ID: 1142204499

View in Genome Browser
Species Human (GRCh38)
Location 16:88776492-88776514
Sequence CTCCAAGGGAAGCTGGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 2, 2: 2, 3: 22, 4: 395}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142204499_1142204517 29 Left 1142204499 16:88776492-88776514 CCGGGGCCCAGCTTCCCTTGGAG 0: 1
1: 2
2: 2
3: 22
4: 395
Right 1142204517 16:88776544-88776566 CGGCTCCTATGTGCACATCTAGG 0: 1
1: 0
2: 1
3: 3
4: 114
1142204499_1142204511 6 Left 1142204499 16:88776492-88776514 CCGGGGCCCAGCTTCCCTTGGAG 0: 1
1: 2
2: 2
3: 22
4: 395
Right 1142204511 16:88776521-88776543 CACTAGCTGCCCCAGCCTTTGGG 0: 1
1: 0
2: 1
3: 19
4: 127
1142204499_1142204512 9 Left 1142204499 16:88776492-88776514 CCGGGGCCCAGCTTCCCTTGGAG 0: 1
1: 2
2: 2
3: 22
4: 395
Right 1142204512 16:88776524-88776546 TAGCTGCCCCAGCCTTTGGGCGG 0: 1
1: 0
2: 0
3: 16
4: 181
1142204499_1142204510 5 Left 1142204499 16:88776492-88776514 CCGGGGCCCAGCTTCCCTTGGAG 0: 1
1: 2
2: 2
3: 22
4: 395
Right 1142204510 16:88776520-88776542 CCACTAGCTGCCCCAGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142204499 Original CRISPR CTCCAAGGGAAGCTGGGCCC CGG (reversed) Intronic
900171658 1:1272353-1272375 CACCGAGGGCAGCTGTGCCCAGG + Intronic
900413678 1:2525471-2525493 CTCCAGGTGAAGCTGCCCCCAGG + Intronic
900574912 1:3378344-3378366 TGCCAAGGGAAGCAGGGACCGGG + Intronic
900950564 1:5856126-5856148 CTCCAAGGCATGTGGGGCCCTGG - Intergenic
900953962 1:5875499-5875521 CTCCTGTGGACGCTGGGCCCAGG - Intronic
901003039 1:6158252-6158274 TTCCTGGGGACGCTGGGCCCAGG + Intronic
901207010 1:7503207-7503229 CTCCAAGGGCAGCAGAGCCCGGG - Intronic
902628084 1:17688489-17688511 CTCTGGGGGAAGCTGGGCCAAGG - Intronic
903130977 1:21279373-21279395 CTCCAAGGGAAGCGGGGCCCGGG - Intronic
903142082 1:21345029-21345051 CTCCAAGCCAAGCTGAGTCCAGG + Intronic
903269365 1:22178037-22178059 CCCCAAGGAAAGCAGGGTCCTGG - Intergenic
903668942 1:25024308-25024330 CTCCCAGGGCAGCTGTGCCACGG + Intergenic
904345115 1:29862855-29862877 AACCAATGGGAGCTGGGCCCAGG - Intergenic
904707288 1:32401029-32401051 CTTCACGGGAAGCTGGCTCCCGG + Intergenic
904772299 1:32886938-32886960 CTCCGAGGGTGGCAGGGCCCAGG + Intronic
906934093 1:50196523-50196545 ATCAAAGGGAAGCTGGGCTGTGG - Intronic
907091625 1:51730146-51730168 CTCCCAAGGAAGAGGGGCCCGGG - Intronic
907877650 1:58508817-58508839 CCCCAGGAGAAGCTGGGCTCTGG - Intronic
907980978 1:59480524-59480546 CTGCAAGGGAAGCTGGGGAAAGG + Intronic
915875994 1:159612677-159612699 CTGCAAAGGCAACTGGGCCCGGG - Intergenic
916388184 1:164300740-164300762 GGCCAAGGGAAGCTGAGACCTGG - Intergenic
916741639 1:167651497-167651519 ACATAAGGGAAGCTGGGCCCAGG - Intronic
918150924 1:181797714-181797736 TCCCAAGGGAAACTGAGCCCAGG - Intronic
919877835 1:201883488-201883510 TCCCCAGGGATGCTGGGCCCTGG + Exonic
920230297 1:204465748-204465770 TGCCCAGGGAAGCTTGGCCCTGG + Intronic
920366252 1:205449820-205449842 TCCCAAGGGATGCTGGGCCAGGG + Intronic
920446238 1:206020855-206020877 CTCCACAGCACGCTGGGCCCTGG - Intronic
922222940 1:223622224-223622246 GTCCCAGGACAGCTGGGCCCTGG - Intronic
1063367680 10:5500943-5500965 CTCCAAGGGAAGCCGGAGGCTGG + Intergenic
1065122913 10:22545450-22545472 TGCCAGGGGAGGCTGGGCCCTGG - Intronic
1066417579 10:35235591-35235613 GGCCCAGGGAAGATGGGCCCAGG + Intergenic
1069578965 10:69552194-69552216 TTCTAAGGGAAGCTGGACCTAGG + Intergenic
1069616625 10:69810705-69810727 CTCCAAGGGAAACTGAGGCCTGG + Intronic
1070288524 10:75100245-75100267 CTCCGAGGGGACCTAGGCCCAGG + Intronic
1070587872 10:77780113-77780135 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1070794955 10:79211052-79211074 CTCTAAGGGAAGCTAGACTCAGG - Intronic
1070819463 10:79346571-79346593 CCCCAGGGGAAGCTGAGGCCTGG - Intergenic
1071554420 10:86591560-86591582 CTCCATGGGAAGCTGTGGGCTGG + Intergenic
