ID: 1142209871

View in Genome Browser
Species Human (GRCh38)
Location 16:88803925-88803947
Sequence GCGCGGAGTGCGGGCCTGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 412}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142209871_1142209878 -2 Left 1142209871 16:88803925-88803947 CCCGCCAGGCCCGCACTCCGCGC 0: 1
1: 0
2: 3
3: 40
4: 412
Right 1142209878 16:88803946-88803968 GCCCCGGCCTCCGCTACCAGTGG 0: 1
1: 0
2: 0
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142209871 Original CRISPR GCGCGGAGTGCGGGCCTGGC GGG (reversed) Exonic
900120112 1:1045247-1045269 GCCCGGGGCGTGGGCCTGGCTGG + Exonic
900342627 1:2195942-2195964 GCGCTGAGTGCTGCCCGGGCAGG + Intronic
900479688 1:2891980-2892002 CAACGGAGCGCGGGCCTGGCGGG + Intergenic
900623718 1:3598785-3598807 TCAGGGAGTGTGGGCCTGGCAGG + Intronic
901441355 1:9280387-9280409 GCGGGGAGTGGGGGCGGGGCGGG - Intergenic
901441365 1:9280405-9280427 GCGGGGAGTGGGGGCGGGGCGGG - Intergenic
901441375 1:9280423-9280445 GCGGGGAGTGGGGGCGGGGCGGG - Intergenic
901783412 1:11609101-11609123 GCGCATGGTGCGGGACTGGCAGG + Intergenic
901791298 1:11654839-11654861 GCGCGGGGGCGGGGCCTGGCGGG + Exonic
901908244 1:12433132-12433154 GTGCTGAGAGCCGGCCTGGCTGG + Intronic
902032550 1:13433822-13433844 GCGCAAGGTGCGGGACTGGCAGG - Intergenic
902033512 1:13439632-13439654 GCGCAGGGCGCGGGACTGGCAGG + Intergenic
902404540 1:16175559-16175581 GGGCTCGGTGCGGGCCTGGCAGG + Intergenic
903281596 1:22253117-22253139 GCCCTGAGGTCGGGCCTGGCCGG + Intergenic
903413788 1:23168154-23168176 GCGCGGGCCGCGGGCCGGGCGGG - Intronic
904215336 1:28914535-28914557 GGGCGGGCTGCGGGCCGGGCTGG + Intronic
905449372 1:38046903-38046925 GCGCGGGGCGGGGGCCGGGCAGG - Intergenic
905643991 1:39611813-39611835 GCACGCAGTGCGGGACTGGTGGG - Intergenic
905742968 1:40388237-40388259 GCGCACAGCGCGGGACTGGCGGG + Intronic
906109282 1:43312470-43312492 GAGGGCAGTGCGGGCCTGGGGGG - Exonic
906520907 1:46466497-46466519 GGGCGGGGCGGGGGCCTGGCGGG - Intergenic
906563442 1:46778493-46778515 GCGCATGGTGCGGGACTGGCAGG - Intronic
907759439 1:57343425-57343447 GCGCACGGTGCGGGACTGGCAGG - Intronic
909608665 1:77531738-77531760 GCGCAGGGCGCGGGACTGGCAGG - Intronic
910772136 1:90841540-90841562 GAGCGGAGCCTGGGCCTGGCGGG - Intergenic
911854026 1:102854177-102854199 ACGCGCGGTGCGGGACTGGCGGG + Intergenic
912798598 1:112707166-112707188 GCGGGGAGGGCGGGCCCGGCAGG + Intronic
914824755 1:151132761-151132783 GCGGAGAGCGCGGGCCGGGCGGG + Exonic
916048897 1:161021177-161021199 GCGCGGAGGGCGGGGCCGGGCGG - Exonic
917027762 1:170661604-170661626 GCGCACAGTGCGGCGCTGGCAGG + Intergenic
918519869 1:185403932-185403954 GCACAGAATGGGGGCCTGGCAGG - Intergenic
918720904 1:187850587-187850609 GCGCATGGTGCGGGACTGGCAGG + Intergenic
920367726 1:205456917-205456939 GCGCGGAGGGCGGGGTGGGCCGG - Intergenic
921051670 1:211515639-211515661 GAGCGGCGGGCTGGCCTGGCGGG + Intergenic
921396309 1:214673122-214673144 GCGCACAGCGCGGGACTGGCAGG - Intergenic
921903861 1:220475957-220475979 GCTCCGAGTGCGGGGCCGGCCGG + Intergenic
922440530 1:225652654-225652676 GCGCGGGGCGGGGGCCGGGCGGG - Intronic
922460253 1:225810184-225810206 CCGGGGAGTGCGGGCCCGGCCGG - Intronic
923631354 1:235650628-235650650 CCCCGGAGTGGGGGCCTCGCCGG - Intronic
924436758 1:244049103-244049125 GGGCGGAGGGCGGGCCGGGTCGG + Intronic
1064086231 10:12348803-12348825 GAGCGGCCGGCGGGCCTGGCCGG - Intergenic
1066234117 10:33468418-33468440 GCGCAGGGTGCAGGACTGGCAGG + Intergenic
1067560371 10:47300763-47300785 GCGGGCAGTGCGGACCAGGCGGG - Exonic
1068216752 10:53991197-53991219 GCGCGCGGTGCGGGACTGGCAGG + Intronic
1068455600 10:57250225-57250247 GCGCATGGTGCGGGACTGGCAGG + Intergenic
1068554889 10:58448240-58448262 GCGCACAGCGCGGGACTGGCGGG - Intergenic
1070599113 10:77853568-77853590 GCGGGGTGTGAGGGGCTGGCTGG - Intronic
1071333288 10:84582355-84582377 GCACGGAGTGCGGGCTGGCCAGG + Intergenic
1073532587 10:104245558-104245580 GCGCACAGTGCAGGACTGGCAGG + Intronic
1074618309 10:115092943-115092965 GCGCGGGGTGCGGGTGGGGCCGG + Intergenic
