ID: 1142207455

View in Genome Browser
Species Human (GRCh38)
Location 16:88790944-88790966
Sequence AGGAGGGGGTTGAGGCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142207455_1142207469 21 Left 1142207455 16:88790944-88790966 CCCAGGAGCCTCAACCCCCTCCT No data
Right 1142207469 16:88790988-88791010 GCCTGCTGCTGCTCAGAGGAGGG No data
1142207455_1142207468 20 Left 1142207455 16:88790944-88790966 CCCAGGAGCCTCAACCCCCTCCT No data
Right 1142207468 16:88790987-88791009 TGCCTGCTGCTGCTCAGAGGAGG No data
1142207455_1142207466 17 Left 1142207455 16:88790944-88790966 CCCAGGAGCCTCAACCCCCTCCT No data
Right 1142207466 16:88790984-88791006 TCCTGCCTGCTGCTGCTCAGAGG No data
1142207455_1142207463 -6 Left 1142207455 16:88790944-88790966 CCCAGGAGCCTCAACCCCCTCCT No data
Right 1142207463 16:88790961-88790983 CCTCCTCGCCTGTAAAGCAAGGG No data
1142207455_1142207461 -7 Left 1142207455 16:88790944-88790966 CCCAGGAGCCTCAACCCCCTCCT No data
Right 1142207461 16:88790960-88790982 CCCTCCTCGCCTGTAAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142207455 Original CRISPR AGGAGGGGGTTGAGGCTCCT GGG (reversed) Intergenic