ID: 1142207456

View in Genome Browser
Species Human (GRCh38)
Location 16:88790945-88790967
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142207456_1142207461 -8 Left 1142207456 16:88790945-88790967 CCAGGAGCCTCAACCCCCTCCTC No data
Right 1142207461 16:88790960-88790982 CCCTCCTCGCCTGTAAAGCAAGG No data
1142207456_1142207463 -7 Left 1142207456 16:88790945-88790967 CCAGGAGCCTCAACCCCCTCCTC No data
Right 1142207463 16:88790961-88790983 CCTCCTCGCCTGTAAAGCAAGGG No data
1142207456_1142207468 19 Left 1142207456 16:88790945-88790967 CCAGGAGCCTCAACCCCCTCCTC No data
Right 1142207468 16:88790987-88791009 TGCCTGCTGCTGCTCAGAGGAGG No data
1142207456_1142207466 16 Left 1142207456 16:88790945-88790967 CCAGGAGCCTCAACCCCCTCCTC No data
Right 1142207466 16:88790984-88791006 TCCTGCCTGCTGCTGCTCAGAGG No data
1142207456_1142207469 20 Left 1142207456 16:88790945-88790967 CCAGGAGCCTCAACCCCCTCCTC No data
Right 1142207469 16:88790988-88791010 GCCTGCTGCTGCTCAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142207456 Original CRISPR GAGGAGGGGGTTGAGGCTCC TGG (reversed) Intergenic
No off target data available for this crispr