1071568447 10:86683621-86683643 CTCCAAGGGATGGTGGGCTAGGG + Intronic
1074366580 10:112862355-112862377 CTGTCAGGTAAGCTGGGCCCAGG - Intergenic
1074372136 10:112908685-112908707 GTCTAGGGGAAGCGGGGCCCAGG + Intergenic
1075078583 10:119368082-119368104 CTCCAGGGGAAGCCAGACCCCGG + Intronic
1075399469 10:122150623-122150645 AACCAAGGGAGGCAGGGCCCAGG + Intronic
1076418374 10:130309037-130309059 CTCCAAGGGTAGCTGAGACCTGG + Intergenic
1077158251 11:1101087-1101109 ACCCAAGGGAAGCCGTGCCCTGG - Intergenic
1077183843 11:1227828-1227850 GTCCAGGGGGAGCTGGGCCGAGG + Intronic
1077341904 11:2029989-2030011 CTCCTTGGGGAGCGGGGCCCAGG + Intergenic
1077371816 11:2185905-2185927 CTCCCAAGGAAGCTGGGCGAGGG + Intergenic
1077634488 11:3832937-3832959 CTACTAGGGAGGCTGGGCCCAGG + Intronic
1077807625 11:5605222-5605244 CTCCCTGGGAGGCTTGGCCCAGG + Intronic
1077909193 11:6559177-6559199 CTCCAAGGCATTCTGGACCCTGG - Exonic
1079231116 11:18649566-18649588 GTGAAAGGGAAGCTGGGTCCAGG + Intergenic
1081600302 11:44488205-44488227 CTCCAGTGGAGGCCGGGCCCTGG - Intergenic
1083315761 11:61814233-61814255 CTCAAAAGGCAGCTGGGCCTAGG - Intronic
1083912671 11:65719370-65719392 CTCCAAGGTCAGCTGGCCACAGG + Exonic
1084044957 11:66563112-66563134 CTACAAGGGATCCGGGGCCCCGG + Exonic
1084459265 11:69287077-69287099 CTCTGTGGGAACCTGGGCCCGGG - Intergenic
1084936569 11:72590123-72590145 CTCAAGGGGAAGTTGGTCCCCGG + Intronic
1085127449 11:74011317-74011339 CCCCAAGGGAAGTGGGGCCCTGG + Intergenic
1085530453 11:77189389-77189411 CTCCAAGAGCAGCTATGCCCGGG + Exonic
1087107325 11:94423542-94423564 CCCACAGGGAAGCTGGCCCCAGG - Intronic
1089493052 11:118895536-118895558 CTCCTAGGGTGGCTGGGTCCAGG + Exonic
1089543907 11:119207108-119207130 CTCTCAGGGAAGCTGTGCTCTGG + Intronic
1089582394 11:119489534-119489556 CTGCAGGAGAAGCAGGGCCCTGG + Intergenic
1089750323 11:120647150-120647172 CTCCAAGGGAAGCAGAGCCCTGG - Intronic
1089778576 11:120856926-120856948 GTCTAGGGGAAGCAGGGCCCCGG - Intronic
1090422882 11:126587895-126587917 CTCTAAGGAGAGCTGGGCCCTGG + Intronic
1090973291 11:131660742-131660764 CACGAAGGGAGACTGGGCCCTGG + Intronic
1202824890 11_KI270721v1_random:85178-85200 CTCCTTGGGGAGCGGGGCCCAGG + Intergenic
1091383572 12:78089-78111 CGCGAAGGGAAGCGCGGCCCGGG + Intronic
1091653158 12:2324536-2324558 CTCCTGGGGAGGCGGGGCCCGGG - Intronic
1091792841 12:3281395-3281417 CTATAGGGGAGGCTGGGCCCGGG + Intronic
1091921153 12:4305936-4305958 GTCCAAGAGCAGCTGGGCCTAGG - Intergenic
1092272096 12:7031361-7031383 CGCCAAGGGAAGCTCGGTACAGG - Intronic
1092559100 12:9590953-9590975 CTCCATGGGAATATGAGCCCAGG - Intergenic
1094842249 12:34347057-34347079 CTCCCGGAGAGGCTGGGCCCCGG - Intergenic
1095838858 12:46669850-46669872 CTGCAAGGGCAGCAGAGCCCTGG + Intergenic
1096638771 12:52977709-52977731 CTGCAAGGGAAGGTGGTCCAGGG - Intergenic
1098557945 12:71840011-71840033 CTCCAAGGCCAGCTAGGCCTCGG + Intronic
1099333105 12:81316904-81316926 TTCCAAGGAAAACTGGGCTCTGG + Intronic
1101093511 12:101312562-101312584 CTCCCAGAGTAGCTGGGCACAGG + Intronic
1101522385 12:105495961-105495983 CTTCAAGGCAAGCTGGGTCGTGG - Intergenic
1102872108 12:116421940-116421962 CTGCAAGGGAAGCTGGGGAAGGG + Intergenic
1103781135 12:123399420-123399442 CGCAGAGGGAAGCTGGGACCAGG - Intronic
1103904723 12:124321440-124321462 CTCCAGGGGAGGCAGGACCCTGG + Intergenic
1104280707 12:127374065-127374087 CTCCAAGGGAAACTGAGGCACGG - Intergenic
1104799539 12:131544291-131544313 CTCCAAGGAATGCTTGGACCAGG - Intergenic
1104802918 12:131566861-131566883 CTCCAGAGGGAGCTGGGCTCTGG + Intergenic
1105678860 13:22705334-22705356 CTCCATGAGGAGCTGGGCCGGGG + Intergenic
1105702778 13:22945558-22945580 CTCCTAGTGAAGCTGGAACCAGG - Intergenic
1106075762 13:26459559-26459581 CTCAAAGACAAGCTGGGCCAGGG + Intergenic
1106115563 13:26814887-26814909 CTCCCACGGGAGCAGGGCCCCGG - Intergenic
1107559248 13:41545506-41545528 CTCCAAAGGACACTGGGCCAAGG + Intergenic
