ID: 1142207471

View in Genome Browser
Species Human (GRCh38)
Location 16:88791009-88791031
Sequence GGTTGAGTGAGACACCCGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142207458_1142207471 28 Left 1142207458 16:88790958-88790980 CCCCCTCCTCGCCTGTAAAGCAA No data
Right 1142207471 16:88791009-88791031 GGTTGAGTGAGACACCCGCGTGG No data
1142207464_1142207471 22 Left 1142207464 16:88790964-88790986 CCTCGCCTGTAAAGCAAGGGTCC No data
Right 1142207471 16:88791009-88791031 GGTTGAGTGAGACACCCGCGTGG No data
1142207467_1142207471 1 Left 1142207467 16:88790985-88791007 CCTGCCTGCTGCTGCTCAGAGGA No data
Right 1142207471 16:88791009-88791031 GGTTGAGTGAGACACCCGCGTGG No data
1142207459_1142207471 27 Left 1142207459 16:88790959-88790981 CCCCTCCTCGCCTGTAAAGCAAG No data
Right 1142207471 16:88791009-88791031 GGTTGAGTGAGACACCCGCGTGG No data
1142207460_1142207471 26 Left 1142207460 16:88790960-88790982 CCCTCCTCGCCTGTAAAGCAAGG No data
Right 1142207471 16:88791009-88791031 GGTTGAGTGAGACACCCGCGTGG No data
1142207465_1142207471 17 Left 1142207465 16:88790969-88790991 CCTGTAAAGCAAGGGTCCTGCCT No data
Right 1142207471 16:88791009-88791031 GGTTGAGTGAGACACCCGCGTGG No data
1142207470_1142207471 -3 Left 1142207470 16:88790989-88791011 CCTGCTGCTGCTCAGAGGAGGGT No data
Right 1142207471 16:88791009-88791031 GGTTGAGTGAGACACCCGCGTGG No data
1142207462_1142207471 25 Left 1142207462 16:88790961-88790983 CCTCCTCGCCTGTAAAGCAAGGG No data
Right 1142207471 16:88791009-88791031 GGTTGAGTGAGACACCCGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142207471 Original CRISPR GGTTGAGTGAGACACCCGCG TGG Intergenic
No off target data available for this crispr