1074996273 10:118760122-118760144 GCGCAGGGCGCGGGACTGGCAGG - Intergenic
1076752601 10:132551106-132551128 GCCCAGAGTGCGAGCCTGGTGGG + Intronic
1076773685 10:132681039-132681061 GCGCACAGCGCGGGACTGGCAGG + Intronic
1076775228 10:132691937-132691959 GGGAGGCGTGCGGTCCTGGCAGG + Intronic
1076796463 10:132800920-132800942 GCGCACAGCGCGGGACTGGCAGG - Intergenic
1076814526 10:132908259-132908281 GCAGGGAGCGCGGGCCTGGGCGG - Intronic
1077038576 11:507299-507321 GCGCGGGGGCGGGGCCTGGCGGG + Intronic
1077063326 11:627042-627064 GGGGGGCGGGCGGGCCTGGCGGG + Intronic
1077214541 11:1389984-1390006 GCGCGGGGCGCGGGCCTCGGCGG + Intronic
1077360429 11:2138202-2138224 GCGGCGTGTGCGGGCCGGGCCGG - Intronic
1077474151 11:2778534-2778556 GTGGGGAGTGGGGGCCTGGTGGG - Intronic
1077495274 11:2884206-2884228 GCGCGGGGCGCGGGCCGGCCGGG + Intronic
1079005966 11:16791165-16791187 TCGGGGAGTGGGGGCCTGGGAGG + Exonic
1079353522 11:19712910-19712932 GCGCGGCTGGCGGGCCGGGCAGG - Intronic
1081428457 11:42950271-42950293 GCGCACAGTGCGGGACTGGCAGG + Intergenic
1081805003 11:45885704-45885726 CCGCGGAGTTCGGGCTAGGCGGG - Exonic
1084186714 11:67476438-67476460 GCGCACGGTGCGGGACTGGCAGG + Intergenic
1086200360 11:84194786-84194808 GCGCAGGGTGTGGGACTGGCAGG - Intronic
1086484719 11:87286495-87286517 GCGCGCAGCACGGGACTGGCAGG - Intronic
1086808090 11:91269141-91269163 GCGCAGGGCGCGGGCCTGGCAGG + Intergenic
1087977190 11:104564927-104564949 GCGCGCAGCACGGGACTGGCGGG - Intergenic
1088481644 11:110300911-110300933 GCGCACGGTGCGGGACTGGCAGG - Intergenic
1089602369 11:119623812-119623834 GCGCTGCTTGCAGGCCTGGCGGG - Intronic
1089618018 11:119706100-119706122 GAGAGGAGCGAGGGCCTGGCTGG - Intronic
1089842114 11:121427345-121427367 GCGAGGTGGGCGGGCCGGGCTGG - Intergenic
1092135271 12:6142582-6142604 GCGCACAGCGCGGGACTGGCAGG + Intergenic
1092221471 12:6716421-6716443 GCGCACAGCGCGGGACTGGCAGG + Intergenic
1092583765 12:9876146-9876168 GCGCAGGGCGCGGGACTGGCAGG - Intergenic
1093189475 12:16057760-16057782 GCGCAGGGCGCGGGACTGGCAGG + Intergenic
1093728705 12:22544204-22544226 GCGCCGAGCGCGGGGCCGGCGGG + Intronic
1095123161 12:38442334-38442356 GCGCACAGTGCAGGACTGGCAGG + Intergenic
1099204431 12:79711326-79711348 GCACGGCGCGCGGGACTGGCAGG + Intergenic
1099523872 12:83696270-83696292 GCGCACAGCGCGGGACTGGCAGG - Intergenic
1100521526 12:95379970-95379992 GCGCAAGGTGCGGGACTGGCAGG + Intronic
1102952162 12:117038183-117038205 GCGGGGAGTCAGGGCCTGGCTGG - Intergenic
1103510052 12:121467618-121467640 CCGCGGCGCGCGGGCCAGGCCGG - Intronic
1103856155 12:123972629-123972651 GCGCGGCGGGCGGGGCTGCCTGG + Exonic
1105071420 12:133236151-133236173 GCGCGGGGTGCGGGGTTGGTGGG + Intergenic
1105605097 13:21920677-21920699 GCGCACAGTGCGGGACTGGCAGG - Intergenic
1106956275 13:34942468-34942490 CCGCGGGGGGCGGGCCGGGCCGG + Exonic
1108751468 13:53452369-53452391 GCGCGCAGCGCGGGACTGGCAGG - Intergenic
1109145461 13:58773657-58773679 GCGCACAGTGCGGGACTGGCAGG + Intergenic
1109446538 13:62447874-62447896 GCGCACAGCGCGGGACTGGCAGG - Intergenic
1111556107 13:89883841-89883863 GCGCACGGTGCGGGACTGGCAGG - Intergenic
1111841342 13:93454761-93454783 GCGCAGGGCGCGGGACTGGCAGG - Intronic
1112290726 13:98142850-98142872 GCGCGGAGCCCGGCCCTGGCCGG + Intronic
1113312046 13:109141012-109141034 GCGCGGGGGGCGGCCCGGGCGGG - Exonic
1113567255 13:111326472-111326494 GCGGGCAGTGCGAGCCTGTCTGG + Intronic
1113567284 13:111326599-111326621 GCGGGCAGTGCGAGCCTGTCTGG + Intronic
1113768381 13:112894436-112894458 GCGCGGGGCGGGGGCCTGGAGGG + Intronic
1113806081 13:113110546-113110568 GCGCTGCTCGCGGGCCTGGCTGG - Intronic
1113841491 13:113363990-113364012 GCGCGGGGTGCGGGCGTCCCCGG - Intronic
1114224180 14:20723422-20723444 GCGCGGGGTTCGGGCCGGGCGGG - Intergenic
1115174520 14:30547483-30547505 GCGTGCAGTGCGGGACTGGTAGG - Intergenic
1115855054 14:37622234-37622256 GCGCGCGGGGCGGGCCGGGCCGG - Intronic
1116452433 14:45080821-45080843 GCGCAGGGCGCGGGACTGGCGGG + Intergenic
1118737541 14:68712879-68712901 GTGCGGTGTGCGGGCCGGGCCGG - Intronic
