ID: 1142206470

View in Genome Browser
Species Human (GRCh38)
Location 16:88785320-88785342
Sequence GCCGCGCGGGACAGCGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 176}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142206470_1142206490 17 Left 1142206470 16:88785320-88785342 CCCCCTCCGCTGTCCCGCGCGGC 0: 1
1: 0
2: 0
3: 9
4: 176
Right 1142206490 16:88785360-88785382 CGCCCTGGTGCGTTGGGGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 119
1142206470_1142206477 -8 Left 1142206470 16:88785320-88785342 CCCCCTCCGCTGTCCCGCGCGGC 0: 1
1: 0
2: 0
3: 9
4: 176
Right 1142206477 16:88785335-88785357 CGCGCGGCCCGTCCCGCCTCCGG 0: 1
1: 0
2: 1
3: 15
4: 142
1142206470_1142206486 11 Left 1142206470 16:88785320-88785342 CCCCCTCCGCTGTCCCGCGCGGC 0: 1
1: 0
2: 0
3: 9
4: 176
Right 1142206486 16:88785354-88785376 CCGGCCCGCCCTGGTGCGTTGGG 0: 1
1: 0
2: 0
3: 2
4: 61
1142206470_1142206484 10 Left 1142206470 16:88785320-88785342 CCCCCTCCGCTGTCCCGCGCGGC 0: 1
1: 0
2: 0
3: 9
4: 176
Right 1142206484 16:88785353-88785375 TCCGGCCCGCCCTGGTGCGTTGG 0: 1
1: 0
2: 1
3: 3
4: 64
1142206470_1142206480 2 Left 1142206470 16:88785320-88785342 CCCCCTCCGCTGTCCCGCGCGGC 0: 1
1: 0
2: 0
3: 9
4: 176
Right 1142206480 16:88785345-88785367 GTCCCGCCTCCGGCCCGCCCTGG 0: 1
1: 0
2: 5
3: 45
4: 350
1142206470_1142206487 12 Left 1142206470 16:88785320-88785342 CCCCCTCCGCTGTCCCGCGCGGC 0: 1
1: 0
2: 0
3: 9
4: 176
Right 1142206487 16:88785355-88785377 CGGCCCGCCCTGGTGCGTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142206470 Original CRISPR GCCGCGCGGGACAGCGGAGG GGG (reversed) Intergenic
900349747 1:2228689-2228711 GGCGCGCGGGGCGGCGGCGGGGG + Exonic
902304686 1:15526977-15526999 GACGCGCGGAACCGCGGACGCGG + Intronic
903263302 1:22142753-22142775 GCGGCGCGGGGCAGCGGGCGCGG - Intronic
903724543 1:25431020-25431042 GCGGGGCGGGCCAGCGGCGGCGG + Exonic
907069189 1:51518952-51518974 GCCGCGCGGGGCGGGGCAGGAGG + Intronic
912363475 1:109113874-109113896 GCCGCGCGCACCAGCGGCGGCGG + Intronic
917817608 1:178725864-178725886 GCCGCCAGGGCCAGGGGAGGGGG - Intronic
919916971 1:202144776-202144798 GCCGCGAGGGAGGGCGGCGGCGG - Intergenic
920559951 1:206931894-206931916 GCCCTGCAGGACAGCTGAGGTGG + Intronic
922739383 1:228006913-228006935 GCGGCGCGGGGCGGCGGGGGCGG - Intergenic
923171677 1:231422330-231422352 GCGGCGCGCGAGGGCGGAGGGGG + Exonic
1065214945 10:23439726-23439748 GCCGGGCGGGCCGGCGGCGGCGG - Exonic
1068538460 10:58267274-58267296 GCTTCGGGGGACAGCGGAAGAGG + Intronic
1071567730 10:86680392-86680414 GCCACGAGGCATAGCGGAGGTGG - Intronic
1072710791 10:97714469-97714491 CCCGCGCGGGGCGGCGGCGGGGG - Exonic
1076372284 10:129963560-129963582 GCGGCGCCGGCCGGCGGAGGGGG + Intronic
1076792727 10:132785643-132785665 GCCGCGCGCCACAGCGGCCGCGG + Exonic
1080012314 11:27471990-27472012 GCCGCCCGGGCCTGGGGAGGGGG - Intronic
1081854676 11:46295918-46295940 GCTGCGCGTGACAGCCGAGAAGG + Intronic
