ID: 1142207875

View in Genome Browser
Species Human (GRCh38)
Location 16:88792556-88792578
Sequence TGGGAGCAACAAAGGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142207862_1142207875 26 Left 1142207862 16:88792507-88792529 CCCTGCGTGGGTGGCTGGGTGGC No data
Right 1142207875 16:88792556-88792578 TGGGAGCAACAAAGGGAGAAAGG No data
1142207871_1142207875 -8 Left 1142207871 16:88792541-88792563 CCCTGGGGCTCTGGTTGGGAGCA No data
Right 1142207875 16:88792556-88792578 TGGGAGCAACAAAGGGAGAAAGG No data
1142207863_1142207875 25 Left 1142207863 16:88792508-88792530 CCTGCGTGGGTGGCTGGGTGGCG No data
Right 1142207875 16:88792556-88792578 TGGGAGCAACAAAGGGAGAAAGG No data
1142207872_1142207875 -9 Left 1142207872 16:88792542-88792564 CCTGGGGCTCTGGTTGGGAGCAA No data
Right 1142207875 16:88792556-88792578 TGGGAGCAACAAAGGGAGAAAGG No data
1142207867_1142207875 1 Left 1142207867 16:88792532-88792554 CCTCTCATGCCCTGGGGCTCTGG No data
Right 1142207875 16:88792556-88792578 TGGGAGCAACAAAGGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142207875 Original CRISPR TGGGAGCAACAAAGGGAGAA AGG Intergenic
No off target data available for this crispr