1119469027 14:74882093-74882115 GCGCGGCGCGCCGGCCGGGCCGG + Intronic
1120789082 14:88562976-88562998 GCGCGCAGTGCCGGCCGGGGCGG + Exonic
1121616963 14:95319838-95319860 GCGCGGAGAGCCTGGCTGGCGGG + Exonic
1122162198 14:99793054-99793076 GCGCGGCGGGCGGCCCTTGCGGG - Intronic
1122409717 14:101519670-101519692 GCGCGGAGGAAGGGCCTGGCTGG + Intergenic
1122940260 14:104978079-104978101 GCGCGCAGTGCGGGCCTTGGGGG - Intronic
1122975343 14:105168584-105168606 CCGCGGCGCGCGGGCCTGGGCGG + Exonic
1123048247 14:105528614-105528636 GCGCGGAGACCGCGCCTGGTGGG + Intronic
1123825513 15:24078411-24078433 GCGTGCAGTGCAGGACTGGCGGG - Intergenic
1124427018 15:29570863-29570885 GCGCCGGGAGCGGGCCGGGCCGG + Intergenic
1124629336 15:31327874-31327896 GCGCGAGGTGGGGGCCGGGCGGG + Intronic
1125362342 15:38877367-38877389 GGGAGGAGAGCAGGCCTGGCAGG + Intergenic
1125510786 15:40291371-40291393 GCGCGGAGCGCGGCGCTGGGAGG - Exonic
1128212439 15:65912100-65912122 GTCCAGAGTGCTGGCCTGGCTGG + Intronic
1128992524 15:72272584-72272606 GGGCGGGGGCCGGGCCTGGCGGG + Exonic
1129144247 15:73633093-73633115 GCGCCGGGGGCGGGCCGGGCGGG - Intronic
1129777434 15:78246112-78246134 GCGCACAGCGCGGGACTGGCAGG - Intergenic
1129986340 15:79923024-79923046 CCGCCGAGAGCGGACCTGGCTGG + Intronic
1130362797 15:83207132-83207154 TGGCGGAGTGCGGGCGAGGCCGG + Intronic
1130868655 15:87952939-87952961 ACGCGGAGGGCCGGCGTGGCTGG - Intronic
1132544786 16:528079-528101 GCGGGGAGCGCGGGCCCGGAGGG + Intronic
1132544797 16:528104-528126 GCGGGGAGCGCGGGCTCGGCGGG + Intronic
1132942338 16:2514372-2514394 GCAGGGCGTGCGGGCCTGGCCGG + Intronic
1132947278 16:2538373-2538395 GCGCGGAGGGCGGGGGAGGCCGG + Intronic
1132968438 16:2673083-2673105 GCGCGGAGGGCGGGGGAGGCCGG - Intergenic
1133814213 16:9184175-9184197 GCGCGCTGTGCGGGACTGGTAGG - Intergenic
1134290768 16:12901761-12901783 GCGCGGGGTGCAGGTCCGGCCGG - Exonic
1135656587 16:24255870-24255892 GCGCGGAGAGTGGGCTTGACTGG + Exonic
1136368258 16:29819692-29819714 GATCGGAGTGGGGGGCTGGCGGG - Exonic
1136566474 16:31073552-31073574 GCGCCGAGGGCGGGCCGGGTTGG - Intronic
1137729513 16:50679515-50679537 GCACGGAGCAGGGGCCTGGCTGG + Intronic
1138516269 16:57536739-57536761 GCGAGGGGTGCGGGCCGGGGCGG + Intergenic
1140096901 16:71883667-71883689 GCGCGGGGTGCGGGGCCGGGGGG - Intronic
1141518575 16:84562698-84562720 GCCCAGGGTGCGGCCCTGGCTGG - Intergenic
1141735157 16:85847297-85847319 GCGCGGGGTGCCGGCCTGCTGGG + Intergenic
1142150642 16:88511149-88511171 GCTCTGAGGGCGGGCCTGTCAGG - Intronic
1142209871 16:88803925-88803947 GCGCGGAGTGCGGGCCTGGCGGG - Exonic
1142747183 17:1965731-1965753 GAGGGCAGTGGGGGCCTGGCGGG - Intronic
1142828747 17:2532106-2532128 GCGCAGGGCGCGGGACTGGCAGG - Intergenic
1143102344 17:4511420-4511442 GGCCGGAGGGCGGGGCTGGCAGG + Intronic
1143460447 17:7100567-7100589 GCGCAGGGCGCGGGACTGGCAGG - Intergenic
1143620863 17:8079654-8079676 ACGCGGGGTGCGGGCTTGCCTGG + Intronic
1143732171 17:8887388-8887410 GCAGGGAGTGAGGGCCAGGCAGG + Intronic
1144634092 17:16893026-16893048 GCGCTGGGTGGGGGCCTGGTCGG + Intergenic
1144953020 17:19004200-19004222 GCGGGGAGGGCGGGCCGCGCGGG + Intronic
1145094906 17:20016810-20016832 GCGCAGGGCGCGGGACTGGCAGG + Intronic
1145168194 17:20632867-20632889 GCGCTGAGTGGGGGTCTGGCCGG + Intergenic
1145963770 17:28902758-28902780 GCGCGGAGAGGAGGCCGGGCCGG - Intronic
1146164278 17:30575836-30575858 GCACTGAGTAGGGGCCTGGCCGG + Intergenic
1146401348 17:32502401-32502423 GCGGGGAGTGGGGGCGTGGAGGG + Intronic
1146716293 17:35089319-35089341 GCGCGGAGGGCGGGAGCGGCCGG - Exonic
1148018459 17:44538741-44538763 GTGGGGAGTGCAGGCCTGGCTGG + Intergenic
1148818408 17:50346575-50346597 GCGCGGCGAGCGGGGCTGGGAGG + Intronic
1149296232 17:55264876-55264898 GCGGGGCGAGCGGGCCAGGCGGG + Intergenic
1150106727 17:62467739-62467761 GCCCAGAGTGAGGGCCTGGAGGG + Intronic
1150775883 17:68081000-68081022 GCGCACAGCGCGGGACTGGCAGG + Intergenic
1150804540 17:68308887-68308909 GCGCAGGGCGCGGGACTGGCAGG - Intronic
1151402788 17:73866846-73866868 GCGCTGGGTTCAGGCCTGGCAGG + Intergenic
1151890413 17:76947964-76947986 GCACGCCCTGCGGGCCTGGCTGG + Exonic
