ID: 1142207465

View in Genome Browser
Species Human (GRCh38)
Location 16:88790969-88790991
Sequence AGGCAGGACCCTTGCTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142207465_1142207468 -5 Left 1142207465 16:88790969-88790991 CCTGTAAAGCAAGGGTCCTGCCT No data
Right 1142207468 16:88790987-88791009 TGCCTGCTGCTGCTCAGAGGAGG No data
1142207465_1142207466 -8 Left 1142207465 16:88790969-88790991 CCTGTAAAGCAAGGGTCCTGCCT No data
Right 1142207466 16:88790984-88791006 TCCTGCCTGCTGCTGCTCAGAGG No data
1142207465_1142207473 29 Left 1142207465 16:88790969-88790991 CCTGTAAAGCAAGGGTCCTGCCT No data
Right 1142207473 16:88791021-88791043 CACCCGCGTGGAACACACCTGGG No data
1142207465_1142207472 28 Left 1142207465 16:88790969-88790991 CCTGTAAAGCAAGGGTCCTGCCT No data
Right 1142207472 16:88791020-88791042 ACACCCGCGTGGAACACACCTGG No data
1142207465_1142207469 -4 Left 1142207465 16:88790969-88790991 CCTGTAAAGCAAGGGTCCTGCCT No data
Right 1142207469 16:88790988-88791010 GCCTGCTGCTGCTCAGAGGAGGG No data
1142207465_1142207471 17 Left 1142207465 16:88790969-88790991 CCTGTAAAGCAAGGGTCCTGCCT No data
Right 1142207471 16:88791009-88791031 GGTTGAGTGAGACACCCGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142207465 Original CRISPR AGGCAGGACCCTTGCTTTAC AGG (reversed) Intergenic