1108727637 13:53200408-53200430 CTCCACCGGGATCTGGGCCCGGG - Intergenic
1109394506 13:61738615-61738637 TTCCAAGGAAAACTGAGCCCAGG - Intergenic
1113716411 13:112511536-112511558 ATCCAAGAGGAGCTGGGGCCAGG + Intronic
1118339051 14:64879697-64879719 CTCAAAGGAGCGCTGGGCCCAGG - Intronic
1119499063 14:75107444-75107466 CTCCATGGTCAGCTGGGCCATGG - Exonic
1120664279 14:87287462-87287484 CTCCCAGGGAAGGTGGGTCAGGG - Intergenic
1121635302 14:95449988-95450010 CTCCAAGAGCCGCTGGGCCAGGG + Exonic
1122235519 14:100328932-100328954 CTACAAGGGCAGCTCGGCCCTGG + Exonic
1122692135 14:103536464-103536486 TTAGAAGGGAAGCTGGGTCCTGG - Exonic
1122829562 14:104389170-104389192 CGGAAAGGGAGGCTGGGCCCCGG + Intergenic
1122844412 14:104483803-104483825 CTCCTAGTGAAGCTGGAACCAGG - Intronic
1123056386 14:105572556-105572578 CAGCGAGGGAGGCTGGGCCCCGG + Intergenic
1123057545 14:105579251-105579273 CAGCGAGGGAGGCTGGGCCCCGG - Intergenic
1123066099 14:105620215-105620237 CTCCAGGGAAAGCTGGGTCGAGG - Intergenic
1123070243 14:105639268-105639290 CTCCAGGGAAAGCTGGGTCGAGG - Intergenic
1123074833 14:105662927-105662949 CTCCAGGGAAAGCTGGGTCGAGG - Intergenic
1123080821 14:105692684-105692706 CAGCGAGGGAGGCTGGGCCCCGG + Intergenic
1123081822 14:105699184-105699206 CAGCGAGGGAGGCTGGGCCCCGG - Intergenic
1123089480 14:105736052-105736074 CTCCAGGGAAAGCTGGGTCGAGG - Intergenic
1123095268 14:105764212-105764234 CTCCAGGGAAAGCTGGGTCGAGG - Intergenic
1123128098 14:105964224-105964246 TCCAAAGAGAAGCTGGGCCCTGG - Intergenic
1124186563 15:27535129-27535151 CGCCAAGGGAAGGTGGCCCAAGG + Exonic
1125292401 15:38164507-38164529 CTCCAAAGGAAGCTGGCCAACGG + Intergenic
1126280654 15:46944468-46944490 CTCTAAAGAAAGCTTGGCCCTGG + Intergenic
1126705071 15:51398778-51398800 CTTCAAGGGAAGCTGAGCAAAGG - Intronic
1126880000 15:53084168-53084190 CTGCAAGGGAAGGTGGGCTTAGG + Intergenic
1129336955 15:74858106-74858128 CTTCAAGACAAGCTGAGCCCTGG + Intronic
1129356524 15:74995706-74995728 TTTGAAGGGAAGCTGGGCGCGGG + Intronic
1130123040 15:81068755-81068777 TTCCAAGGGAAACTGCGCCATGG + Intronic
1130649081 15:85751885-85751907 CTCAAAGGGAAGCAGTGACCAGG - Intergenic
1130916200 15:88307062-88307084 CCCCAGAGGAAGCTGGACCCTGG + Intergenic
1131146714 15:90018698-90018720 CACACAGGAAAGCTGGGCCCTGG + Intronic
1132179095 15:99738244-99738266 CTCCAAGGGAGGTCGGGCACAGG - Intergenic
1132550951 16:553643-553665 GCCCATGGGAAGCTGAGCCCTGG - Exonic
1132638156 16:963607-963629 CACCAATGAAGGCTGGGCCCTGG - Intronic
1132659485 16:1055036-1055058 GGCCCAGGGAAGCTGGACCCTGG - Intergenic
1132708042 16:1254906-1254928 GTCCATGGGGAGCTGGGGCCGGG + Intergenic
1132708138 16:1255169-1255191 CTCCATGGGGAGCTGGGGCTGGG + Intergenic
1132743370 16:1426923-1426945 CACCAAGGAGAGCAGGGCCCCGG - Intergenic
1132833670 16:1942107-1942129 CTCCAGGGGAGGCTGTCCCCAGG - Intronic
1132901408 16:2256771-2256793 AACCAAGGGAAGCTGGGTCTGGG + Intronic
1133118424 16:3591422-3591444 TTCAAAGGGAAGCAGGGCCTGGG - Intronic
1133270688 16:4609645-4609667 CTCCATGGCAGGGTGGGCCCTGG + Exonic
1133493644 16:6296034-6296056 CTGTAAAGGAAGCTGAGCCCAGG + Intronic
1133681604 16:8125204-8125226 CTGCAAGGGAAGTTAGACCCTGG - Intergenic
1133805702 16:9124644-9124666 CTACGAGGGAAGCTGGACCAAGG + Intergenic
1134232153 16:12437669-12437691 CTCCCAGGGACTCTGGGTCCTGG - Intronic
1134297968 16:12963326-12963348 CTCCAAGAAAAGCTGGGGGCTGG + Intronic
1136153053 16:28364802-28364824 CTCCCAGGGCCGCAGGGCCCGGG - Intergenic
1136210030 16:28750471-28750493 CTCCCAGGGCCGCAGGGCCCGGG + Intergenic
1136637940 16:31537596-31537618 CTCCACGGGAGGCCGGTCCCAGG - Intergenic
1136666787 16:31819557-31819579 CTCCACGGGCGGCTGGTCCCAGG + Intergenic
1137249783 16:46732973-46732995 GTGAAAGGGAAACTGGGCCCAGG - Intronic
1137754263 16:50888937-50888959 CTCTGGAGGAAGCTGGGCCCAGG + Intergenic
