ID: 1142201984

View in Genome Browser
Species Human (GRCh38)
Location 16:88765452-88765474
Sequence CTCAAGGCACAGAGAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142201984_1142201990 -4 Left 1142201984 16:88765452-88765474 CCCTCCCCTCTCTGTGCCTTGAG No data
Right 1142201990 16:88765471-88765493 TGAGTTCCCAGTAAGTGAAATGG 0: 1
1: 0
2: 2
3: 21
4: 204
1142201984_1142201991 -3 Left 1142201984 16:88765452-88765474 CCCTCCCCTCTCTGTGCCTTGAG No data
Right 1142201991 16:88765472-88765494 GAGTTCCCAGTAAGTGAAATGGG 0: 1
1: 0
2: 0
3: 18
4: 169
1142201984_1142201992 -2 Left 1142201984 16:88765452-88765474 CCCTCCCCTCTCTGTGCCTTGAG No data
Right 1142201992 16:88765473-88765495 AGTTCCCAGTAAGTGAAATGGGG 0: 1
1: 0
2: 1
3: 13
4: 247
1142201984_1142201995 8 Left 1142201984 16:88765452-88765474 CCCTCCCCTCTCTGTGCCTTGAG No data
Right 1142201995 16:88765483-88765505 AAGTGAAATGGGGACAGAATTGG 0: 1
1: 0
2: 2
3: 21
4: 399
1142201984_1142201996 9 Left 1142201984 16:88765452-88765474 CCCTCCCCTCTCTGTGCCTTGAG No data
Right 1142201996 16:88765484-88765506 AGTGAAATGGGGACAGAATTGGG 0: 1
1: 0
2: 3
3: 30
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142201984 Original CRISPR CTCAAGGCACAGAGAGGGGA GGG (reversed) Intronic
No off target data available for this crispr