ID: 1142207466

View in Genome Browser
Species Human (GRCh38)
Location 16:88790984-88791006
Sequence TCCTGCCTGCTGCTGCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142207465_1142207466 -8 Left 1142207465 16:88790969-88790991 CCTGTAAAGCAAGGGTCCTGCCT No data
Right 1142207466 16:88790984-88791006 TCCTGCCTGCTGCTGCTCAGAGG No data
1142207454_1142207466 18 Left 1142207454 16:88790943-88790965 CCCCAGGAGCCTCAACCCCCTCC No data
Right 1142207466 16:88790984-88791006 TCCTGCCTGCTGCTGCTCAGAGG No data
1142207455_1142207466 17 Left 1142207455 16:88790944-88790966 CCCAGGAGCCTCAACCCCCTCCT No data
Right 1142207466 16:88790984-88791006 TCCTGCCTGCTGCTGCTCAGAGG No data
1142207458_1142207466 3 Left 1142207458 16:88790958-88790980 CCCCCTCCTCGCCTGTAAAGCAA No data
Right 1142207466 16:88790984-88791006 TCCTGCCTGCTGCTGCTCAGAGG No data
1142207459_1142207466 2 Left 1142207459 16:88790959-88790981 CCCCTCCTCGCCTGTAAAGCAAG No data
Right 1142207466 16:88790984-88791006 TCCTGCCTGCTGCTGCTCAGAGG No data
1142207464_1142207466 -3 Left 1142207464 16:88790964-88790986 CCTCGCCTGTAAAGCAAGGGTCC No data
Right 1142207466 16:88790984-88791006 TCCTGCCTGCTGCTGCTCAGAGG No data
1142207462_1142207466 0 Left 1142207462 16:88790961-88790983 CCTCCTCGCCTGTAAAGCAAGGG No data
Right 1142207466 16:88790984-88791006 TCCTGCCTGCTGCTGCTCAGAGG No data
1142207457_1142207466 9 Left 1142207457 16:88790952-88790974 CCTCAACCCCCTCCTCGCCTGTA No data
Right 1142207466 16:88790984-88791006 TCCTGCCTGCTGCTGCTCAGAGG No data
1142207460_1142207466 1 Left 1142207460 16:88790960-88790982 CCCTCCTCGCCTGTAAAGCAAGG No data
Right 1142207466 16:88790984-88791006 TCCTGCCTGCTGCTGCTCAGAGG No data
1142207456_1142207466 16 Left 1142207456 16:88790945-88790967 CCAGGAGCCTCAACCCCCTCCTC No data
Right 1142207466 16:88790984-88791006 TCCTGCCTGCTGCTGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142207466 Original CRISPR TCCTGCCTGCTGCTGCTCAG AGG Intergenic
No off target data available for this crispr