1152095150 17:78268305-78268327 GCGCAGAGTGGGGGGCTGGGAGG - Intergenic
1152233075 17:79124716-79124738 GGGTGGAGAGCGGGCCTGGCAGG - Intronic
1152728575 17:81959376-81959398 GTGCGGGGTGGGGGCCTGGCTGG + Intronic
1152778893 17:82217838-82217860 GCGGGGCCTGCGGTCCTGGCCGG + Intergenic
1152821586 17:82440282-82440304 GCGCGGAGAGCGGGACCCGCAGG + Intronic
1154041363 18:10859412-10859434 GGGCAGAGTGCGTGCGTGGCAGG - Intronic
1154255240 18:12776821-12776843 GCGCAGTGCGCGGGACTGGCAGG - Intergenic
1154294044 18:13134659-13134681 GCGCAGGGCGCGGGACTGGCGGG - Intergenic
1156459464 18:37313629-37313651 CTGTGGAGTGCGGGCCTGGGTGG - Intronic
1157661892 18:49452743-49452765 GCGCACAGCGCGGGACTGGCAGG + Intronic
1157849107 18:51030653-51030675 GCGGGGTGCGCGGGCCCGGCCGG - Intronic
1158460669 18:57643634-57643656 GTGCAGGGTGCGGGACTGGCAGG - Intergenic
1160256012 18:77249710-77249732 CTGCGGAGTGCGGACCTGCCCGG - Intergenic
1160378316 18:78430164-78430186 GCGCGGAGGGCTGGGCTGGGAGG - Intergenic
1160538061 18:79605815-79605837 GTGAGGAGTGCAGACCTGGCAGG - Intergenic
1160682170 19:416919-416941 AGGCGGATTCCGGGCCTGGCTGG - Exonic
1160887124 19:1355183-1355205 GCGAGGAGGCCGGGCCTGGGGGG + Intronic
1160973070 19:1778508-1778530 GGCCGGAGCACGGGCCTGGCGGG + Exonic
1161021936 19:2014905-2014927 GCCCAGAGTGCAGGCCTGGTGGG + Intronic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161095000 19:2385153-2385175 TCGCGGAGGGCGGGGCTCGCGGG + Intergenic
1161104627 19:2437143-2437165 GCAGGGAGTGTGGGCCCGGCCGG + Intronic
1161256877 19:3314696-3314718 GACCGGAGTGCGGGCTGGGCCGG - Intergenic
1161293075 19:3506229-3506251 GCGCGGCGTGGGGGCGTGGTCGG + Intergenic
1161664644 19:5568008-5568030 GGGCGGAGCGCGGGCGCGGCGGG - Intergenic
1162987166 19:14277992-14278014 GCGCACAGCGCGGGACTGGCAGG + Intergenic
1163651719 19:18521764-18521786 GCGCGGAGTGGGCGCCAGTCCGG - Intronic
1163693607 19:18751026-18751048 CCTTGGAGTGGGGGCCTGGCAGG + Intronic
1164143964 19:22498963-22498985 GCGCACAGCGCGGGACTGGCAGG - Intronic
1164638953 19:29811450-29811472 GCGGGGAGGGCGTGCCTGGCGGG + Intergenic
1164834679 19:31349635-31349657 GCGCGGGGTTCGGGGCTGGGGGG + Intergenic
1164839465 19:31381438-31381460 GCAGGGATTCCGGGCCTGGCAGG - Intergenic
1165433905 19:35786742-35786764 GCGGGGGGTGCTGGGCTGGCGGG - Intronic
1165739838 19:38198553-38198575 GGACGGGGTGGGGGCCTGGCGGG - Intronic
1166044742 19:40223349-40223371 ACGCGGGGTGGGGGCGTGGCCGG - Intronic
1166372456 19:42309873-42309895 GCGGGGAGTGTGGGGCTGCCTGG - Exonic
1166385026 19:42376004-42376026 CCGCGGCGTGCGGGACCGGCTGG + Exonic
1166734497 19:45076132-45076154 GCGAGGAGGGCGGCCCCGGCGGG + Exonic
1166785291 19:45363703-45363725 GCGCGGGGTGGGGGCCCGGCAGG - Intronic
1166809404 19:45506823-45506845 GCGAGGAGTGCGGGAGTGGGGGG - Intronic
1166861713 19:45815298-45815320 GCGCGGGGAGCGGGCCAGGGTGG + Exonic
1167521458 19:49958476-49958498 GCGCAGAGAGGGGGCCGGGCTGG + Exonic
1167756147 19:51415014-51415036 GCGCAGAGAGGGGGCCGGGCTGG + Exonic
1168257600 19:55175198-55175220 GCGGCCAGTGCAGGCCTGGCGGG - Exonic
1168301159 19:55405944-55405966 GTGAGGAGAGCCGGCCTGGCAGG - Intronic
924958418 2:11380-11402 GCGCGGAGCGTGGGGGTGGCGGG + Intergenic
926685772 2:15696749-15696771 GCGCAGGGCGCGGGACTGGCAGG - Intronic
927191062 2:20517276-20517298 GCTCTCATTGCGGGCCTGGCAGG + Intergenic
927714120 2:25341644-25341666 GCGGGGACGGCGGGCCGGGCTGG - Intronic
933049987 2:77590858-77590880 GCGCAAGGTGCGGGACTGGCAGG + Intronic
933511399 2:83245941-83245963 GCGCATGGTGCGGGACTGGCAGG - Intergenic
935069073 2:99677609-99677631 GCAGGGAGAGCGGGCCTTGCAGG + Intronic
936581453 2:113704397-113704419 GCGCAGGGCGCGGGACTGGCGGG - Intergenic
937624191 2:124025208-124025230 GAGCGCGGGGCGGGCCTGGCTGG + Intergenic
939281822 2:140074165-140074187 GCGCACGGTGCGGGACTGGCAGG + Intergenic
939738702 2:145880878-145880900 GCGCAGGGCGCGGGACTGGCAGG - Intergenic
939869122 2:147507303-147507325 GCACACAGTGCGGGACTGGCAGG + Intergenic
939960568 2:148561673-148561695 GCCCGAAGTGGGGACCTGGCTGG + Intergenic
