ID: 1142201270

View in Genome Browser
Species Human (GRCh38)
Location 16:88762200-88762222
Sequence TGAGCTCTGGGTGGGCCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 391}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142201270_1142201283 9 Left 1142201270 16:88762200-88762222 CCTCCCGGCCCACCCAGAGCTCA 0: 1
1: 0
2: 4
3: 40
4: 391
Right 1142201283 16:88762232-88762254 GCAGAGCCCAGCTGAAGAAAGGG 0: 1
1: 0
2: 3
3: 102
4: 1283
1142201270_1142201282 8 Left 1142201270 16:88762200-88762222 CCTCCCGGCCCACCCAGAGCTCA 0: 1
1: 0
2: 4
3: 40
4: 391
Right 1142201282 16:88762231-88762253 GGCAGAGCCCAGCTGAAGAAAGG 0: 1
1: 0
2: 2
3: 50
4: 333
1142201270_1142201286 19 Left 1142201270 16:88762200-88762222 CCTCCCGGCCCACCCAGAGCTCA 0: 1
1: 0
2: 4
3: 40
4: 391
Right 1142201286 16:88762242-88762264 GCTGAAGAAAGGGCCCCCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142201270 Original CRISPR TGAGCTCTGGGTGGGCCGGG AGG (reversed) Intronic
900523846 1:3119033-3119055 AGAGCTGGGGGTGGCCCGGGAGG + Intronic
900638570 1:3677278-3677300 TGAGGTCTGGGTTTGCCGGAGGG + Intronic
900736107 1:4300392-4300414 TGGGCTCTGGGTGGGTTGGTAGG + Intergenic
901087381 1:6619624-6619646 TGAGTTCTGGCTGGGCGTGGTGG - Intronic
901104815 1:6746903-6746925 GAAGCTCAGGGTGGGCGGGGGGG + Intergenic
901109759 1:6785408-6785430 GGAGCTGTGCGTGGGCCGCGGGG + Exonic
901131992 1:6967641-6967663 TGAGCTCTGGCTGTGCTGTGTGG + Intronic
901468933 1:9442053-9442075 TGAGCTCTGGCTGGGGGCGGGGG + Intergenic
901492608 1:9604044-9604066 TGGGCTCTTTGTGGGCTGGGGGG - Intronic
901655826 1:10768638-10768660 TGGGCTCTGGCTGGGCAGGAGGG - Intronic
901669731 1:10849257-10849279 GGAGCTCTGCCTGGTCCGGGTGG - Intergenic
901874983 1:12162272-12162294 TGAGCTGTGGTTGTGCTGGGAGG - Intergenic
902807310 1:18869152-18869174 GGAGCTCTGGGTCAGCCTGGTGG + Intronic
903190988 1:21655899-21655921 TGGGCTCTAGGTGGGGCTGGTGG + Intronic
903236700 1:21955363-21955385 TCAGCTCTGGGTGGGGGGGCCGG + Intergenic
903500472 1:23797626-23797648 TGGGCTCAGGGTGGGCCCTGAGG + Intronic
904081911 1:27877612-27877634 TGAGCTCTGGCCGGGCATGGTGG - Intronic
904416990 1:30369028-30369050 TGGGCTCTGGCTGGGGCAGGAGG + Intergenic
904955866 1:34283440-34283462 TGAGCTGTGGGAGGGTGGGGTGG - Intergenic
905233766 1:36531170-36531192 TGAGCTCTGGATGGGTTGGTGGG + Intergenic
905546537 1:38804502-38804524 AGAGATCTGGCTGGGCCGTGCGG - Intergenic
905630658 1:39516388-39516410 GGAGCTCTGGGAGGGCCTGACGG + Intronic
905636824 1:39559563-39559585 TGAGCTGGGGGTGGGCAGAGTGG - Intergenic
905664581 1:39755263-39755285 TGAGATCTGGATGAGCCAGGAGG + Intronic
905667103 1:39769782-39769804 GGAGCTCTGGGAGGGCCTGACGG - Exonic
905827516 1:41037279-41037301 TGAGCTCTGGGAGGCCAGAGAGG - Intronic
906067273 1:42990885-42990907 TGTGCTTTGGGAGGGACGGGAGG - Intergenic
908117381 1:60953337-60953359 TGAGCTGGGGGTGGGCTGGGTGG + Intronic
910047214 1:82932257-82932279 TGAGCTCTGGGTGAGCCTGCTGG - Intergenic
910213071 1:84813813-84813835 GGAGGCCTGGGTGGGCCGAGAGG + Exonic
911594057 1:99780812-99780834 CTAGCTCTGGGTGGACTGGGAGG + Intergenic
913010219 1:114675894-114675916 TGAGTTCTGGGTCAGCCTGGGGG + Exonic
913103062 1:115587342-115587364 TGAGCACTGGGAGGACAGGGTGG + Intergenic
913677738 1:121157693-121157715 TGACCTCTGGCTGGGCCCGTAGG + Intergenic
914029572 1:143945322-143945344 TGACCTCTGGCTGGGCCCGTAGG + Intronic
914159877 1:145122628-145122650 TGACCTCTGGCTGGGCCCGTAGG - Intergenic
914985070 1:152449501-152449523 TGAGGACTGGGTGAGCTGGGTGG + Intergenic
916721356 1:167486782-167486804 GCAGCTCTGGGTGGGCATGGTGG + Intronic
916752197 1:167733455-167733477 TGTCCTCTGGCTGGGCCTGGTGG + Intronic
917929424 1:179813370-179813392 TGTGCTCTGAGTGGGCAGGCTGG - Intronic
919896559 1:202012898-202012920 TGAGCAGAGGGTGGGCCGGCAGG + Intronic
920382781 1:205545293-205545315 AGAGCCCTGGGTGGGCGTGGTGG - Intergenic
920465043 1:206176203-206176225 TGACCTCTGGCTGGGCCCGTAGG + Intergenic
