ID: 1142207473 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:88791021-88791043 |
Sequence | CACCCGCGTGGAACACACCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1142207470_1142207473 | 9 | Left | 1142207470 | 16:88790989-88791011 | CCTGCTGCTGCTCAGAGGAGGGT | No data | ||
Right | 1142207473 | 16:88791021-88791043 | CACCCGCGTGGAACACACCTGGG | No data | ||||
1142207465_1142207473 | 29 | Left | 1142207465 | 16:88790969-88790991 | CCTGTAAAGCAAGGGTCCTGCCT | No data | ||
Right | 1142207473 | 16:88791021-88791043 | CACCCGCGTGGAACACACCTGGG | No data | ||||
1142207467_1142207473 | 13 | Left | 1142207467 | 16:88790985-88791007 | CCTGCCTGCTGCTGCTCAGAGGA | No data | ||
Right | 1142207473 | 16:88791021-88791043 | CACCCGCGTGGAACACACCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1142207473 | Original CRISPR | CACCCGCGTGGAACACACCT GGG | Intergenic | ||