940666636 2:156618009-156618031 GCGCAGGGCGCGGGACTGGCAGG - Intergenic
942317524 2:174709544-174709566 GCGCAGGGCGCGGGACTGGCAGG - Intergenic
943365313 2:186962514-186962536 GTGCGGAGCTCGGGCATGGCGGG - Intergenic
944495839 2:200306804-200306826 GCTCGGAGGGCGGGCCGAGCGGG - Intronic
945069699 2:205977570-205977592 GCGCATGGTGCGGGACTGGCAGG + Intergenic
946185585 2:217978876-217978898 GCGCGGATTGCGGGCTGGGGTGG - Intronic
946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG + Exonic
946923494 2:224603676-224603698 GCGCACAGCGCGGGACTGGCAGG - Intergenic
947748752 2:232522385-232522407 GCACGGAGGGCGGGCCGGGGAGG - Intronic
947795320 2:232890696-232890718 TCGGGGAGTGGGGGCCCGGCAGG - Intronic
947860477 2:233354437-233354459 GGGCCGAGGGCGGGCCGGGCCGG - Intergenic
947991884 2:234495320-234495342 GAGCGCTGTGCTGGCCTGGCTGG - Exonic
1169164111 20:3407678-3407700 GCGCGGCGCGCGGGCCCGGCGGG + Intergenic
1170246539 20:14226892-14226914 GCGCACAGCGCGGGACTGGCAGG + Intronic
1170625975 20:18030490-18030512 GGGCTGAGTGGTGGCCTGGCTGG - Intronic
1171123420 20:22583684-22583706 GTGCGGAGTGCGGGGGCGGCTGG + Intronic
1171318781 20:24220696-24220718 GCGCATGGTGCGGGACTGGCAGG - Intergenic
1175237494 20:57524941-57524963 GGGCGGAGGGAGGGGCTGGCCGG - Intronic
1175866816 20:62183077-62183099 GCGGGGAGCGTGGGCCTGGGGGG + Intronic
1175877817 20:62238689-62238711 GAGGGGAGGGCGGGCCGGGCAGG + Intronic
1176108519 20:63400694-63400716 GCGTGGGGCGCGGGCATGGCGGG + Intergenic
1176146911 20:63569572-63569594 GTGCGTAGAGCCGGCCTGGCGGG + Exonic
1179179070 21:39030194-39030216 GAGAGGAGAGCGGGCCTGGTGGG + Intergenic
1179512050 21:41879486-41879508 GCGCGCGGGGCGGGTCTGGCCGG + Intergenic
1180731272 22:17984315-17984337 GAGCGCAGTGTTGGCCTGGCTGG - Intronic
1180740973 22:18053344-18053366 CTGAGGAGTGCGGGACTGGCAGG - Intergenic
1180876845 22:19178657-19178679 GCGCGGGGCGCGGGCATGGCGGG + Exonic
1181478010 22:23180507-23180529 GCGCAGAGTGCGGGCCGGGCGGG + Exonic
1182236972 22:28883727-28883749 GCGCGGAGGGCGGGCGCGGCCGG - Exonic
1183361388 22:37384968-37384990 GCCAGGAGGGCGGGCCTAGCCGG - Intronic
1183420609 22:37709474-37709496 GCCCGGAGTCGGGGCCTGGGAGG + Intronic
1183490400 22:38112616-38112638 GGGCGGGGTGCGGGCCGGGCGGG - Intronic
1183606925 22:38871582-38871604 GCGCGGAGTGGGGCCCGGGAAGG - Intronic
1184033579 22:41908414-41908436 GAGCGGAGACCGGGCCTGGTGGG + Intergenic
1184136602 22:42553732-42553754 GCGGGAAGGCCGGGCCTGGCGGG + Intronic
1184265442 22:43343549-43343571 GTGGGGGGTGTGGGCCTGGCCGG + Intergenic
1184461179 22:44639080-44639102 GCGTGGACAGCGGGCATGGCTGG + Intergenic
1185313840 22:50170484-50170506 GCGGCGGGTGCGGGGCTGGCCGG - Intergenic
1185413501 22:50697773-50697795 GCGCGCGGTGCTGGCCGGGCCGG + Intergenic
949259048 3:2084013-2084035 GCGCAGGGCGCGGGACTGGCAGG + Intergenic
949552386 3:5122199-5122221 CAGCGGCGGGCGGGCCTGGCCGG + Exonic
949970000 3:9396754-9396776 GCGCGGGGCGCGGGGGTGGCGGG - Intergenic
950068890 3:10136410-10136432 GTGCAGGGTGCGGGACTGGCAGG - Intergenic
950084586 3:10248534-10248556 GGGCGGAGGCCGGGCCAGGCGGG + Exonic
950204782 3:11071194-11071216 GCGCGTGGTGCGGGACTGGTGGG - Intergenic
950256588 3:11511571-11511593 GCGCACAGTACGGGACTGGCAGG - Intronic
950569914 3:13793434-13793456 GCGAGCCTTGCGGGCCTGGCTGG - Intergenic
950600315 3:14029470-14029492 GCGCATGGTGCGGGACTGGCAGG - Intronic
950610668 3:14124796-14124818 GCGCGGCGGGCAGGCCTGGGAGG - Exonic
951551806 3:23882506-23882528 GCGCACAGTGCGGGACTGGCGGG - Intronic
952713381 3:36453688-36453710 GCGCAGGGCGCGGGACTGGCAGG + Intronic
952730718 3:36634293-36634315 GCGCAGGGCGCGGGACTGGCAGG + Intergenic
953124439 3:40077895-40077917 GCGCAGGGCGCGGGACTGGCAGG - Intronic
953418011 3:42734086-42734108 GGGAGGGGTGGGGGCCTGGCAGG - Intronic
954558781 3:51538768-51538790 CCGCGGCGCCCGGGCCTGGCCGG + Intergenic
954632880 3:52056520-52056542 GCGCGGAGGGCCGGGCGGGCGGG - Exonic
955449547 3:59051243-59051265 GCGCACGGTGCGGGACTGGCAGG + Intergenic
956200782 3:66703249-66703271 GCGCTCAGTGCAGCCCTGGCCGG - Intergenic