921932848 1:220769377-220769399 TGAGATCTGCCTGGGCCGGTGGG + Intronic
922490246 1:226010657-226010679 TGAGCTCTGGCCGGGCATGGTGG - Intergenic
923864674 1:237927105-237927127 TGAGCTGTGCGTGGCCCTGGAGG + Intergenic
924382073 1:243474492-243474514 GGAGGTCTGGGTGGGCAGGGAGG + Intronic
924478905 1:244409011-244409033 TGAGCTTTGGTGGGGCTGGGAGG - Exonic
1062829623 10:597084-597106 GGAGCCCTGGGTGGACAGGGTGG - Intronic
1064551540 10:16506214-16506236 TGAGAAATGGGTGGGCCGTGAGG + Intronic
1068963890 10:62892773-62892795 TGAGCTGTGTGGGTGCCGGGTGG - Intronic
1069162292 10:65106940-65106962 TCTGCCCTGGGTGGGCCAGGTGG - Intergenic
1069409226 10:68135238-68135260 TGAGTTCTGGTTGGGCACGGTGG - Intronic
1069834751 10:71301418-71301440 TAGGCTCTGGCTGGGCCCGGAGG + Exonic
1070245977 10:74731418-74731440 TGAGATCTGGGGGGCCAGGGTGG + Intergenic
1070284930 10:75075995-75076017 CGGCCTCTGGGTGGGCAGGGAGG - Intergenic
1070782669 10:79146665-79146687 TGCCCTCTGGGTGGGGAGGGCGG + Intronic
1070793577 10:79203963-79203985 GGAGCTCTGGATGGCCCAGGGGG - Intronic
1072482576 10:95823404-95823426 GGAGATCTGGGTGGGACAGGGGG + Intronic
1073057858 10:100713655-100713677 TGGGAGCTGGGTGGGCGGGGTGG + Intergenic
1073115360 10:101088689-101088711 TGAGCTCTGTGTGGCTTGGGTGG + Intergenic
1073122559 10:101131568-101131590 TGGGCTCTGCGTGACCCGGGTGG - Exonic
1073377494 10:103049091-103049113 AGAGCTTTGGGAGGCCCGGGCGG - Intronic
1073393755 10:103201046-103201068 TGAGAGCTGGCTGGGCCTGGTGG - Intergenic
1073600581 10:104842436-104842458 TGATCTCTGGGTGGCCTTGGTGG + Intronic
1076662638 10:132065606-132065628 TGGGCTCCGGGTTGGCCCGGCGG - Intergenic
1076683136 10:132185619-132185641 TGGGCGCTGGGAAGGCCGGGCGG - Intergenic
1076780696 10:132722950-132722972 TGAGCTCTGGGAGGGCAGCGGGG + Intronic
1077076059 11:702779-702801 TGAGTTCTGGGTGGCCATGGAGG + Intronic
1078419980 11:11202688-11202710 TGAGCACTGGCTGGGCACGGTGG + Intergenic
1078800811 11:14643332-14643354 TGAGCTAAGGGTGGGAGGGGAGG - Intronic
1080229951 11:30009192-30009214 TGAGCTCTGGTTGGGGGCGGGGG - Intergenic
1083147960 11:60772828-60772850 TGAAGTCTGGGTGGGCTGAGAGG - Intronic
1083609529 11:63998440-63998462 AGAGCTCTCGGTGAGCCAGGCGG - Intronic
1083625972 11:64072152-64072174 GGAGCTGTGGCTGGGCCTGGGGG + Intronic
1083746828 11:64741641-64741663 TGAGCTCTGGGAGGGGTTGGAGG + Intronic
1083964875 11:66037286-66037308 TGAGATCTGGGCGGGTGGGGGGG - Intergenic
1084651491 11:70491986-70492008 TGTGCTCTGGGTGGACCAGGAGG + Intronic
1084659548 11:70538788-70538810 AAAGCACTGGGTGGGGCGGGAGG + Intronic
1087744026 11:101922070-101922092 TGAGCTCAGGCTGGGCGCGGTGG - Intronic
1089536463 11:119163457-119163479 TGAGCCCTGGGTGTGCCTGCAGG + Intergenic
1091302301 11:134515340-134515362 AGAGCTCTGGGTGGGCTGAGAGG - Intergenic
1092144791 12:6207167-6207189 TGAGCTCAGGCTGGGCGTGGTGG - Intronic
1092168023 12:6354989-6355011 TGAGCAGTGGGTGGGCATGGGGG - Intronic
1096125309 12:49114945-49114967 TGAGCTCTGGCTGGGTACGGTGG - Intergenic
1096170173 12:49462356-49462378 TGAACTCTGTGTGGGCCCCGTGG + Intronic
1096177477 12:49532438-49532460 TGAGCTAGGGCTGGGCCTGGTGG - Intergenic
1096233887 12:49912892-49912914 TGAGCTCCTGGAGGGCGGGGAGG - Intergenic
1096476922 12:51914075-51914097 TGAGCAGTGGGTGAGCCCGGTGG + Intronic
1098463511 12:70760399-70760421 AAAGCTCTGGGTGGGCATGGTGG - Intronic
1100587806 12:95995820-95995842 TGTGGGCTGGCTGGGCCGGGAGG - Exonic
1101439279 12:104691237-104691259 TCAGCTCTGGATGGGCTGTGAGG + Intronic
1101863354 12:108500477-108500499 TGAGCCGTGGCTGGGCAGGGTGG + Intergenic
1101867840 12:108535331-108535353 TGATCTCGGGGTGGGGAGGGAGG - Intronic
1102594486 12:113982022-113982044 AGAGCCCTGGCTGGGCCTGGGGG + Intergenic
1103371859 12:120425272-120425294 TCACCTCTGGGTGGGCCTGGTGG - Intergenic
1103534845 12:121627118-121627140 GGCTCTCTGGGCGGGCCGGGCGG + Intronic
1103625997 12:122220231-122220253 TGAGGTCAGGGTGGGCATGGTGG - Intronic