1083657016 11:64234642-64234664 GCAGCGCAGCGCAGCGGAGGCGG - Exonic
1083726316 11:64630375-64630397 GCGGCGCGGGCCCGCGGAGGAGG - Intronic
1084014683 11:66371554-66371576 GCCCCGCGGGACAGGTGAGTGGG - Exonic
1084023197 11:66430665-66430687 GCCGAGCGGAACTGAGGAGGGGG + Intergenic
1084068470 11:66718915-66718937 GCCCTGCGGGGCGGCGGAGGAGG + Intronic
1084284260 11:68121304-68121326 GGCGCGCGGGGCGGCGGCGGCGG + Intronic
1084332496 11:68438220-68438242 GCGGCGGGGGTCAGAGGAGGAGG + Intronic
1085284623 11:75351713-75351735 GGCGGCCGGGAGAGCGGAGGAGG - Intergenic
1085346114 11:75769011-75769033 GCCGCGCAGGACCCCGGAGTAGG - Exonic
1085395778 11:76206501-76206523 GCAGCCGGGGAGAGCGGAGGCGG + Exonic
1089537347 11:119168903-119168925 GCCGCGCAGGCGGGCGGAGGTGG + Exonic
1089596532 11:119584449-119584471 GCCGCGCGGAGCCGCGGAAGAGG - Intergenic
1092045949 12:5431996-5432018 GCGGCGCGGGCCGGCGGGGGAGG + Intergenic
1095810873 12:46372411-46372433 GCCGCGCGGGAAGGCGGCCGCGG - Intronic
1095925882 12:47578687-47578709 GCAGCGGGGGTCAGGGGAGGAGG + Intergenic
1096475721 12:51907622-51907644 GCCGCGCGGTGGAGGGGAGGTGG + Exonic
1096710521 12:53452252-53452274 GCCCCGCGGGCGGGCGGAGGAGG - Exonic
1097017431 12:55997383-55997405 GCTGAGCTGGGCAGCGGAGGGGG + Intronic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1100632115 12:96399897-96399919 GCTGCGTGGGACAGAGGCGGGGG - Intronic
1102781560 12:115570231-115570253 GCTGCGCAGGACAGAGGCGGGGG - Intergenic
1102997459 12:117361248-117361270 GCCGCGCGGGGCGGCGGACTCGG - Intronic
1103092032 12:118104184-118104206 GCAGCCCGGGGCAGCGGCGGGGG - Intronic
1103749864 12:123151147-123151169 GCCGCGCGGGGGAGCGGCGGCGG + Intergenic
1104909902 12:132235659-132235681 GCCCCTCGGGACAGGGCAGGAGG + Intronic
1106776553 13:33015871-33015893 GCCAGGTGGGACAGCCGAGGGGG - Intergenic
1111676805 13:91398642-91398664 GCCGAGCCGGGCGGCGGAGGCGG + Intergenic
1112734250 13:102400067-102400089 GCAGCGCGAGGCAGAGGAGGAGG - Intronic
1113231240 13:108215653-108215675 GCCCCGTGGGGCTGCGGAGGCGG + Intronic
1117675657 14:58152348-58152370 CCCCCGCGGGAGAGCGGAGGCGG - Intronic
1119320924 14:73729817-73729839 GGCGCACGGGAGAGCGCAGGTGG + Exonic
1120167842 14:81220221-81220243 GCCGGGCCGGGCCGCGGAGGCGG - Intronic
1122810105 14:104283508-104283530 GCTGCCCGGGAGGGCGGAGGGGG + Intergenic
1129676043 15:77632822-77632844 GCGGCGGGCGACAGCGCAGGCGG - Intronic
1129823650 15:78620609-78620631 ACCGCGCGGGCGAGCGGAGAGGG - Intronic
1130908899 15:88257583-88257605 GCTGCGCTGGAGAGCCGAGGTGG + Intergenic
1130994062 15:88894585-88894607 GCCGCCCGGGCCAGCGGATTGGG - Intronic
1132779003 16:1612717-1612739 GCGGCGCGGGAGAGCGCGGGGGG + Intronic
1132802415 16:1760959-1760981 GCTGCCCGGGAATGCGGAGGGGG - Intronic
1132875684 16:2135915-2135937 GCCGCGCGGGGAGGAGGAGGAGG - Intergenic
1134519301 16:14911438-14911460 GCCGCGCGGGGAGGAGGAGGAGG + Intronic