956392131 3:68785287-68785309 GCGCATGGTGCGGGACTGGCAGG - Intronic
956438890 3:69260638-69260660 GCGCGTGGTGCGGGACTGGCGGG + Intronic
957386511 3:79502607-79502629 GCGCACAGCGCGGGACTGGCGGG + Intronic
957446187 3:80314834-80314856 GCGCACAGCGCGGGACTGGCAGG + Intergenic
960141164 3:114152940-114152962 GCGCACAGTGCGAGGCTGGCAGG - Intronic
961298289 3:125904278-125904300 GCGCTGGGCGCGGGACTGGCAGG + Intergenic
962177172 3:133167374-133167396 GCGCACAGCGCGGGACTGGCAGG - Intronic
962498476 3:135965934-135965956 GCGCGGAGGCCGGGGCGGGCGGG + Intronic
963081872 3:141402304-141402326 GCGCCGGGGGCGGGCCGGGCCGG + Intronic
964977825 3:162640457-162640479 GCGCACAGCGCGGGACTGGCAGG + Intergenic
964983086 3:162710482-162710504 GCGCAAGGTGCGGGACTGGCAGG - Intergenic
965288113 3:166843197-166843219 GCGCACAGCGCGGGACTGGCAGG + Intergenic
965298196 3:166976219-166976241 GTGCACAGTGCGGGACTGGCAGG + Intergenic
965446534 3:168780494-168780516 GCGCACAGTGCGGGACTGGCAGG + Intergenic
965728645 3:171746263-171746285 GCTCGCAGCGCGGGACTGGCGGG + Intronic
965882043 3:173397775-173397797 GCGCGGAGAGCGCGCCCGGGCGG + Intronic
966355108 3:179071646-179071668 GCGCGCAGGGCGGGCGTCGCGGG - Exonic
966874660 3:184315135-184315157 GCCCGGAGGGCGGGCGGGGCCGG - Intronic
968434064 4:576072-576094 GCGCGGGGTGCGGGCCGGCTCGG - Intergenic
968568751 4:1328511-1328533 GTGGGGTGTGTGGGCCTGGCTGG + Intronic
968652178 4:1764661-1764683 GGGCCGAGTGTGAGCCTGGCTGG + Intergenic
968879907 4:3293338-3293360 GCGCGGGGCGCGGGCCTGTGGGG + Intronic
969303082 4:6309008-6309030 GCGCAGGGCGCGGGACTGGCGGG - Intergenic
969379420 4:6783692-6783714 GCGCGGGGGGCGGGCCTGGCGGG + Intronic
969688337 4:8689385-8689407 GGGTGGAGGGAGGGCCTGGCTGG + Intergenic
969912208 4:10457211-10457233 GCGCGGGGCGGGGGCCTGACGGG - Intronic
970574510 4:17414279-17414301 GCGCGCGGTGCCGGACTGGCGGG - Intergenic
974147489 4:57965811-57965833 GCGCATGGTGCGGGACTGGCAGG + Intergenic
974147777 4:57967577-57967599 GCGCGTGGTGTGGGACTGGCAGG + Intergenic
974641676 4:64640447-64640469 GCGCAGGGCGCGGGACTGGCAGG - Intergenic
975779013 4:77819760-77819782 GCGGGGCGGGCGGGCCGGGCCGG + Intergenic
976690529 4:87863644-87863666 GCGCATGGTGCGGGACTGGCGGG - Intergenic
977641241 4:99360062-99360084 GCGCACAGCGCGGGACTGGCTGG + Intergenic
977717280 4:100196494-100196516 GCGCACGGTGCGGGACTGGCAGG - Intergenic
981280670 4:142954647-142954669 GCACAGGGTGCGGGACTGGCAGG + Intergenic
982100724 4:151965249-151965271 GGGCAGAGAGCGGACCTGGCGGG - Intergenic
982139466 4:152304204-152304226 GGGAGGGGTCCGGGCCTGGCAGG + Intergenic
982769006 4:159378478-159378500 GCGCGTGGTGTGGGACTGGCGGG + Intergenic
983369704 4:166842813-166842835 GCCGGCAGTGCGGGACTGGCAGG - Intronic
983792162 4:171812772-171812794 GCGCGGAGTGCGGTCGTGCAAGG + Intronic
984095482 4:175428024-175428046 CCGCGGAGTACGGGCCTGCCGGG - Intergenic
984668006 4:182448845-182448867 GCGCTGGGCGCGGGGCTGGCGGG + Intronic
984862554 4:184253327-184253349 GCGCCGTGTGCGGGTCTGGTGGG + Intergenic
985660853 5:1155904-1155926 GCGGGGAGGGCGGGGCCGGCGGG + Intergenic
987084410 5:14455868-14455890 GTGTGCAGTGCGGGACTGGCGGG - Intronic
987146181 5:14993778-14993800 GCGCACAGCGCGGGACTGGCAGG - Intergenic
987896362 5:23951683-23951705 GCGCGCGGCGCGGGACTGGCAGG + Exonic
988177340 5:27743847-27743869 GCGCAAGGTGCGGGACTGGCAGG + Intergenic
989957997 5:50377217-50377239 GTGCACAGTGCGGGACTGGCAGG + Intergenic
990308605 5:54517797-54517819 GCGCGGAGGGCGCGACCGGCTGG + Exonic
992527657 5:77628354-77628376 GCGCGGAGGGCGCCCCTCGCGGG - Intergenic
992802919 5:80309964-80309986 GCGCCTGGTGCGGGACTGGCGGG - Intergenic
994769717 5:103966300-103966322 GCGCACAGCGCGGGACTGGCAGG - Intergenic
995112315 5:108442055-108442077 GTGCACAGTGCGGGACTGGCAGG - Intergenic
995326350 5:110894001-110894023 GCGCAGGGCGCGGGACTGGCAGG - Intergenic
997582799 5:135028050-135028072 GCGGGCAGTGCGGGCCTGGCGGG - Exonic
997697249 5:135871544-135871566 GTGAGGAATGAGGGCCTGGCGGG + Intronic
998101627 5:139439508-139439530 GCGCGGAGCGCGGGGCACGCTGG + Exonic