1104697061 12:130871885-130871907 TGCGCTTAGGGTGGGGCGGGAGG - Exonic
1104744858 12:131204334-131204356 GCAGCTCTGGGCTGGCCGGGGGG - Intergenic
1104856055 12:131903020-131903042 TGGGTTCTGGGTGGGCCCAGGGG + Intronic
1107371631 13:39756730-39756752 AGAGCTCTGGGCGGGGCGGGGGG + Intronic
1108212930 13:48156686-48156708 TGAGCCCTGGGGGAGCAGGGTGG + Intergenic
1112402850 13:99090407-99090429 TGACCTCTGGCTGGACTGGGTGG + Intergenic
1113955104 13:114096122-114096144 TGCTCTCTGGGTGGCCTGGGTGG + Intronic
1114166596 14:20225027-20225049 TGAGATCTGGCTGGGCACGGTGG + Intergenic
1114179621 14:20354787-20354809 TGATCTCTGGGTGGGCCTGCAGG + Exonic
1114455002 14:22848540-22848562 GGAGCCCAGGGTGGGCTGGGTGG - Intronic
1114529428 14:23386572-23386594 TGAACTCTAGCTGGGCCCGGAGG + Exonic
1115203312 14:30875359-30875381 GGGGCTGTGGGTGGGCCTGGAGG - Intronic
1115474359 14:33799717-33799739 TGTCCTCTGTGTGGGGCGGGGGG - Exonic
1116594179 14:46819289-46819311 TGTGCACTGGGTGAACCGGGTGG + Intergenic
1118367147 14:65105634-65105656 TGAGATTTGGCTGGGCAGGGTGG - Intergenic
1119010627 14:70983588-70983610 TTAGCTATGGGTGGGCACGGTGG - Intronic
1119890206 14:78176844-78176866 TGAGGTCTTGGTGGGGCAGGTGG + Intergenic
1121240239 14:92424572-92424594 TCAGCTCTGGATGGGCATGGTGG + Intronic
1121570133 14:94940976-94940998 TGAGCACTGGGTGCGCCTGCCGG - Intergenic
1122135025 14:99627871-99627893 TGAGGTCAGGATGGGCTGGGAGG + Intergenic
1123032361 14:105458033-105458055 TGCATTCTGGGTGGGCTGGGAGG + Intronic
1123110275 14:105863938-105863960 TGAGCCCGGGGAGGGCCCGGGGG + Intergenic
1123500632 15:20878121-20878143 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1123594106 15:21889095-21889117 TGAGCTCTGGGTGCGCCCGGCGG + Intergenic
1123777660 15:23596852-23596874 TGAGCACTGGGAGGGCGGGGTGG - Intronic
1124130154 15:26976579-26976601 TGAGGTCTTGGTGGTCAGGGTGG + Intronic
1124614106 15:31229286-31229308 TGCCCTCTGGTGGGGCCGGGGGG + Intergenic
1128308748 15:66617465-66617487 TGAGGGCTGGGTGGGCAGGAGGG - Intronic
1129082235 15:73051923-73051945 CGAGCTCAGGCTGGTCCGGGAGG - Exonic
1129364073 15:75043726-75043748 CCAGCTCTGCCTGGGCCGGGAGG - Intronic
1129616796 15:77105131-77105153 TGAGCATTGGGTGGTCCTGGTGG + Exonic
1130960043 15:88653186-88653208 TGAGCTCTTGGTTGGTTGGGAGG + Intronic
1131650163 15:94389307-94389329 GGAGCTCAGGGTGGGCATGGAGG + Intronic
1202966228 15_KI270727v1_random:178986-179008 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1132549624 16:548952-548974 TGTGCTCAGGCTGGGCAGGGTGG - Intronic
1132651458 16:1023079-1023101 GGGGCACTGGGTGGGGCGGGGGG + Intergenic
1132657351 16:1046833-1046855 TGAGCCCGGGGTGGGCCGAGAGG - Intergenic
1132747775 16:1444100-1444122 TGAGCTCTGGGTGGTGGGCGAGG - Intronic
1132939837 16:2501190-2501212 CCAGCTCTGGGTGGGGCTGGGGG - Exonic
1133118411 16:3591355-3591377 TGGGCTCTGGGTGCCCCGGTGGG + Intronic
1133136899 16:3718375-3718397 TGAGTTCTGGTTGGGCGCGGTGG + Intergenic
1133299194 16:4771842-4771864 AGTGCTCTGGGTGGCCAGGGAGG + Intergenic
1133390351 16:5405166-5405188 TGTGCCCAGGGTGGGCCAGGTGG + Intergenic
1133442901 16:5835855-5835877 TGTGCTCTGGGAGGGATGGGAGG - Intergenic
1134291213 16:12903634-12903656 TGAGGTCCGGGCGGGCGGGGTGG + Intronic
1136254415 16:29028774-29028796 GGGGCTCTGGCTGGGCTGGGCGG + Intergenic
1136293789 16:29290635-29290657 TGAGTTGTGGCTGGGCTGGGAGG - Intergenic
1136363795 16:29799132-29799154 GGAGCGCTGGTTGAGCCGGGTGG - Exonic
1137629343 16:49931223-49931245 TGAGGTCTGGGTGGGCAAGAGGG + Intergenic
1139196081 16:64920131-64920153 TGCTCTGTGGGTGGGCTGGGTGG - Intergenic
1139387411 16:66581731-66581753 TGAGCTTTGAGTGGGCGGAGAGG + Intronic
1140655486 16:77135138-77135160 TGAGCTCTGGGGAGGCAAGGGGG + Intergenic
1141424419 16:83935882-83935904 TCAGCTCTGGGAGGGCCGGGTGG - Intronic
1141431030 16:83970198-83970220 TGAGCGGGGGGTGGGGCGGGAGG + Intronic
1141903621 16:87008491-87008513 TGAGCCTTGGGTGGGCTGGAAGG + Intergenic
1142011042 16:87714338-87714360 TCATTTCGGGGTGGGCCGGGTGG - Intronic