1138230284 16:55331399-55331421 CTCGCAGGGAAGCAGGGACCCGG + Intergenic
1140256953 16:73345863-73345885 GCCCTAGGGAAGCAGGGCCCTGG - Intergenic
1140389577 16:74573646-74573668 CTACTGGGGAAGCTGAGCCCAGG - Intronic
1140480183 16:75258140-75258162 GGCCAAGGGAAGGTGCGCCCTGG - Intronic
1140872700 16:79121667-79121689 CGCCAAGGGAAGCTGGGCTTTGG + Intronic
1140913824 16:79477273-79477295 CTTCAAGAGAAGCAGGACCCTGG + Intergenic
1141324061 16:83039103-83039125 CTCCGTGGGAACCTGGGCCATGG - Intronic
1141478754 16:84292304-84292326 CTCAAATGGAACCTGGGCCAAGG + Intergenic
1141684304 16:85561671-85561693 CTCCGGGGGCAGCTGGGGCCGGG - Intergenic
1141820330 16:86441409-86441431 CTGCCATGGAAGCTGAGCCCAGG - Intergenic
1141907800 16:87039102-87039124 CTCCAAGGGAAGCTGAGCCCAGG - Intergenic
1142204499 16:88776492-88776514 CTCCAAGGGAAGCTGGGCCCCGG - Intronic
1143582757 17:7836118-7836140 CACCAACAGCAGCTGGGCCCGGG - Intergenic
1143628786 17:8125474-8125496 CTCCTTGGGAACCTGGGCTCGGG + Intergenic
1143773860 17:9185296-9185318 CCCCCTGGGAAGCGGGGCCCGGG + Intronic
1145060345 17:19729319-19729341 ATCCAAGGGAAGCTGGGACTGGG - Intergenic
1145760876 17:27425079-27425101 TACCAAGGGAAGCTGGAGCCTGG - Intergenic
1146495337 17:33317204-33317226 CTGCAAGGGAAGCAGGCCTCAGG - Intronic
1147536374 17:41325303-41325325 CACCAAGGGCAGCTGGAGCCTGG - Intergenic
1148819922 17:50354401-50354423 CTCTCAGGGAAGATGAGCCCCGG + Exonic
1148984843 17:51612325-51612347 CTCCAGAGCAAGGTGGGCCCTGG + Intergenic
1149594424 17:57855821-57855843 CTCAAAGGAAAGCTGGGCCTGGG - Intergenic
1149610739 17:57956068-57956090 CTTCAAGGGCTGCTGAGCCCTGG + Intergenic
1149998414 17:61416924-61416946 CTCCCAGGGAAGCGCGGCCAGGG + Intergenic
1151363339 17:73601658-73601680 CTCCAAGGAGAGCTTGTCCCGGG - Intronic
1151454703 17:74218848-74218870 CTCAAAGGGTAGCTGGGGGCAGG + Intronic
1151475282 17:74341664-74341686 CTCCAGTGGGACCTGGGCCCTGG + Intronic
1151608123 17:75153461-75153483 CTGCAAGGGAACCAGGGCCAGGG + Intronic
1151670712 17:75570362-75570384 CTCCAAGGCCAGCTGGTCACTGG - Exonic
1152086745 17:78224518-78224540 CTCCAAAGAAAGCGGGGACCTGG - Exonic
1152112829 17:78366513-78366535 CTCCAAGGGCGCCTGGGCCCAGG - Intergenic
1152175288 17:78782734-78782756 CTCCCTGGCAAGCTGGGGCCGGG - Intergenic
1152378135 17:79929098-79929120 CTCCACTGGGAGCTGGGGCCAGG + Intergenic
1152407778 17:80107460-80107482 CTCCCAGGGCACCAGGGCCCGGG + Intergenic
1152494422 17:80660958-80660980 CCCCAAGGGCAGCTGGGCTGGGG - Intronic
1155660060 18:28238753-28238775 GTCAAAGGGAAAGTGGGCCCTGG + Intergenic
1156345181 18:36250522-36250544 CTCCAAGGCATCCTGGGACCAGG - Intronic
1157094624 18:44676706-44676728 CTTCAAGGGCTCCTGGGCCCTGG + Intergenic
1157530179 18:48413762-48413784 TTCTAGGGGAAGCTGGCCCCTGG - Intergenic
1157612816 18:48968988-48969010 CTCCAAGGGGGGCCGGGCCGGGG - Intergenic
1160048007 18:75405872-75405894 CTCCAAAAGATGCTGTGCCCTGG - Intergenic
1160056088 18:75482344-75482366 CTCCATGGGAACCAGAGCCCAGG + Intergenic
1160121578 18:76135066-76135088 CTGCATGGGCAGCGGGGCCCAGG - Intergenic
1160530391 18:79558998-79559020 CTCCAAGGGCAGCTCTGACCAGG + Intergenic
1160537919 18:79604778-79604800 CCCCAGGGGAACCTGGGCCGTGG + Intergenic
1160691874 19:464009-464031 CTCCAGGGGTCGCGGGGCCCGGG + Exonic
1160732836 19:649080-649102 CTCCAAGGGGCCCAGGGCCCAGG - Intronic
1161772803 19:6240434-6240456 CTCCAAGCGGAGCTGGCACCCGG + Intronic
1161965371 19:7544881-7544903 CTCCCAGATAAGCAGGGCCCAGG - Intronic
1162477808 19:10911528-10911550 CTGCAGGGGAAGCTGGGGTCAGG - Intronic
1162833698 19:13302774-13302796 CTCCACTGGGAGCTGGGGCCGGG + Intronic
1163008257 19:14409586-14409608 CTCCACGAGGAGCTGGGCCAGGG + Exonic
1163597060 19:18226363-18226385 CCCCGAGGGGAGCCGGGCCCGGG + Intronic
1163831708 19:19550275-19550297 GTCAAAGGGGAGCTGGGCACAGG - Intergenic
1164502423 19:28831255-28831277 AGTCAAGGGGAGCTGGGCCCAGG + Intergenic
