ID: 1142206253

View in Genome Browser
Species Human (GRCh38)
Location 16:88784631-88784653
Sequence GGGGGCGGTCGAGCGAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142206253_1142206268 27 Left 1142206253 16:88784631-88784653 CCGGCGCTCGCTCGACCGCCCCC 0: 1
1: 0
2: 1
3: 18
4: 163
Right 1142206268 16:88784681-88784703 CCGCCGCCGCCCTTCCAGCCCGG 0: 1
1: 0
2: 2
3: 53
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142206253 Original CRISPR GGGGGCGGTCGAGCGAGCGC CGG (reversed) Intronic