1134706971 16:16310093-16310115 GCCGCGCGGGGAGGAGGAGGAGG + Intergenic
1134960569 16:18402031-18402053 GCCGCGCGGGGAGGAGGAGGAGG - Intergenic
1137655128 16:50153136-50153158 GCTGCGCGGCGCAGCGGGGGCGG + Intronic
1138520999 16:57570801-57570823 GCAGGGCAGGACAGAGGAGGCGG - Intronic
1138961782 16:62036564-62036586 CCAGCGCGGGAGAGCGAAGGGGG - Exonic
1139965178 16:70741370-70741392 CCCTCCCGGGGCAGCGGAGGTGG + Intronic
1140223117 16:73058203-73058225 GCGGCGCGGGGCCGGGGAGGAGG + Intronic
1141538636 16:84700446-84700468 GCCGCGCCGGCCGGGGGAGGCGG + Intronic
1142049915 16:87951547-87951569 GCCCCGCGGGAAGGGGGAGGCGG - Intronic
1142147890 16:88500093-88500115 GCCGGGTGGGAGGGCGGAGGAGG - Intronic
1142206470 16:88785320-88785342 GCCGCGCGGGACAGCGGAGGGGG - Intergenic
1143174916 17:4950054-4950076 GCCGCGCGGGCCGGCGGGGCGGG + Intronic
1143527147 17:7479376-7479398 GCAGCGCCGGGCAGCGGAGAGGG + Intronic
1146179651 17:30689439-30689461 GGCCCGCGGTACAGTGGAGGGGG - Intergenic
1146183201 17:30709869-30709891 GGCGCGCGGAAGAGGGGAGGCGG + Intergenic
1147168695 17:38606040-38606062 GCCGCCCGGGGCGGCGGGGGCGG + Intergenic
1147440331 17:40443658-40443680 GGCGCGCGGGCGAGCGGCGGAGG - Exonic
1149486340 17:57045896-57045918 GCCGCGTGGGGAGGCGGAGGCGG - Intergenic
1149595344 17:57861835-57861857 GGCGCGGGGAGCAGCGGAGGGGG + Exonic
1149614630 17:57987965-57987987 GCCGGGCCGGAGAGCGGAGCCGG + Intronic
1151990574 17:77571429-77571451 GCCGAGCGGGGCCGCGAAGGAGG + Intergenic
1152197302 17:78925216-78925238 GCCGAGCGGGGCAGGTGAGGAGG - Exonic
1152716218 17:81902073-81902095 GCCGCGCGGGCGAGCGCTGGAGG - Intronic
1152748428 17:82051669-82051691 GGCGCGCGGGGCAGCGGCAGCGG + Exonic
1153457104 18:5294815-5294837 GCTGCCCGGGGCAGGGGAGGCGG - Intronic
1153457187 18:5295172-5295194 GCGGCGCGGGGCTGCGGAGCCGG - Intronic
1157613777 18:48975498-48975520 GCCGTGCGGGACCGCGATGGGGG - Intergenic
1159390770 18:67789243-67789265 GCCGCGTGGGTCAGGTGAGGAGG - Intergenic
1160698539 19:495830-495852 GCCGCCCGGGAAAGTGCAGGCGG + Intronic
1160698813 19:496819-496841 GGGGCGCGGGAGAGAGGAGGGGG + Intronic
1160698840 19:496892-496914 GGGGCGCGGGAGAGAGGAGGGGG + Intronic
1160698849 19:496911-496933 GGGGCGCGGGAGAGGGGAGGGGG + Intronic
1160698953 19:497237-497259 GGGGCGCGGGAGAGGGGAGGGGG + Intronic
1160704605 19:524192-524214 GCTGGGCGGGGCAGGGGAGGTGG - Intergenic
1161388090 19:4007602-4007624 GCCGCGCGCGCCTGCGCAGGAGG + Intergenic
1162021159 19:7869235-7869257 GCCGCGGGCGGCAGCGGCGGGGG - Exonic
1162572409 19:11480872-11480894 GCCCCGCGGGGCCGCGCAGGGGG - Exonic
1162810747 19:13163207-13163229 GCCCAGCGGGAAGGCGGAGGCGG + Intergenic
1163688649 19:18726317-18726339 TCCCCGGGGGACAGCAGAGGAGG + Intronic
1164143677 19:22496190-22496212 GCAGGGCGGCACAGCAGAGGAGG + Intronic
1166094720 19:40531429-40531451 GCCTCCCGGGACCGCGGAGCTGG + Intronic
1166853414 19:45770928-45770950 GCGGGGCGCGACGGCGGAGGGGG + Intronic
