGTGGG + Intronic
1062118581 9:134822118-134822140 GGGGGCCCAGGAGGCCCAATCGG - Exonic
1062234977 9:135503439-135503461 AGGAGCCCGGGAGTCCCTGGTGG + Intronic
1062235424 9:135505651-135505673 TGGACCTCAGGAGACACAGTGGG + Intergenic
1062247139 9:135575052-135575074 GTGAGCCCAGGGGACCCAGATGG + Intergenic
1062735517 9:138135228-138135250 AGGAGGCCAGGACACCCCCTGGG - Intergenic
1203636341 Un_KI270750v1:116583-116605 TGGAGCCCAGTAGCCCCACTGGG - Intergenic
1185836645 X:3350819-3350841 TGCAGCCCAGGAGACCCAGGAGG + Intergenic
1186319159 X:8405314-8405336 GGGAGCCCAGGGGACATAGTTGG + Intergenic
1186990295 X:15059995-15060017 AGGAGGCAGGGAGACCCAATAGG + Intergenic
1188531146 X:31142738-31142760 TGGAGCCCATGAGAGCCAATAGG + Intronic
1189479290 X:41380719-41380741 AGGAGCCCTGCCCACCCAGTTGG - Intergenic
1190756861 X:53408867-53408889 ATGAGCTCAGGAGAACAAGTTGG + Intronic
1193198126 X:78657787-78657809 AGCAGCCCAGGAGTCCCTGGAGG - Exonic
1193668250 X:84351163-84351185 GGGAGCCCAGGAGCTCCAGTAGG + Intronic
1193978756 X:88156271-88156293 AGAAGGCCAGGAGACTCAGCAGG - Intergenic
1195242212 X:102963605-102963627 AGGATCACAGGAGCCCCAGGAGG - Intergenic
1197718045 X:129724268-129724290 AGGAGCACAGGATCCCCAGATGG + Intergenic
1199720876 X:150542070-150542092 CGGAGCCCAGGAGGCCCTCTTGG - Intergenic
1199948015 X:152682832-152682854 AGGAGGACAGGAGCCCCAGGAGG + Intergenic
1199961664 X:152785622-152785644 AGGAGGACAGGAGCCCCAGGAGG - Intergenic
1200799973 Y:7377578-7377600 AGGAGCCGAGGGGACCCAACTGG - Intergenic
1201239970 Y:11949232-11949254 TGCAGCCCAGGAGACCCAGGAGG - Intergenic