998149329 5:139747864-139747886 GCGCGGTGCGCGGGGCTGGCAGG + Intergenic
1000903491 5:166936234-166936256 GCGCAGGGTGCGGGACTGGCAGG - Intergenic
1002000691 5:176194887-176194909 GAGCGGGGAGCGGGCCAGGCAGG + Intergenic
1002253651 5:177944100-177944122 GAGCGGGGAGCGGGCCAGGCAGG - Intergenic
1002524179 5:179806452-179806474 GCGCCAGGTGCGGGCCGGGCGGG + Intronic
1003060794 6:2860527-2860549 GCGCACGGTGCGGGACTGGCAGG + Intergenic
1003087127 6:3068933-3068955 GCGCGGCGGGCGGGCCCCGCCGG + Intronic
1003603830 6:7542105-7542127 GCGCGGGCTGCGGGGCTCGCGGG + Intronic
1004476414 6:15977315-15977337 GTGGGGAGGGTGGGCCTGGCTGG + Intergenic
1004906869 6:20244744-20244766 GCGCACAGTGCGGGACTGGCAGG - Intergenic
1005712078 6:28512173-28512195 GCGCAGGGCGCGGGACTGGCAGG + Intronic
1005724996 6:28639758-28639780 GCGCAGGGCGCGGGACTGGCAGG - Intergenic
1005766386 6:29015467-29015489 GCACGGCGCGCGGGACTGGCGGG + Intergenic
1005953480 6:30647720-30647742 ACTCGGAGAGCGGTCCTGGCAGG + Exonic
1008005520 6:46405740-46405762 GCGCACGGTGCGGGACTGGCAGG - Intronic
1008545061 6:52576935-52576957 GCGCAGGGTGCGGGCCCCGCCGG - Intergenic
1010703322 6:79077824-79077846 GCGCGCGGCGCGGGCCGGGCCGG - Intronic
1012450572 6:99349557-99349579 CCGCGGACGGCGGGCCTGGCCGG + Exonic
1014739074 6:125126241-125126263 GCGCAGGGCGCGGGACTGGCAGG + Intronic
1015149231 6:130019868-130019890 GCGCGGGCCGCGGGCCGGGCCGG + Intronic
1017325164 6:153134009-153134031 GCGCAGGGCGCGGGACTGGCAGG + Intergenic
1018400615 6:163415546-163415568 GCGCGGGGTCCCGGCCGGGCAGG - Intronic
1019163918 6:170086955-170086977 GAGGGGAGTGCGGGCCCTGCGGG - Intergenic
1019186367 6:170222985-170223007 GCGCGGAGGGCGGGCTTCTCAGG - Intergenic
1019427394 7:984050-984072 GCACAGAGTGAGGGCCTGACAGG - Intronic
1019562557 7:1665843-1665865 GCTCGGAGCCCGGGGCTGGCCGG - Intergenic
1019656696 7:2199849-2199871 GTGCGGAGTGTGGGCCCTGCTGG - Intronic
1020066225 7:5190389-5190411 GCGCGGCGAGTGGGCCCGGCCGG - Exonic
1021731261 7:23597629-23597651 GCGAGAGGTGCGGGCCCGGCTGG - Intronic
1021959680 7:25859087-25859109 GCGAGGAGGATGGGCCTGGCCGG + Intergenic
1022101059 7:27169434-27169456 GCGCGGGGGTCGGGCCGGGCGGG - Intronic
1022989590 7:35694820-35694842 GCGCGGAGGGCGGCGGTGGCGGG - Exonic
1024579992 7:50793489-50793511 GCGGGGAGGGCGGGCGGGGCCGG - Intergenic
1025615386 7:63113086-63113108 GCGGGGGGTGCCCGCCTGGCCGG - Intergenic
1027152066 7:75739594-75739616 GCGCAGCGTGGGCGCCTGGCCGG + Intergenic
1027232613 7:76281565-76281587 GCGCGGCGGGCGGGGCGGGCAGG + Exonic
1027668817 7:81071493-81071515 GAACGCAGTGCGGGACTGGCGGG + Intergenic
1029524763 7:101087943-101087965 GCCCGGAGGCCGGGCCTGGAGGG + Exonic
1029535270 7:101154327-101154349 GCGGGGAGCGCGGGCGGGGCTGG - Intergenic
1030102068 7:105955783-105955805 GCGCACAGCGCGGGACTGGCAGG - Intronic
1030121159 7:106112101-106112123 GAGCGGCAGGCGGGCCTGGCCGG + Intronic
1030215661 7:107042335-107042357 GCGCACAGCGCGGGACTGGCAGG - Intergenic
1031292192 7:119951484-119951506 GCGCACAGCGCGGGACTGGCAGG - Intergenic
1032035776 7:128520282-128520304 GCCCAGAGTGAGGGCCTGGAGGG + Intergenic
1033220462 7:139523854-139523876 GCGCCGAGTGCGCGTCGGGCTGG + Exonic
1033461624 7:141551619-141551641 GTAGGGGGTGCGGGCCTGGCCGG + Intronic
1033839839 7:145360569-145360591 GCGCAGGGTGCAGGACTGGCGGG - Intergenic
1034344629 7:150379001-150379023 ACGCGGAGTCCAGGCCTGGCAGG + Intronic
1034448721 7:151126296-151126318 GCGCGCAGTGCAGGCCTTGAGGG + Intronic
1035580962 8:738721-738743 GCGCTGAGGGAGGGCCGGGCGGG - Intergenic
1035694727 8:1586491-1586513 GCGCTGAGAGGGGGCCTGCCTGG + Intronic
1036033357 8:4994637-4994659 GCGCGGAGACCCGGGCTGGCGGG + Exonic
1036378329 8:8219259-8219281 GCACAGGGTGCGGGACTGGCAGG + Intergenic
1036398251 8:8386555-8386577 GCGGGGCGCGCGGGCCAGGCGGG - Intergenic
1036554597 8:9847773-9847795 GCGCAGGGCGCGGGACTGGCAGG - Intergenic
1036579646 8:10062031-10062053 GCAAGGAGTGGGAGCCTGGCTGG + Intronic
1036665545 8:10734791-10734813 GCGCGGGAGGCGGGGCTGGCAGG - Intronic
1036770916 8:11577888-11577910 GCACTGAGTGCAGGCCTGGAGGG + Intergenic
1036785301 8:11681473-11681495 GCGCGGGGTGCGGCGCTCGCGGG + Intronic