1167633491 19:50639823-50639845 GGCGCGCGGGGCTGCGGCGGCGG - Intronic
927054945 2:19358840-19358862 GTCGCGCGGGACTGAAGAGGAGG - Intergenic
934566850 2:95346235-95346257 TCCGCGCGGGCCAGCGGCGCGGG + Intronic
935971485 2:108534368-108534390 GCCGCGCGGGAAGGCGGGGGAGG - Intronic
938727666 2:134121420-134121442 GCCGCGCGGAAGAGCCGAAGAGG + Intronic
941110426 2:161414826-161414848 GCCGCGCGGGAATGAGCAGGAGG - Intergenic
941517271 2:166494569-166494591 GCAGCGCGGTGCAGCTGAGGGGG + Intergenic
942450777 2:176106942-176106964 GCGGCGCGGGAGGGCGGACGCGG + Intronic
944811108 2:203328357-203328379 CCAGCGCGCGACAGGGGAGGGGG - Exonic
946248569 2:218400236-218400258 GCCGCCCGGGGCGGCGGCGGCGG - Intronic
947800797 2:232927766-232927788 GCGGCGGGGGCCCGCGGAGGAGG + Intronic
948085332 2:235242545-235242567 GCCGAGGAGGACAGAGGAGGTGG - Intergenic
948920702 2:241064672-241064694 GCCCCGCAGGGCAGTGGAGGTGG + Intronic
1169171704 20:3470825-3470847 GCCGGCCGGGACAGCGCAGCCGG + Intergenic
1169849617 20:10035118-10035140 GGCGCGCGGGACAGCAGGGCTGG - Exonic
1172429199 20:34876281-34876303 GCCAGGCGGGACAGGAGAGGAGG - Intronic
1172951630 20:38726411-38726433 GTCGCGGGGCACAGCGAAGGCGG - Intronic
1173681657 20:44886148-44886170 GCCGTAAGGGACAGCGGAGCCGG + Intronic
1175997297 20:62817484-62817506 GCCGCTCGGGACCCGGGAGGAGG + Intronic
1176389191 21:6154918-6154940 ACCCCGCGGGACTGGGGAGGGGG - Intergenic
1177188026 21:17819319-17819341 GCCGCACGGAACGGCGGTGGTGG - Exonic
1178162935 21:29939650-29939672 CCCGCGTGGGACCGCGGAGCTGG + Exonic
1179734281 21:43383330-43383352 ACCCCGCGGGACTGGGGAGGGGG + Intergenic
1180791405 22:18577478-18577500 GCGGCGCGGGTCTGCGGAGCGGG - Intergenic
1180914836 22:19478988-19479010 GCGGGGCGGGACGGCGGCGGAGG - Intronic
1180965755 22:19787238-19787260 GCCGTGGGGTACAGCCGAGGAGG - Exonic
1181230334 22:21417833-21417855 GCGGCGCGGGTCTGCGGAGCGGG + Intronic
1181248316 22:21517030-21517052 GCGGCGCGGGTCTGCGGAGCGGG - Intergenic
1181299279 22:21867754-21867776 GCCGCGCGGGCCGGCGGAAGCGG + Intergenic
1183880042 22:40819398-40819420 GCGGGGCGGGAAAGCGGGGGGGG + Intronic
1184186774 22:42870037-42870059 GCCACGCGGGCCGGCGGGGGTGG - Exonic
1185285792 22:49999530-49999552 GCCGCGCGGGAGGGCGGGGGTGG + Intronic
954778922 3:53045511-53045533 GCCGCGGCGGAGAGCGGCGGCGG - Intronic
955470492 3:59281791-59281813 GTCGTGGGGGACAGCGGTGGTGG + Intergenic
962367671 3:134796697-134796719 GCTCCGCGGGAGAGCGGAGTTGG + Intronic
967098072 3:186193785-186193807 GCCGCGCGGGCCGGAGCAGGGGG - Intronic
968849548 4:3069700-3069722 GAGGCGCAGGACAGCGGCGGGGG - Intergenic
969288326 4:6222184-6222206 GGCACGCGCGACAGAGGAGGTGG - Intergenic
973552667 4:52051471-52051493 ACCGCGCGGGACGGCGGATGAGG + Exonic
974716040 4:65669759-65669781 GCCGCTCGGGACAGCGGCACCGG - Exonic
986813599 5:11384951-11384973 GCCGCGCGGCGCGGCGTAGGTGG + Exonic
986859028 5:11904528-11904550 GCCGCGGGAGAGAGGGGAGGAGG + Intergenic
