ID: 1142207470

View in Genome Browser
Species Human (GRCh38)
Location 16:88790989-88791011
Sequence ACCCTCCTCTGAGCAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142207470_1142207473 9 Left 1142207470 16:88790989-88791011 CCTGCTGCTGCTCAGAGGAGGGT No data
Right 1142207473 16:88791021-88791043 CACCCGCGTGGAACACACCTGGG No data
1142207470_1142207471 -3 Left 1142207470 16:88790989-88791011 CCTGCTGCTGCTCAGAGGAGGGT No data
Right 1142207471 16:88791009-88791031 GGTTGAGTGAGACACCCGCGTGG No data
1142207470_1142207472 8 Left 1142207470 16:88790989-88791011 CCTGCTGCTGCTCAGAGGAGGGT No data
Right 1142207472 16:88791020-88791042 ACACCCGCGTGGAACACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142207470 Original CRISPR ACCCTCCTCTGAGCAGCAGC AGG (reversed) Intergenic
No off target data available for this crispr