1142020700 16:87780382-87780404 TGTGCTCTCTGTGGCCCGGGCGG - Intergenic
1142099687 16:88264681-88264703 TGAGGTGTGGCTGGGCTGGGAGG - Intergenic
1142201270 16:88762200-88762222 TGAGCTCTGGGTGGGCCGGGAGG - Intronic
1142964696 17:3573294-3573316 TGTGGTCTGGGTGGTCCTGGAGG - Intronic
1143433163 17:6901909-6901931 TGAGTTCTGGCTGGGCGCGGTGG + Intronic
1144771203 17:17760582-17760604 TGACTTCTGGGTGGGGCTGGGGG - Intronic
1144956803 17:19022795-19022817 TGAGATCTTGGTGGGCAGGCAGG - Intronic
1145276218 17:21432691-21432713 TGAGCTCTGGGAGGGCACGAAGG - Intergenic
1145314058 17:21718605-21718627 TGAGCTCTGGGAGGGCACGAAGG - Intergenic
1145868312 17:28254895-28254917 TGAGCTCTTGTAGGGGCGGGGGG - Intergenic
1145900448 17:28487590-28487612 AGAGTTCTGGGTGGACAGGGTGG + Intronic
1145941498 17:28745455-28745477 TCAGCTGTGGGGGGGTCGGGGGG - Intronic
1146000336 17:29126849-29126871 TGTTCTCTGGGTGGGGCAGGAGG - Intronic
1146508056 17:33422481-33422503 GAAGCTCTGGGTGGGCAGGAGGG + Intronic
1146637544 17:34517658-34517680 GGAGCTCTGGATGGGCAGGCAGG - Intergenic
1146687396 17:34850489-34850511 TGAGCTGTGGGTCGGCAGGAAGG + Intergenic
1147307500 17:39573920-39573942 TGCTCTCTTGGTGGGCGGGGAGG + Intergenic
1147384731 17:40074404-40074426 TGGCCTGTGGGTGTGCCGGGGGG + Exonic
1148084862 17:44987928-44987950 TGTCCTCTGGTTGGGGCGGGAGG + Intergenic
1148101413 17:45094140-45094162 GGGGCTCTGGGTGGCCGGGGTGG - Intronic
1148207415 17:45787847-45787869 TGAGCCCAGGGTGGGCCAGTGGG + Intronic
1149480159 17:56996804-56996826 AGAGCTTTGGCTGGGCCTGGTGG - Intronic
1149636019 17:58170069-58170091 TCAGCTCTGGGTGGGGCTGGTGG + Exonic
1149819902 17:59766215-59766237 TGTGCTCTGGCTGGGCCTGGTGG + Intronic
1150473312 17:65455951-65455973 TCTGCTCTGAGTGGGCAGGGAGG - Intergenic
1150604545 17:66679588-66679610 TGAGCCCTGGGTGTGCCTAGAGG - Intronic
1151147922 17:72058395-72058417 TGAACTCTGGGAGGGTGGGGGGG - Intergenic
1151519300 17:74616931-74616953 TCAGCCTTGGGTGGGCTGGGGGG - Intronic
1151836498 17:76585859-76585881 AGAGAACCGGGTGGGCCGGGTGG + Exonic
1151887442 17:76931563-76931585 AGGGCTCTGGGTGGGCTGGATGG + Intronic
1152148864 17:78586501-78586523 TGCGCACTGGTTGGACCGGGTGG + Intergenic
1152398526 17:80049841-80049863 TGAGCCCTGGGTCGGGCAGGAGG + Intronic
1152690401 17:81715398-81715420 GGATCCCTGGCTGGGCCGGGTGG + Intronic
1152851622 17:82639866-82639888 CGAGCTGTGTGTGGGTCGGGAGG + Intronic
1152851644 17:82639960-82639982 TGGGCTGTGTGTGGGTCGGGAGG + Intronic
1153914619 18:9734480-9734502 TGAGCTAAGGGTGAGCCGAGAGG + Intronic
1155054128 18:22170281-22170303 TGACCGCGGGGTGGGCCGGGTGG + Intronic
1155092683 18:22526839-22526861 TGAGCACTGGGGATGCCGGGAGG + Intergenic
1155470402 18:26185952-26185974 GGAGCTCTGGATGGGCATGGTGG + Intronic
1157619679 18:49009035-49009057 TGAGCACTGGGCGGGTGGGGTGG + Intergenic
1158358133 18:56642649-56642671 TATGCTCTGGGTGGGAAGGGTGG - Intronic
1158538684 18:58332358-58332380 TGAGCTTTGGCTGGGCACGGTGG + Intronic
1160055318 18:75473149-75473171 TGACCTCTGAGTGGACCTGGAGG - Intergenic
1160576419 18:79856839-79856861 TGAGCCCTGGGGAGGCCGGCAGG + Intergenic
1161167708 19:2797146-2797168 TGGGCTCAGGGTTGGCCGGCTGG + Intronic
1161349248 19:3783292-3783314 TGGCCTCTGGGTGGGGTGGGTGG + Intronic
1161513307 19:4683381-4683403 TGGGCTCCGGGTGGCGCGGGCGG + Intronic
1161708178 19:5832018-5832040 TGAGCGGTGGGTGGGCAGGCTGG + Exonic
1161710389 19:5844287-5844309 TGAGCGGTGGGTGGGCAGGCTGG + Exonic
1161714392 19:5867134-5867156 TGAGCGGTGGGTGGGCAGGCTGG + Exonic
1162818623 19:13210067-13210089 GGAGCTCTGGGTGGGGGTGGGGG + Intronic
1163156492 19:15442634-15442656 TGACCTCAGGGAGGGCAGGGGGG - Intronic
1163557868 19:18002509-18002531 TGAGGTCTGGCTTGGCCCGGAGG - Intronic
1164608590 19:29617417-29617439 TGACCCCTGGGTGGGCCATGAGG - Intergenic
1165109259 19:33492215-33492237 TGGGCTCTGGGTACGCCGGCAGG - Intronic
1165143855 19:33719238-33719260 TCAGCCGGGGGTGGGCCGGGTGG + Intronic