989375504 5:40756122-40756144 GCTGCGCGGTACCGCGGGGGCGG - Intergenic
991054502 5:62306550-62306572 GCCGAGCGGGCCAGCGGGGCTGG - Intronic
997272952 5:132557082-132557104 GCCGGTGGGGAGAGCGGAGGCGG - Exonic
1001431690 5:171667523-171667545 GCCGCTCAGGAGAGAGGAGGAGG + Intergenic
1001683804 5:173577583-173577605 CCCGAGTGGGACAGAGGAGGAGG + Intergenic
1002455910 5:179345280-179345302 GCAGCGCGGGGCAGAGCAGGCGG + Exonic
1003139351 6:3457327-3457349 GCCGGGCGGGGCGGGGGAGGAGG + Intergenic
1007739704 6:44003070-44003092 GCCGCGGATGACAGCGGCGGTGG - Exonic
1013230429 6:108157455-108157477 TCGGAGCGGGGCAGCGGAGGAGG + Intronic
1014632441 6:123803602-123803624 GCCGCCGGGGACCGCGGAGCCGG + Intergenic
1014724986 6:124962678-124962700 GCCGCTCGGCTCCGCGGAGGCGG - Exonic
1017877463 6:158536612-158536634 GCTGGGCGGGACCGAGGAGGAGG - Exonic
1019486129 7:1290172-1290194 ACCTCGGAGGACAGCGGAGGGGG - Intergenic
1023814490 7:43939181-43939203 GCAGAGCAGGACAGTGGAGGAGG + Intronic
1023951268 7:44847988-44848010 GGCGCGCGGCCGAGCGGAGGCGG - Exonic
1025752799 7:64307744-64307766 GCCGCGTGGGACAGAGGAAGGGG - Intronic
1026776866 7:73235888-73235910 GCCGCGCTGGACAGGGGTCGGGG - Intergenic
1027017715 7:74789258-74789280 GCCGCGCTGGACAGGGGTCGGGG - Exonic
1027070307 7:75156674-75156696 GCCGCGCTGGACAGGGGTCGGGG + Intergenic
1029684329 7:102135425-102135447 GTCTCGGGTGACAGCGGAGGAGG + Intronic
1032015850 7:128380119-128380141 GCCGCTGGGTGCAGCGGAGGGGG + Intergenic
1037289606 8:17336748-17336770 GCAGCCAGGGCCAGCGGAGGGGG - Intronic
1039805230 8:40992042-40992064 GCCGCGAGGGACAGATGTGGTGG + Intergenic
1041449961 8:57995168-57995190 GCCGCGCTGCGGAGCGGAGGTGG + Intronic
1042987944 8:74604423-74604445 GCCCCGCGGGCGGGCGGAGGAGG + Intronic
1045564347 8:103298730-103298752 GCCGGGCGGCGCAGCGCAGGCGG + Intronic
1046547389 8:115668777-115668799 GCCGGGTGGGAGAGGGGAGGGGG + Exonic
1046547420 8:115669079-115669101 GCCGGGCGGGGCGGCGGCGGCGG - Intronic
1048974382 8:139662808-139662830 GGTGCGGGGGACAGGGGAGGGGG + Intronic
1051104917 9:13568664-13568686 GCCGTGCTGGGCAGCAGAGGGGG + Intergenic
1057488543 9:95505858-95505880 GCAGCGCGGGGCTGCGGAGGCGG - Intronic
1057665185 9:97039190-97039212 GCAGCGCGGGAAGGCGGTGGGGG - Intronic
1058045516 9:100352986-100353008 GCCGCGCGCAACCGGGGAGGCGG + Intergenic
1060514578 9:124257930-124257952 GGCGCGCGGGCCCGCGCAGGCGG + Intronic
1060556803 9:124512200-124512222 CCCGTGCAGGGCAGCGGAGGGGG + Intergenic
1062162468 9:135087826-135087848 GGCGCGCGGGGCGGCGGCGGCGG + Exonic
1062435716 9:136545824-136545846 GCCCCGCCGGCCAGCGCAGGAGG - Exonic
1185642736 X:1597515-1597537 GCCGAGCAGGACAGCTGGGGTGG + Intronic
1186108015 X:6227106-6227128 GCCGCGCGGGAATTGGGAGGCGG + Intronic
1187915429 X:24149409-24149431 GGCGGGCGGGAGCGCGGAGGAGG + Intronic
1195625330 X:107000316-107000338 GCCGAGCGGGAAAGCGCGGGGGG + Intergenic
1198683352 X:139204329-139204351 GCCGCTCGGGATCGCGGCGGCGG - Intronic