ID: 1142207459

View in Genome Browser
Species Human (GRCh38)
Location 16:88790959-88790981
Sequence CTTGCTTTACAGGCGAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142207459_1142207469 6 Left 1142207459 16:88790959-88790981 CCCCTCCTCGCCTGTAAAGCAAG No data
Right 1142207469 16:88790988-88791010 GCCTGCTGCTGCTCAGAGGAGGG No data
1142207459_1142207468 5 Left 1142207459 16:88790959-88790981 CCCCTCCTCGCCTGTAAAGCAAG No data
Right 1142207468 16:88790987-88791009 TGCCTGCTGCTGCTCAGAGGAGG No data
1142207459_1142207466 2 Left 1142207459 16:88790959-88790981 CCCCTCCTCGCCTGTAAAGCAAG No data
Right 1142207466 16:88790984-88791006 TCCTGCCTGCTGCTGCTCAGAGG No data
1142207459_1142207471 27 Left 1142207459 16:88790959-88790981 CCCCTCCTCGCCTGTAAAGCAAG No data
Right 1142207471 16:88791009-88791031 GGTTGAGTGAGACACCCGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142207459 Original CRISPR CTTGCTTTACAGGCGAGGAG GGG (reversed) Intergenic
No off target data available for this crispr