1166293095 19:41875911-41875933 TGAGGTCTGAGTGGGGAGGGCGG - Intergenic
1166345031 19:42160194-42160216 TAACCTCTGGGTGGGCAGAGTGG + Intronic
1166518480 19:43464102-43464124 TGAGAACTGGGTGGGGCGGACGG - Intronic
1166732478 19:45067018-45067040 TGAGCTCTGGGAGGGATGGCTGG - Intronic
1166740693 19:45113148-45113170 TGAGCTCCCAGAGGGCCGGGTGG - Intronic
1166782899 19:45351616-45351638 GCAGCTCTGAGTGGGGCGGGTGG - Exonic
1166826927 19:45615723-45615745 TGAGTTCTGGGAGGGGAGGGAGG - Intronic
1167116967 19:47493982-47494004 GGAGCTCTGGGTGTGCCTGGGGG - Intronic
1167127591 19:47561184-47561206 TGAGCTCTGGCTGGGTGTGGTGG + Intergenic
1167849212 19:52189358-52189380 TGAGCTCGGGGAGGTCCAGGCGG + Intergenic
1168199426 19:54804209-54804231 TGAGCTCTGTGTGGCCCAGGCGG + Intronic
1168206464 19:54853766-54853788 GGGGCCCTGGGTGGGCCAGGAGG - Exonic
1168412235 19:56147199-56147221 GGAGCTCTGGGTGAGCCTGGCGG + Exonic
925367553 2:3321111-3321133 AGAGCTCTCCCTGGGCCGGGAGG - Intronic
925918936 2:8626119-8626141 GGAGCGCTGGGTGGGACCGGAGG + Intergenic
925923893 2:8657243-8657265 TGAGCTCAGGGTGGGGGCGGGGG - Intergenic
926151311 2:10427090-10427112 TGAGCTCCCCGTGAGCCGGGAGG - Exonic
926223076 2:10948913-10948935 TGTGCTCTGAGTGTGCCGGATGG - Intergenic
926767002 2:16330595-16330617 TGGGCTCAGGGTGGGCGGGTGGG - Intergenic
927055672 2:19363579-19363601 TCACCTCCGGGTGTGCCGGGAGG - Intergenic
927690839 2:25207122-25207144 TGTGCTCAGGGAGGGCCTGGAGG - Intergenic
928472739 2:31590151-31590173 TGAGCGCAGGGTGGGTGGGGTGG - Intergenic
928997454 2:37308532-37308554 TGAACTCTGGGTGGGGAGGGAGG - Intronic
929362197 2:41105563-41105585 TGAGGTCTGGGAGGGCCATGGGG - Intergenic
932259983 2:70318830-70318852 TGAGCTGTGGGTGGGAGGTGTGG + Intergenic
932285563 2:70528949-70528971 AGAGCACTGGGTGGGACGAGGGG + Intronic
933548739 2:83746947-83746969 TGAGTTCTGGCCGGGCCCGGTGG - Intergenic
933679844 2:85089906-85089928 TCAGCTGCGGGTGGGCTGGGGGG + Intergenic
933728140 2:85437879-85437901 CGGGCTCTGGCAGGGCCGGGAGG + Intergenic
934978732 2:98823249-98823271 CGAGCTCCGGGGTGGCCGGGCGG + Exonic
934993390 2:98936516-98936538 GGGGCTCCGGGAGGGCCGGGGGG + Intergenic
935011534 2:99141116-99141138 TGAGCTCTGGGCAGGACGGCGGG - Intronic
935583794 2:104783011-104783033 TGAGCTCTGTGAGGGGCTGGGGG + Intergenic
937279186 2:120705719-120705741 TGGGCTTTGGGTGGGCAGAGTGG + Intergenic
941977852 2:171424845-171424867 TGAGCTCTGGGAGGGGCCAGGGG + Intronic
943615190 2:190084378-190084400 TGAGCTCTAGCTGGGCAAGGTGG - Intronic
944501089 2:200360895-200360917 TGAACTCTGGTGGGGGCGGGGGG - Intronic
945997123 2:216447176-216447198 TGAGAAATGGGTGGGCTGGGAGG - Intronic
946327251 2:218991111-218991133 TGAGCTCTGGGAGTGCCTGTGGG - Intronic
947518736 2:230828480-230828502 TGAGCCCTGGGTGGGGCCAGGGG - Intergenic
948130811 2:235599404-235599426 TGAGCTCTGGGCGACCCAGGAGG + Intronic
948570384 2:238913830-238913852 TGAGGCCTGGGTGGGCAGGGTGG + Intergenic
948794227 2:240393946-240393968 TGAGCCCTGTGGGTGCCGGGGGG - Intergenic
948886764 2:240888684-240888706 GGAGCACAGGGTGGGCCGGGTGG - Intronic
948928634 2:241116160-241116182 TGAGGACTGGGTGGCCCTGGTGG - Intronic
949059645 2:241949479-241949501 TGAGCCCTCCCTGGGCCGGGTGG + Intergenic
1168854592 20:999749-999771 TGAGCTGTAGATGGGGCGGGGGG + Intronic
1169129682 20:3159659-3159681 CCAGCTCTGGGCCGGCCGGGAGG + Intronic
1169226488 20:3860162-3860184 GGACCTATGGGTGGGGCGGGGGG + Intronic
1169851965 20:10061900-10061922 TGAGCACTGGGTGGGCCAGCTGG + Intergenic
1169971262 20:11271548-11271570 TGGCCTCTGGGGGCGCCGGGGGG - Intergenic
1170072487 20:12383483-12383505 TGACCACTGGTTGGGCCCGGCGG + Intergenic
1170209643 20:13835761-13835783 TGAGTTCTGGAAGGGCCTGGAGG - Intergenic
1170760532 20:19245121-19245143 TGGGCTCTAGGTGGGGCTGGGGG + Intronic
1172065910 20:32220415-32220437 TGAGCCCTGGATGGGCATGGTGG - Intronic
1172222662 20:33284482-33284504 TGAGCTCTGGGAGGGAGGGCTGG - Intronic