1164972583 19:32545177-32545199 CTCCATGGGCAGCTGGGTCCAGG + Intergenic
1165461355 19:35945908-35945930 CCCCAGGGGAAGCTGGGGCAGGG + Intergenic
1166359824 19:42248480-42248502 CTCCAGGGAGAGCTGGGCCGTGG + Exonic
1167476840 19:49706225-49706247 CTCCAGGGGCACGTGGGCCCAGG + Exonic
1167525134 19:49978958-49978980 CTCCCTGGGAAGCTGGGCCCTGG + Intronic
1168076309 19:53982510-53982532 CTCCAAGGGCAGCGTGGCCGCGG + Exonic
1168550435 19:57288953-57288975 CTACTCGGGAAGCTGAGCCCAGG - Intronic
925117910 2:1396127-1396149 TTCCAAGGGGAGATGGGGCCTGG - Intronic
925361045 2:3280513-3280535 CTCCAGGGGAAGAGGGGCTCTGG + Intronic
927207021 2:20617260-20617282 CAGCAAGGGATGCAGGGCCCGGG + Intronic
927783395 2:25956311-25956333 CTCCAAGGGGACCTGGCACCTGG + Intronic
927879127 2:26678140-26678162 CTCCAAGTGTATCTGGGCACAGG + Intergenic
928490330 2:31777408-31777430 CTCCAAGGGAACCAGTGCCAGGG + Intergenic
929133561 2:38602376-38602398 CTCCCCGGGAAGCAGGGCCTCGG - Intronic
929815069 2:45223863-45223885 CTCCATGGGATGCCAGGCCCTGG + Intergenic
930237547 2:48902510-48902532 CTCCTAGGGAAGCTGCTCTCAGG + Intergenic
930722044 2:54647217-54647239 CTCCAAGACCAGCCGGGCCCTGG + Exonic
932344100 2:70984653-70984675 CTCCACGGCAAGCTGCACCCAGG + Exonic
932459410 2:71872713-71872735 CCCCTGGGGAAGCTGGGGCCTGG + Intergenic
932471275 2:71961048-71961070 CTCCAAGGGAACCAGGGCCAGGG - Intergenic
932606928 2:73171715-73171737 TTCCAAGGGAAGCTGGGTGGGGG - Intergenic
933920452 2:87040325-87040347 ATCCAAGAGGAGCTGGGACCTGG - Intergenic
933925500 2:87088696-87088718 TTCCAAGGGAAGCTGGGTGGGGG + Intergenic
933931172 2:87153461-87153483 ATCCAAGAGGAGCTGGGACCTGG + Intergenic
934002545 2:87729573-87729595 ATCCAAGAGGAGCTGGGACCTGG + Intergenic
934099206 2:88636002-88636024 CTCCAAACTAAGCTGGACCCAGG + Intergenic
934768361 2:96893235-96893257 CTCCCCAGGAAGCTGAGCCCGGG + Intronic
936068188 2:109347943-109347965 CACCAAGGTAAGGTGAGCCCCGG + Exonic
936361951 2:111811971-111811993 ATCCAAGAGGAGCTGGGACCTGG - Intronic
937580805 2:123485314-123485336 CTACAAGTGAAGCTGGTCCTGGG - Intergenic
938199663 2:129362410-129362432 ATCCAAGGGGAGCTGGGCAAGGG + Intergenic
938400619 2:130987891-130987913 CTGTAAGGGAAGCTGGGCTTGGG + Intronic
941407073 2:165103310-165103332 CTCCAAGGAAAGATGGCCACAGG + Intronic
942483583 2:176415963-176415985 TTTCATGGGAAGCTGAGCCCTGG - Intergenic
944581618 2:201137296-201137318 CTCCCAGGGCAGCCTGGCCCAGG + Intronic
945066252 2:205949846-205949868 CCCCCAGGGAAGCCTGGCCCAGG + Intergenic
945176129 2:207045272-207045294 CTCCAAGGGAAGCTAGCTACAGG - Intergenic
947635956 2:231680932-231680954 CTCCGAGCGCAGCTGGGCCGGGG + Intergenic
948408259 2:237739276-237739298 CTCCAGGGCCAGCTCGGCCCGGG + Intronic
948551810 2:238777963-238777985 GGCAAAGGGAAACTGGGCCCTGG - Intergenic
948812659 2:240492101-240492123 CTGCTTGGGAGGCTGGGCCCAGG - Intronic
948984184 2:241509783-241509805 CTGCAAGCGGAGCTGTGCCCAGG + Intergenic
949043654 2:241860523-241860545 CTGGAGGGGAGGCTGGGCCCAGG + Intergenic
1168769523 20:406613-406635 CTACTCGGGAAGCTGAGCCCAGG + Intergenic
1168875190 20:1166555-1166577 CTCAGATGGAAGCTGGGCCTGGG + Exonic
1169488971 20:6055627-6055649 CTCCCAGGGAGCCTGGGCCCAGG + Intergenic
1169733429 20:8811303-8811325 CTCGAAGGGAAGCAGGGATCTGG + Intronic
1170817251 20:19724210-19724232 GGCCAAGGGAAGATGGGCACTGG + Intergenic
1171058936 20:21937129-21937151 TTCCAAGGGCTCCTGGGCCCAGG + Intergenic
1172530260 20:35626229-35626251 CTCCAAGGGAACCTAGGCCTGGG + Exonic
1173001391 20:39108467-39108489 TTCCAAAGGAAGCTGGGGTCAGG - Intergenic
1173173907 20:40749821-40749843 GTCCAGGGGAAGCTGGGTCCAGG - Intergenic
1173371869 20:42443698-42443720 CTTTCAGGGAAGGTGGGCCCAGG + Intronic
1174134614 20:48370870-48370892 CTACAGGAGAAGCTGGGCCTTGG + Intergenic
1174352999 20:49981720-49981742 CTCCCAGGGAAGCTGGGGTGGGG + Intergenic
