ID: 1142206614

View in Genome Browser
Species Human (GRCh38)
Location 16:88785774-88785796
Sequence CACCGCGCGCGGCTTTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142206608_1142206614 -9 Left 1142206608 16:88785760-88785782 CCAGCCACGCCGGCCACCGCGCG No data
Right 1142206614 16:88785774-88785796 CACCGCGCGCGGCTTTGCCCGGG No data
1142206601_1142206614 25 Left 1142206601 16:88785726-88785748 CCGCGTTGGTCTGACGGGGGCTC No data
Right 1142206614 16:88785774-88785796 CACCGCGCGCGGCTTTGCCCGGG No data
1142206607_1142206614 -8 Left 1142206607 16:88785759-88785781 CCCAGCCACGCCGGCCACCGCGC No data
Right 1142206614 16:88785774-88785796 CACCGCGCGCGGCTTTGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142206614 Original CRISPR CACCGCGCGCGGCTTTGCCC GGG Intergenic
No off target data available for this crispr