1173627515 20:44484080-44484102 TGAGCTCTGGCTGGGCACAGTGG - Intronic
1173699635 20:45057038-45057060 TGGGCCCTGGCTGGGCCAGGAGG + Intronic
1175272843 20:57746961-57746983 TGGGCTCTGGGTGGACCAGAAGG + Intergenic
1175890000 20:62311819-62311841 TGAGGTGGGGGTGGGCAGGGTGG - Intronic
1176114997 20:63428335-63428357 GGAGCTCCAGGTGGGGCGGGTGG - Intronic
1176117831 20:63440707-63440729 TGAGGACAGGGTGGGCCGGCTGG + Intronic
1176182554 20:63757824-63757846 TGAGCCCTGGACGGGGCGGGTGG - Intronic
1176182580 20:63757915-63757937 TGAGCTCTGGACGGGGCGGGTGG - Intronic
1176182589 20:63757946-63757968 TGAGCTCTGGACGGGGCGGGTGG - Intronic
1176182640 20:63758127-63758149 TGAGCTCTGGATGGGGCGGGTGG - Intronic
1176182649 20:63758158-63758180 TGAGCTCTGGACGGGGCGGGTGG - Intronic
1176182660 20:63758189-63758211 TGAGCTCTGGACGGGGCGGGTGG - Intronic
1176195059 20:63832898-63832920 TGGGCTCTGGGTGGGCAGGTGGG - Intergenic
1176388906 21:6153657-6153679 TGAGCTCAGGTGAGGCCGGGGGG + Intergenic
1179734566 21:43384591-43384613 TGAGCTCAGGTGAGGCCGGGGGG - Intergenic
1180099441 21:45577745-45577767 TGGGCTCTGAGTTGGCCTGGGGG + Intergenic
1180180375 21:46116213-46116235 TGAGCCCTGGGTCGGGCTGGAGG - Intronic
1180748783 22:18110660-18110682 TGAGCCGCGGGTGGGCGGGGAGG + Intronic
1181305799 22:21916592-21916614 GGACCTCTGGGTGGGGGGGGGGG - Intergenic
1181440058 22:22931147-22931169 TGGGAACTGGGTGGGCAGGGAGG - Intergenic
1181917300 22:26291635-26291657 TGTGCTCTGGCTGGGCTTGGGGG - Intronic
1183153904 22:36059169-36059191 TGAGTTTTGGGTGGGCTCGGTGG + Intergenic
1183723053 22:39573406-39573428 TGGGCTCTGGCTGGGCTGGCTGG + Intronic
1184042458 22:41952202-41952224 GGGGCTCTGAGTGGGCCAGGAGG - Intergenic
1184649211 22:45912029-45912051 ACAACTCTGGGTGGGGCGGGAGG - Intergenic
1184731485 22:46373405-46373427 AGTGCTCTGGGCGGGGCGGGGGG + Intronic
1185272837 22:49936563-49936585 TGTGACCTGGGTGGGGCGGGGGG - Intergenic
1185296423 22:50057394-50057416 TCAGGTCTGGGTTGGGCGGGAGG + Intergenic
1185420381 22:50731491-50731513 TGTGCGCTGGGTGGGCTGGGCGG - Intergenic
950304582 3:11908140-11908162 GGTGCTCTGGGTGGAGCGGGAGG - Intergenic
950455677 3:13091529-13091551 TGTGCTCAGGGAGGGCAGGGAGG - Intergenic
950520119 3:13493164-13493186 GGAGCTGTGGGTGGGGCAGGTGG - Intronic
951551383 3:23878511-23878533 TGAGCAGTGGGTGGGCAGGCCGG + Intronic
952542825 3:34385924-34385946 TGAGCTCTTGCTGAGCCGTGGGG + Intergenic
953770403 3:45775271-45775293 TGAGCACTGGGTGGGGAGGCAGG - Intronic
954214330 3:49116062-49116084 TCAGCGCTGGGGGGGCCTGGAGG - Exonic
954420088 3:50414212-50414234 TGGGCTCTGTGTGGGCCTGTGGG - Intronic
956670555 3:71685648-71685670 TGAGTTCCGGCTGGGCCTGGTGG - Intronic
958505188 3:94967722-94967744 TGAGCAATGGGTGGGTGGGGAGG - Intergenic
959574021 3:107914747-107914769 TGTGCTCTGGGAGGACGGGGTGG + Intergenic
961058685 3:123810380-123810402 TGAGCCATGGGTGAGCAGGGTGG + Intronic
961212887 3:125139600-125139622 TGAGGTCTGGGTGGGCCACCAGG - Intronic
961354460 3:126327257-126327279 TGAGGTCTGGGTGGGAAGCGTGG + Intergenic
962798571 3:138869977-138869999 TAGGCTCGGTGTGGGCCGGGCGG - Intergenic
963006234 3:140728480-140728502 TGGGCTCTGGGTGGGCCGAATGG - Intergenic
964975611 3:162615465-162615487 TGAGATTTGGGCGGGCCCGGGGG + Intergenic
965710112 3:171548556-171548578 AGAACTCTGGGTGGGCGTGGTGG - Intergenic
968432583 4:567470-567492 GGAGTTCTTGGTGGGCCTGGAGG + Intergenic
968490210 4:886072-886094 TGAGTTCTGGTTGGGCCTGGAGG - Intronic
968759794 4:2436829-2436851 GGGGCCCTGGCTGGGCCGGGAGG - Intronic
968871705 4:3245868-3245890 TGGGCCCTGGGTGGGCCCTGTGG + Intronic
969051103 4:4373608-4373630 TGAGCCCTGGGAGGGCAGAGAGG - Intronic
969277903 4:6149377-6149399 TCAGCTGTGGGTGGCCTGGGTGG - Intronic
973182970 4:47291430-47291452 TGGACTCTGTGTGGGTCGGGGGG - Intronic
973767980 4:54181050-54181072 TGACTTCTGGCTGGGCCTGGTGG - Intronic
976015118 4:80542996-80543018 TGAGCCCTGGCTGGGCTGGAGGG - Intronic