1174404061 20:50292518-50292540 CTCCCAGGGCAGCCTGGCCCAGG - Intergenic
1174870128 20:54174086-54174108 CTCCGAGGGACGCGGGACCCAGG + Intergenic
1175107955 20:56627870-56627892 CTCCAAGGGAAACTTTCCCCCGG - Intergenic
1175712531 20:61232571-61232593 CTTCAAGGGAGGCTGGGCCTGGG + Intergenic
1175916045 20:62426452-62426474 CTCCAAGGCCAGGTGGGCCCCGG - Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176062983 20:63180261-63180283 CTCGGAGGGAAGGTGGCCCCTGG + Intergenic
1176063477 20:63182400-63182422 CTCCAGGGGAAGCTGAGGCCAGG + Intergenic
1176171346 20:63697725-63697747 CCCCAGGGGAGGCTGTGCCCTGG - Intronic
1176281603 20:64316692-64316714 CGCGAAGGGAAGCGCGGCCCGGG - Intergenic
1179570418 21:42275310-42275332 CGCCCAGGGATGCTGGGCCCAGG - Intronic
1180181585 21:46120700-46120722 CCCCAAGGTAAGGGGGGCCCAGG + Intronic
1181049268 22:20231040-20231062 GGCCTGGGGAAGCTGGGCCCAGG - Intergenic
1181106924 22:20581162-20581184 CTGCAAGGGATGCTGGGTGCAGG - Intronic
1181287617 22:21765647-21765669 ATCCAGGGGAAGCTGGGGCTGGG - Intronic
1182422583 22:30255879-30255901 TCCCCAGGAAAGCTGGGCCCAGG + Intergenic
1183161630 22:36117440-36117462 CACAAAGGGTATCTGGGCCCTGG - Intergenic
1183521539 22:38298580-38298602 CACCATGGGCAGCAGGGCCCAGG - Intronic
1183613540 22:38927377-38927399 CGCCAGGGGACGCAGGGCCCAGG - Intergenic
1183917607 22:41135028-41135050 CTCCAAGAGTAGCTGGGACTAGG + Intronic
1184274456 22:43402210-43402232 CTCCAAGAGGACCTTGGCCCAGG + Intergenic
1184429033 22:44430451-44430473 CTCCATGGGCAGCGGGACCCTGG - Intergenic
1184988820 22:48153976-48153998 CCCTAAGGCACGCTGGGCCCCGG + Intergenic
949535709 3:4994972-4994994 CCCCAGGGGAAGCAGGGGCCAGG - Intergenic
950831531 3:15879768-15879790 CTCCCAGGGCAGCCTGGCCCAGG - Intergenic
952870992 3:37901245-37901267 CTCCAAAGGGACCTGGGTCCAGG + Intronic
953472865 3:43181606-43181628 CCCCCAGGAAAGCTGGCCCCAGG + Intergenic
953566013 3:44032685-44032707 CCCCATGGGAAGCTGAGACCTGG - Intergenic
953607137 3:44419483-44419505 CTGCAAGGTCATCTGGGCCCTGG - Intergenic
953879511 3:46684299-46684321 CTACAAATGAAGCTGGGACCTGG + Intronic
953901500 3:46846339-46846361 CGCCGAGGGAGGCTGAGCCCTGG + Intergenic
953919656 3:46943209-46943231 CTCCCAGGGCTGCTGGGACCTGG + Intronic
954103700 3:48397881-48397903 CTCCAAGGGACCCAGGGACCCGG + Intronic
954369820 3:50164243-50164265 TGCCAAGGGAAGCTGGAGCCAGG - Intronic
954445905 3:50546820-50546842 CTCCTGGGGGAGCTGGGCACTGG - Intergenic
957262579 3:77920724-77920746 ATCCAAGAGGAGCTGGGACCTGG - Intergenic
961379485 3:126487757-126487779 CTCCCAGGGCAGCTGGGCTGGGG - Intronic
961523914 3:127484470-127484492 CTCACAGGGTTGCTGGGCCCTGG - Intergenic
962013994 3:131421925-131421947 CTTCTAAGGAAGGTGGGCCCTGG - Intergenic
962049372 3:131796615-131796637 CTCCAGGGGAAGGGGGACCCTGG - Intronic
962746870 3:138403396-138403418 CTCCAAGGGAAGATGGCTTCAGG - Exonic
965614911 3:170584655-170584677 CTCGCAGGGAATGTGGGCCCTGG + Intronic
965837096 3:172864774-172864796 CTCAAAGGGAGGTTGGCCCCTGG - Intergenic
965932030 3:174056139-174056161 GTCCAAGGGAATCTGAGCACAGG + Intronic
967269307 3:187719841-187719863 GCCTAAGGGAAGCTGGCCCCAGG - Intronic
968288228 3:197520460-197520482 CTACAAGGCAGGGTGGGCCCCGG - Intronic
968728636 4:2259684-2259706 CCCCAAGGGTCTCTGGGCCCAGG - Intronic
968874293 4:3257155-3257177 CTGCAAAGGAGGCTGGGGCCAGG + Intronic
969271463 4:6106079-6106101 ATCCATGGGAACGTGGGCCCAGG - Intronic
969478116 4:7432700-7432722 CTCCAAGGGCTGCTGGGCTTCGG - Exonic
969490869 4:7498596-7498618 CTCCTAGGGACGCAGGGCCTGGG + Intronic
969848933 4:9941839-9941861 CTGCAAGGCATGCTGGGACCTGG - Intronic
972217801 4:36916625-36916647 CTCAAACGGAAGCAGGGCTCTGG - Intergenic
972629440 4:40830447-40830469 CTCCAAGGTAAGGTGGGTCAGGG - Exonic
978144484 4:105355635-105355657 TTCCAAGGGAAAATGTGCCCTGG - Intergenic
980749965 4:137076212-137076234 CTGCAAGGGAAGCAGGGAACTGG - Intergenic
