ID: 1142207461

View in Genome Browser
Species Human (GRCh38)
Location 16:88790960-88790982
Sequence CCCTCCTCGCCTGTAAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142207454_1142207461 -6 Left 1142207454 16:88790943-88790965 CCCCAGGAGCCTCAACCCCCTCC No data
Right 1142207461 16:88790960-88790982 CCCTCCTCGCCTGTAAAGCAAGG No data
1142207455_1142207461 -7 Left 1142207455 16:88790944-88790966 CCCAGGAGCCTCAACCCCCTCCT No data
Right 1142207461 16:88790960-88790982 CCCTCCTCGCCTGTAAAGCAAGG No data
1142207456_1142207461 -8 Left 1142207456 16:88790945-88790967 CCAGGAGCCTCAACCCCCTCCTC No data
Right 1142207461 16:88790960-88790982 CCCTCCTCGCCTGTAAAGCAAGG No data
1142207452_1142207461 21 Left 1142207452 16:88790916-88790938 CCTTGAGGTCTTGGATAAGCTAC No data
Right 1142207461 16:88790960-88790982 CCCTCCTCGCCTGTAAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142207461 Original CRISPR CCCTCCTCGCCTGTAAAGCA AGG Intergenic
No off target data available for this crispr