1036789520 8:11708724-11708746 GCGGCGGGTGCGGGCCTGGCGGG + Exonic
1037241621 8:16784293-16784315 GCGCAGGGTGCAGGACTGGCAGG + Intergenic
1037547673 8:19939863-19939885 GCGGGGAGTAAGGGCCCGGCTGG + Intronic
1037819695 8:22129739-22129761 GTGGGAAGTGCAGGCCTGGCAGG + Intronic
1037983596 8:23272503-23272525 GCGCAGGGCGCGGGACTGGCAGG + Intronic
1038544236 8:28412944-28412966 GGGCAGAGTGCGGGGCTGGCAGG - Intronic
1040014544 8:42689899-42689921 GCGCCCGGTGCGGGACTGGCAGG + Intergenic
1040807495 8:51409585-51409607 GTGAGGAGGGCGGGCCTGGGAGG + Intronic
1040952642 8:52952830-52952852 GTGCACAGTGCGGGACTGGCAGG - Intergenic
1044633406 8:94300307-94300329 GCACACAGTGCGGGACTGGCAGG - Intergenic
1044734792 8:95268732-95268754 GCGCGGACTGCGGGCTCTGCGGG + Intronic
1045096292 8:98800973-98800995 GCGCACAGTGCGGGACTGGCAGG + Intronic
1045232261 8:100316746-100316768 GCGCACGGTGCGGGACTGGCAGG - Intronic
1045933802 8:107655985-107656007 GCACGCGGTGCGGGACTGGCAGG + Intergenic
1048112920 8:131487415-131487437 GCGCGCGGTGCAGGACTGGCAGG + Intergenic
1049500381 8:142959863-142959885 GCGCACAGTGCGGGACTGGCAGG + Intergenic
1049606177 8:143530224-143530246 GTGGAGGGTGCGGGCCTGGCAGG - Intronic
1049663038 8:143829017-143829039 GCGCGGCGTGTGGCCCTTGCGGG - Intronic
1049944444 9:580745-580767 GCGCACAGCGCGGGACTGGCAGG - Intronic
1051419662 9:16877094-16877116 CCGCAGGGTGCGGGACTGGCAGG - Intergenic
1051975553 9:22943173-22943195 GGGCGGAGTGAGGGCCCGCCTGG - Intergenic
1055102502 9:72480213-72480235 GCGCAGGGCGCGGGACTGGCAGG - Intergenic
1056914110 9:90729889-90729911 GCGCAGGGCGCGGGACTGGCAGG + Intergenic
1057300770 9:93880295-93880317 GCGCATGGTGCGGGACTGGCAGG + Intergenic
1057432311 9:95005183-95005205 GGGCGGAGTGCGGGCTTGCGCGG + Exonic
1057726977 9:97574560-97574582 GCGCAGGGCGCGGGACTGGCAGG + Intronic
1060220928 9:121763691-121763713 GTGGGGAGTGAGGACCTGGCGGG - Intronic
1060810708 9:126610290-126610312 GCGCAGGGTGCAGTCCTGGCCGG - Intergenic
1060825086 9:126683208-126683230 GCGCGCTCTGCGGGCCTCGCGGG - Intronic
1061075786 9:128340666-128340688 GGGCGGCGGGCGGGGCTGGCGGG + Intronic
1062203920 9:135325065-135325087 GCGCCTACTGTGGGCCTGGCAGG - Intergenic
1062546028 9:137064113-137064135 GCGGGGGGTGCCTGCCTGGCTGG - Exonic
1062596422 9:137301940-137301962 GCGCGGGCCGCGGGCCGGGCCGG + Exonic
1062626066 9:137441900-137441922 GCGCGGAGCCAGGGCCGGGCTGG + Intergenic
1203492420 Un_GL000224v1:119509-119531 GCTCAGAGTGGGGTCCTGGCTGG + Intergenic
1203505043 Un_KI270741v1:61381-61403 GCTCAGAGTGGGGTCCTGGCTGG + Intergenic
1187669850 X:21657280-21657302 GCGCGGGGCGCGGGCCCCGCGGG - Exonic
1188166897 X:26873675-26873697 GCGCACGGTGCGGGACTGGCAGG - Intergenic
1189002913 X:36964053-36964075 GCGCGGTGCGGGGGCCGGGCCGG + Intergenic
1190024664 X:46912539-46912561 GCGCGGGGGGCGGCCCCGGCGGG + Exonic
1190244514 X:48682393-48682415 GCCCGGAGTGCGAGCCAGGCAGG - Intronic
1190862626 X:54358638-54358660 GCGCGCACTGCGGTCCTGGGGGG - Intronic
1191055114 X:56232889-56232911 GGGTGGAGAGCGGGCTTGGCCGG + Intronic
1193654886 X:84187575-84187597 GGGCGGAGCGCCTGCCTGGCGGG - Intronic
1194204539 X:90995788-90995810 GCGCACGGTGCGGGACTGGCCGG + Intergenic
1195060695 X:101191443-101191465 GCGCGGGGCCCGGGCCTGGCCGG + Intergenic
1196319468 X:114270535-114270557 GCGCACGGTGCGGGACTGGCAGG - Intergenic
1196582755 X:117395066-117395088 GCGCATGGTGCGGGACTGGCAGG + Intergenic
1196714677 X:118799342-118799364 GCGCACAGTGCAGGACTGGCAGG + Intergenic
1197340114 X:125256020-125256042 CTGAGGAGTGCGGGACTGGCAGG + Intergenic
1198032559 X:132767688-132767710 GAGAGGAGTGGCGGCCTGGCAGG - Intronic
1199175604 X:144784004-144784026 GCGCACAGCGCGGGACTGGCAGG + Intergenic
1199953264 X:152722701-152722723 GCTCGGAGTGCCAGCCTGCCTGG - Intergenic
1199956418 X:152745749-152745771 GCTCGGAGTGCCAGCCTGCCTGG + Intergenic
1200102474 X:153694898-153694920 GAGGGGAGGGCGGGCCGGGCGGG - Intronic
1200550382 Y:4571229-4571251 GCGCACGGTGCGGGACTGGCCGG + Intergenic
1201499506 Y:14627272-14627294 GCGCGGGGCACGGGACTGGCAGG - Intronic