981356583 4:143796484-143796506 CTCTCAGGGAGGCTGGGACCAGG + Intergenic
981368120 4:143927083-143927105 CTCTCAGGGAGGCTGGGACCAGG + Intergenic
981377912 4:144037355-144037377 CTCTCAGGGAGGCTGGGACCAGG + Intergenic
982474615 4:155834886-155834908 CACCAAGGGGAGCTCGGCCGGGG + Intronic
983839842 4:172443835-172443857 CTCCAAGGAAAGGTGTGGCCCGG + Intronic
985268459 4:188172305-188172327 CTCTTCGGGTAGCTGGGCCCTGG + Intergenic
985660137 5:1152896-1152918 CTGCAAGGGAAGGTCAGCCCAGG + Intergenic
985908889 5:2863861-2863883 CTCGAAGGGAACCCGTGCCCAGG - Intergenic
986448467 5:7844089-7844111 TTGCAAGGGAAACTGGGCCTTGG + Intronic
986686329 5:10278338-10278360 GTCCATGGGAAGGTGGTCCCAGG - Intronic
987054392 5:14177654-14177676 CTCCAAGGGGTCCTGGGCTCTGG - Intronic
989180301 5:38569630-38569652 CTCCCATGGAAACTGGTCCCTGG + Intronic
989602788 5:43215384-43215406 CTCCAAGAACTGCTGGGCCCAGG - Intronic
990803159 5:59628638-59628660 CTCCAAGACAAGTAGGGCCCTGG + Intronic
995574077 5:113511627-113511649 CCCCAAGAGAAGCAGGGCTCAGG + Intergenic
996009052 5:118460189-118460211 CCCCACGTGAAGGTGGGCCCTGG + Intergenic
997710102 5:135996896-135996918 CTTCTAGGGAAGCCGGGTCCTGG - Intergenic
999452026 5:151685858-151685880 CTCCAAGGGAAGGGGGGCACTGG - Intronic
1000259005 5:159568073-159568095 CTCCAAGCGCAGCTGTCCCCTGG + Intergenic
1001319706 5:170670484-170670506 CTCCCAGGGAAACTGAGCTCAGG - Intronic
1001680180 5:173550963-173550985 CTCCAAGGGCAGCGAGACCCTGG - Intergenic
1001701015 5:173706432-173706454 GGCCTGGGGAAGCTGGGCCCTGG - Intergenic
1002332106 5:178450308-178450330 CTGCAAGGGAATGTGGGACCAGG - Intronic
1002571157 5:180140070-180140092 CTCCCAGGGGACCTGGGGCCTGG + Intronic
1004079696 6:12380173-12380195 ATCAAAAGGAAGCTGGGGCCAGG + Intergenic
1004554284 6:16680517-16680539 CTTCAAGGGAAGAAGGACCCAGG + Intronic
1004731839 6:18366516-18366538 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1005325110 6:24692526-24692548 CTCCGAGGGAAGCTGGGGTGGGG - Intronic
1006502319 6:34466558-34466580 TTCCTTGGGAAGCTGGGGCCTGG + Intronic
1006524108 6:34589173-34589195 CTCCATGGGAAGCTTGAACCAGG - Exonic
1007112730 6:39322391-39322413 CTCCAACTGAAACTGGTCCCTGG + Exonic
1007584153 6:42978696-42978718 TTGCAAGGGCTGCTGGGCCCAGG - Exonic
1008539376 6:52533641-52533663 CTGCAGGGGATGGTGGGCCCAGG + Intronic
1008596765 6:53050008-53050030 CTCCAATTGAGGCTGGGCACAGG - Intronic
1008725383 6:54411610-54411632 CTCAAAGGGAAGCTGAGAGCTGG + Intergenic
1011705154 6:89993753-89993775 CTCCAAGGACACCAGGGCCCAGG + Intronic
1013131027 6:107232930-107232952 CTCCTTGGGAGGCTGAGCCCAGG - Intronic
1015701490 6:136040191-136040213 TTCCCAGGGAAGCTGCACCCTGG + Intronic
1016581887 6:145637437-145637459 CTGCAGGGGAAGCAGGGCTCAGG - Intronic
1018064740 6:160117102-160117124 TTCCTAGGGAACCTGGGCCAGGG - Intergenic
1018544482 6:164919590-164919612 CTTCAAGGGAAGCCTGGCACTGG + Intergenic
1019194278 6:170272191-170272213 CCCCAGGGGAAGTAGGGCCCGGG + Intergenic
1019275721 7:174528-174550 AACCAAGGGAAGCCAGGCCCTGG + Intergenic
1019367846 7:644496-644518 CTCGGAGGGATGCTGGACCCCGG - Intronic
1019547554 7:1585820-1585842 CGGCCAGGGAAGGTGGGCCCTGG - Intergenic
1019740342 7:2669962-2669984 AGCCAAGGGGAGCTGGACCCAGG + Intergenic
1020034920 7:4959026-4959048 TTCCATGGGAATCTGGCCCCGGG + Exonic
1020251769 7:6474881-6474903 CGCTTTGGGAAGCTGGGCCCAGG - Intronic
1021106814 7:16646618-16646640 CTCCCGGGGAGGCTGGGGCCGGG + Intronic
1022681730 7:32554936-32554958 CTACCAGGGAAACTAGGCCCTGG - Intronic
1022732051 7:33036333-33036355 CACCCACGGAAGCTGGGCCAGGG - Intronic
1024382711 7:48717447-48717469 CTCAAAGGGCAGCTTGGGCCTGG - Intergenic
1024539430 7:50464030-50464052 CTGCTATGGAAGCAGGGCCCAGG - Intronic
1026224900 7:68431718-68431740 CTCCAGGGGAGGCTGAGCCAGGG - Intergenic
1026863635 7:73809802-73809824 CTCCCAGTGAAACCGGGCCCTGG - Intronic