976218280 4:82735054-82735076 TGAGCTCAGGCTGGGCGTGGTGG - Intronic
980970192 4:139560208-139560230 TCAGTTCTGCGGGGGCCGGGGGG + Intronic
981154068 4:141413370-141413392 TGAGCTCTAGGTAGGCAGGCTGG + Intergenic
985774249 5:1832537-1832559 TGAGCCCTGGGCGTGCCCGGGGG - Intergenic
985788836 5:1914637-1914659 TGATCGCTGGTTGGGCCAGGAGG + Intergenic
988274243 5:29059803-29059825 TGAACTCTGGGTGGCCGAGGTGG - Intergenic
988458865 5:31414063-31414085 TGACCACTGGGTGGACCTGGAGG + Intronic
991206991 5:64060574-64060596 TGAGATCTGGGAGGGGCCGGGGG + Intergenic
992130020 5:73682753-73682775 AGAGCTCTGGCTGGGCATGGTGG + Intronic
992259640 5:74956902-74956924 AGAGCTCTGGCTGGGCCCGGTGG + Intergenic
993904147 5:93604453-93604475 TGTGCGCTGGGAGGGCCGCGGGG + Intergenic
995393051 5:111660476-111660498 TGAGATCTGCGAGGGGCGGGGGG - Intergenic
997360729 5:133293120-133293142 TTAGCTCTGGGGGTGCCGGAAGG - Intronic
997377750 5:133409476-133409498 GGAGATCTGGGAGGGCTGGGGGG - Intronic
997468549 5:134104027-134104049 AGGGCTCAGGGTGGGCCGGGTGG - Intergenic
997823324 5:137085202-137085224 TGAGCGTAGGGTGGGCCAGGTGG - Intronic
997998289 5:138603995-138604017 TGAGTCCTGGGTTGGCAGGGAGG + Intergenic
998482725 5:142476231-142476253 TGAGCTCCATGAGGGCCGGGAGG - Intergenic
999208998 5:149871418-149871440 TGAGGTCTGGGAGGTCAGGGAGG + Intronic
1000672241 5:164077170-164077192 TGATCTCTGGGTGGGGGGAGGGG + Intergenic
1001538260 5:172515240-172515262 TGTGTTCTGGGTGGGTGGGGGGG - Intergenic
1001867250 5:175116404-175116426 TGGGCACTGGGTGTGCTGGGGGG + Intergenic
1002140998 5:177138960-177138982 TGAGGTCAGGGTGGGCATGGTGG + Intronic
1002256005 5:177958969-177958991 TGAGCTGTGGGAGGACTGGGCGG - Intergenic
1002619058 5:180474029-180474051 AGAGCTCTGGCTGGGCACGGTGG + Intergenic
1002638500 5:180619596-180619618 GCAGCTCGGGGTGGGCCGGTGGG - Intronic
1002639059 5:180622034-180622056 TGGGCTTTTGGTGGGGCGGGGGG - Intronic
1002805218 6:567210-567232 TGAGCAGTGGGAGGGCTGGGAGG - Intronic
1003227360 6:4218434-4218456 TGAGATCTGGGAGGGGCTGGGGG - Intergenic
1004297865 6:14430609-14430631 TGAGCTCAGGCTGGGCAAGGTGG + Intergenic
1004424515 6:15498277-15498299 TGAGCTCTGGCTGGGGCTGTTGG + Intronic
1005460092 6:26060324-26060346 TGACCTCTGGCCGGGCGGGGTGG + Intergenic
1005736461 6:28752393-28752415 TGAGCACTGGCCGGGCCTGGTGG + Intergenic
1007833097 6:44653837-44653859 TGAGCTGGGGGTGGGGCTGGGGG - Intergenic
1008069209 6:47082654-47082676 TGAGCTCTGGCTGGGCGCTGTGG + Intergenic
1009289388 6:61865620-61865642 TGAGATTTGGGTGGGACGAGGGG - Intronic
1011057621 6:83222904-83222926 TGAGCTCTGTCTGGGCCTTGAGG - Intronic
1012185897 6:96216654-96216676 TGAGCTCTGGGTGGTATGAGAGG - Intergenic
1012465772 6:99515234-99515256 TGATCCCTGGGGGCGCCGGGCGG - Exonic
1015120472 6:129695865-129695887 TGAGCTGTAGGTGGGTGGGGCGG - Intronic
1015290507 6:131533065-131533087 TGGGCAGTGGGTGGGCCTGGGGG + Intergenic
1017406780 6:154127876-154127898 AGAGCACTGGGTGAGCCTGGGGG - Intronic
1018826997 6:167415802-167415824 TCTGCTCTGGGTGGGCAGCGGGG + Intergenic
1019104713 6:169658972-169658994 TGAGCTCTGGCCGGGCGCGGTGG - Intronic
1019437490 7:1029595-1029617 TGTGCTCTGGGTGGCCAGTGCGG - Intronic
1019513270 7:1429026-1429048 TGAGCTCTGGGTGGCCCCCTCGG - Intronic
1019515389 7:1437738-1437760 TGCGGTCTGGGTGGGCCAGGCGG - Intronic
1019554869 7:1624177-1624199 AGGGGCCTGGGTGGGCCGGGAGG + Intergenic
1019605195 7:1906646-1906668 TGAGCTCAGGGTGCGCCGCAGGG - Intronic
1020101991 7:5399112-5399134 TGAGCAGTGGGTGGGGCAGGGGG - Intronic
1020187585 7:5970718-5970740 AGAGCACAGGGTGGGCCTGGCGG - Intergenic
1020242082 7:6403113-6403135 TTAGCTGTGGGTGTGCCGGGTGG + Intronic
1020257536 7:6510461-6510483 CCAGGCCTGGGTGGGCCGGGAGG + Intronic
1020271672 7:6600283-6600305 TGAGCTCTCGCTGGACCGGCTGG + Exonic
1020295332 7:6754052-6754074 AGAGCACAGGGTGGGCCTGGCGG + Intergenic
1029139792 7:98401334-98401356 GGAGCTCTGGGAGAGCCGCGAGG - Intergenic
1029156365 7:98520673-98520695 GGAGCTCTGGGTGGGGTGAGCGG + Intergenic
