ID: 1142206253 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:88784631-88784653 |
| Sequence | GGGGGCGGTCGAGCGAGCGC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 183 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 18, 4: 163} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1142206253_1142206268 | 27 | Left | 1142206253 | 16:88784631-88784653 | CCGGCGCTCGCTCGACCGCCCCC | 0: 1 1: 0 2: 1 3: 18 4: 163 |
||
| Right | 1142206268 | 16:88784681-88784703 | CCGCCGCCGCCCTTCCAGCCCGG | 0: 1 1: 0 2: 2 3: 53 4: 369 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1142206253 | Original CRISPR | GGGGGCGGTCGAGCGAGCGC CGG (reversed) | Intronic | ||