1026976715 7:74503188-74503210 CTCCCTGGGCAGCGGGGCCCTGG - Intronic
1028600209 7:92592711-92592733 CTCTGAGGGAAGCTGGCCCAGGG - Intergenic
1029312383 7:99679264-99679286 CTTCATGGGAAGCTGTCCCCTGG - Intronic
1029314518 7:99699394-99699416 CTTCACGGGAAGCTGTCCCCCGG - Intronic
1029320159 7:99751854-99751876 CTTCACGGGAAGCTGTCCCCCGG - Intergenic
1029363435 7:100102516-100102538 CACATTGGGAAGCTGGGCCCAGG + Intronic
1029592587 7:101517158-101517180 GCCCTAGGGAAGCTGAGCCCAGG + Intronic
1029618717 7:101676671-101676693 CTCCAGGCGAGGCTGGGGCCAGG - Intergenic
1029979246 7:104862726-104862748 CTCCTTGGAAAGCTGGCCCCAGG - Intronic
1031978012 7:128105949-128105971 AGCCAAGGAAAGCTGGGCTCTGG - Intergenic
1032018183 7:128392789-128392811 CTCCCAGGGCAGCCTGGCCCCGG + Exonic
1032193693 7:129778358-129778380 CTCCAAGAGCCACTGGGCCCCGG + Intergenic
1033608618 7:142944931-142944953 CACAAAGGGAAGGTGGGGCCTGG + Intronic
1034196485 7:149252318-149252340 CTGCAAGGTAAGATGGGCACTGG - Intronic
1034500435 7:151447345-151447367 CTTCAAGTGAAGCAGGGACCAGG + Intergenic
1035120062 7:156559548-156559570 CCCAAAGGGGAGCTGGGCACTGG + Intergenic
1036032903 8:4992453-4992475 CTCCAAGCCTAACTGGGCCCGGG - Intronic
1036485144 8:9172732-9172754 CTCCAAAGGAAGCTCGTCTCTGG - Intergenic
1036748747 8:11429701-11429723 CTCAGAGGCGAGCTGGGCCCAGG + Intronic
1037731390 8:21526598-21526620 CCCACAGGCAAGCTGGGCCCTGG + Intergenic
1039785704 8:40832568-40832590 TGCCAAGGGCAGCTGGGCTCGGG - Intronic
1042535016 8:69850242-69850264 CTTCAAGGGAAGCTTGTTCCAGG - Intergenic
1043170714 8:76962454-76962476 CTGCAATGGAAGCTGGGTCAAGG - Intergenic
1045238965 8:100381552-100381574 CTGCAAGGGAAGCTGGGAAATGG - Intronic
1045552834 8:103187742-103187764 CTCTAAGGGAAGAAGGACCCAGG - Intronic
1047247901 8:123160602-123160624 CGCCAGGGGACGCTGTGCCCAGG + Intergenic
1047275539 8:123402302-123402324 CTCCCAGGGCAGCCTGGCCCAGG - Intronic
1047496656 8:125413668-125413690 CTCTGAGGGAAGCTGAGCTCTGG + Intergenic
1047844885 8:128794793-128794815 CTTCCAGGGAGGCTGCGCCCGGG + Intergenic
1049302449 8:141878869-141878891 GCCCAAGGGCAGCTGAGCCCTGG - Intergenic
1049419759 8:142511366-142511388 CTCCGAGGGAGCCTGGGCCTGGG + Intronic
1049748928 8:144274474-144274496 CTCCAAGGGAACAGAGGCCCAGG + Intronic
1049772662 8:144390943-144390965 CTCTACGTGAAGCTGGGCCAGGG + Exonic
1049787144 8:144456430-144456452 ACCCAACAGAAGCTGGGCCCTGG + Intronic
1049831933 8:144706167-144706189 CTCAGAGGGAAGGTGGGGCCAGG - Intergenic
1052941158 9:34132963-34132985 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1056865453 9:90224489-90224511 AGGCAAGGGAAGGTGGGCCCTGG + Intergenic
1057623212 9:96655050-96655072 CTGGAAGGGAAGCGCGGCCCAGG - Intronic
1060010430 9:120038865-120038887 CTCCAGGGGACACTGAGCCCTGG + Intergenic
1061074640 9:128333678-128333700 CTCCAAGGGAAGCAGGGGATGGG - Exonic
1061502953 9:131014073-131014095 GGCCAAGGCCAGCTGGGCCCAGG - Intronic
1061861033 9:133468963-133468985 CTCCAGGGGAAGCTGCTCCCAGG - Exonic
1061887529 9:133599361-133599383 CACAAAGGGAACCTGGGTCCCGG + Intergenic
1061892891 9:133632017-133632039 CTCCCAGGGAAGCAGAACCCAGG - Intergenic
1062451725 9:136618562-136618584 TTCCAAGGAGAGCTGTGCCCCGG - Intergenic
1185985304 X:4826133-4826155 CTTCAATGGAAGCTGCGCTCAGG + Intergenic
1186163717 X:6804975-6804997 TTCCAAGGAAGGCTGGGCACGGG + Intergenic
1187007716 X:15248751-15248773 CTCCAAGAAGAGCTGGGCCAAGG + Exonic
1188860090 X:35245030-35245052 CCCGAAGCAAAGCTGGGCCCGGG - Intergenic
1189376855 X:40473397-40473419 CTCCAAGGTCAGCAAGGCCCCGG - Intergenic
1189658990 X:43277901-43277923 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1195753389 X:108178613-108178635 CCCCCAGGGCATCTGGGCCCAGG + Intronic
1199944106 X:152652075-152652097 CTGGAAGGGAAGATGGGCGCAGG + Intronic
1200902882 Y:8450731-8450753 CCCCAATGGAAGCAGGGTCCAGG - Intergenic