1029205704 7:98868324-98868346 TGAGCTCTGGGTGACTTGGGGGG - Intronic
1030813562 7:114006150-114006172 TGAGCTTTGTGGGGGTCGGGGGG + Intronic
1032354638 7:131199063-131199085 TGAGTTCAGGCTGGGCAGGGAGG + Intronic
1034218077 7:149422942-149422964 TGAGCTCTGGGTGAGCTGGGGGG + Intergenic
1034759986 7:153662691-153662713 TGAGCTCTGGGCAGGGAGGGAGG + Intergenic
1035754500 8:2021697-2021719 TGAGCTCTGGGTGTACAGCGGGG + Intergenic
1036286486 8:7447947-7447969 TGACCTCAGGGTGGCCCAGGTGG - Intronic
1038492352 8:27980355-27980377 AGAGCCCTGGGTGGGCAGGTGGG - Intronic
1039802418 8:40970841-40970863 TGAGCACTGGGAGGACGGGGTGG - Intergenic
1039955262 8:42202500-42202522 TGAGGGCTGGGGGGGCAGGGTGG - Intronic
1042316578 8:67432343-67432365 TGAGCACTGGATGTGCTGGGAGG + Intronic
1042874714 8:73430403-73430425 TGAGCTCATGGTGAGCAGGGAGG - Intronic
1043982614 8:86658876-86658898 TGAGCTCTGGGAGGAGCAGGTGG - Intronic
1045063031 8:98424881-98424903 TGAGCTCTGGAGGGGCCGGAAGG + Intronic
1045269401 8:100649413-100649435 TGGGGTCAGGGTGGGCAGGGAGG - Intronic
1045879483 8:107020959-107020981 TGAGCCCTGGCTGGGCTGGAGGG - Intergenic
1047066195 8:121286354-121286376 TGAGCCCTGTGTGGGCAGGGAGG - Intergenic
1047246344 8:123148452-123148474 TCAGCTCTGGCTGGGCACGGTGG + Intronic
1047613996 8:126547894-126547916 TGGGCTCTGGGTAGTCAGGGAGG - Intergenic
1048964384 8:139604757-139604779 TGAGCCCTGGGTAGGCCCTGGGG + Intronic
1049032482 8:140047958-140047980 TGAGCTCTGGCTGGGGCCTGTGG - Intronic
1049381582 8:142319072-142319094 TAAGCTCTGGCTGGGGTGGGTGG + Intronic
1049521607 8:143094313-143094335 TGAGCCCTGGGCAGGTCGGGAGG + Intergenic
1051818444 9:21136182-21136204 TGAGCTCTGGGTGTGCCCAAAGG - Intergenic
1057443054 9:95095839-95095861 AGGGGTGTGGGTGGGCCGGGAGG + Intergenic
1057806168 9:98221255-98221277 TGAGCTCAGGGAGGGCCTGCTGG + Intronic
1058486654 9:105448311-105448333 TGGGCTGTGGGTGCGCGGGGTGG + Intronic
1058835341 9:108854976-108854998 TGAGCTCCGGGAGGCCCGGCTGG + Exonic
1059170535 9:112120454-112120476 TGATCTCTGGGTGGGTAGGTAGG - Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060935183 9:127510379-127510401 TGGGCTCTGGGATGGCTGGGAGG - Intronic
1061253616 9:129440840-129440862 TGAGACCTGGGTGGCCTGGGGGG + Intergenic
1061579091 9:131525881-131525903 CAAGCTCTGGGAGGGGCGGGGGG + Intronic
1061894180 9:133638531-133638553 TGGGCTCTGGGTGGCTGGGGTGG + Intronic
1061894656 9:133640929-133640951 TGGGCTCTGGGTGGCCGGGGTGG + Intronic
1061932804 9:133841978-133842000 TGAGCCATGGCAGGGCCGGGTGG - Intronic
1062326050 9:136013115-136013137 GGAGGACTGGGTGGGCCGCGGGG - Intronic
1062394531 9:136347433-136347455 GGAGCTGTGGGTGAGCAGGGAGG + Intronic
1062472573 9:136712844-136712866 TGAGCCCGGGGTGGGCAGCGGGG + Intronic
1062499770 9:136847409-136847431 GCGGCCCTGGGTGGGCCGGGCGG - Exonic
1062540519 9:137039886-137039908 TGGGCAGTGGGTGGGCTGGGGGG + Intronic
1203788381 EBV:140770-140792 GGAGCTCGGGGGCGGCCGGGTGG + Intergenic
1185763678 X:2707641-2707663 GGAGCTTTGAGAGGGCCGGGTGG + Intronic
1187237927 X:17485627-17485649 TCAGCTCTGGGTGGTGGGGGTGG + Intronic
1187425892 X:19176849-19176871 TGTGCTGGGGGTGGGGCGGGGGG - Intergenic
1188244368 X:27822398-27822420 TGAGCTGTGGGAGGTCAGGGTGG + Exonic
1188451174 X:30309207-30309229 TGAGCCCGGGGTGGGCAGAGAGG - Exonic
1189682949 X:43535690-43535712 TGAGCTTAGGGTGGGGGGGGTGG + Intergenic
1190232152 X:48590499-48590521 TGAGGTCAGGGAGGGCCCGGAGG + Intronic
1192165532 X:68825367-68825389 TTAGCTCTGGCTGGGCCTGCTGG + Intergenic
1194930383 X:99880754-99880776 TGAGCTCCTGGTGGGAGGGGTGG + Intergenic
1195708630 X:107756880-107756902 TGAGCTCTGCGTGGACAGGCAGG - Intronic
1197702905 X:129612954-129612976 TGAGTTCTGGCTGGGCATGGTGG + Intergenic
1199143124 X:144334782-144334804 AGAGCTGGGGGTGGGGCGGGGGG + Intergenic
1200206176 X:154317888-154317910 GGAGCTCTGTGTGGGCCTGGGGG + Intronic
1200310200 X:155070795-155070817 TGAGCCCGGGGTGAGCCGAGGGG + Exonic