ID: 1142210663

View in Genome Browser
Species Human (GRCh38)
Location 16:88806956-88806978
Sequence ACTTGTGCCTTGAGAGATAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142210657_1142210663 7 Left 1142210657 16:88806926-88806948 CCGGCACAGACCACCCAGTGTGC 0: 1
1: 0
2: 1
3: 20
4: 221
Right 1142210663 16:88806956-88806978 ACTTGTGCCTTGAGAGATACCGG 0: 1
1: 0
2: 0
3: 10
4: 112
1142210660_1142210663 -3 Left 1142210660 16:88806936-88806958 CCACCCAGTGTGCTGGGTGAACT 0: 1
1: 0
2: 1
3: 34
4: 927
Right 1142210663 16:88806956-88806978 ACTTGTGCCTTGAGAGATACCGG 0: 1
1: 0
2: 0
3: 10
4: 112
1142210662_1142210663 -7 Left 1142210662 16:88806940-88806962 CCAGTGTGCTGGGTGAACTTGTG 0: 1
1: 0
2: 3
3: 18
4: 195
Right 1142210663 16:88806956-88806978 ACTTGTGCCTTGAGAGATACCGG 0: 1
1: 0
2: 0
3: 10
4: 112
1142210661_1142210663 -6 Left 1142210661 16:88806939-88806961 CCCAGTGTGCTGGGTGAACTTGT 0: 1
1: 0
2: 0
3: 26
4: 164
Right 1142210663 16:88806956-88806978 ACTTGTGCCTTGAGAGATACCGG 0: 1
1: 0
2: 0
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142210663 Original CRISPR ACTTGTGCCTTGAGAGATAC CGG Intronic
901657748 1:10780031-10780053 CCTTGTGCCCAGAGAGACACGGG + Intronic
901820994 1:11829439-11829461 ACCTGAGCGTTGAGAGATATGGG + Intronic
906921077 1:50064950-50064972 TCTTGTGCCTAGAGACATAGGGG + Intronic
908954233 1:69601548-69601570 ACTTGTGCCTTTAGTGTTATAGG + Intronic
911035170 1:93535672-93535694 AATTGTGCTTTTAAAGATACAGG - Intronic
913357190 1:117935041-117935063 ACTCATGACTTGTGAGATACAGG - Intronic
917644087 1:177012816-177012838 ACTTCTGCCCTGAGTGATCCAGG - Intronic
921310845 1:213841801-213841823 ACTTTTGCCTAGGGAGATGCAGG - Intergenic
921968269 1:221116651-221116673 ACATGTGCCTTAAAAGATCCTGG - Intergenic
1065056919 10:21854539-21854561 AGTGGTGCATTTAGAGATACAGG + Intronic
1065218285 10:23471735-23471757 ACTGGTTCCTGGAGAAATACAGG + Intergenic
1068678089 10:59788546-59788568 ACTTGAGCCTTGAGAGTTCGAGG - Intergenic
1068841927 10:61625104-61625126 ACTTGTCACTCCAGAGATACTGG + Intergenic
1069767040 10:70870107-70870129 ACTTGGGACTTGAGAGACACTGG + Intronic
1071540559 10:86479013-86479035 ACTTGAGCCTTGGGAGATGGAGG + Intronic
1072794661 10:98345390-98345412 CCTTGTGCCTTGAGGGGTACTGG + Intergenic
1073931504 10:108582253-108582275 ACTTGTGCTTTGAAAAATACAGG + Intergenic
1075052471 10:119193012-119193034 ACTTGGACTTTGAGAGATAATGG - Intergenic
1075324117 10:121517016-121517038 ACTTGTTCCTTAAGAGAAAGGGG + Intronic
1080127009 11:28746833-28746855 ACTTGTGGCTTGATAGATTCAGG + Intergenic
1080292461 11:30686413-30686435 ACTTGGGCCTTGATATAGACTGG + Intergenic
1085373138 11:76030451-76030473 ATGTGTGCCTTGGAAGATACGGG + Intronic
1086201535 11:84209061-84209083 ATTTGTCCCTTGAGAGAATCTGG + Intronic
1086326901 11:85711002-85711024 GTTTGTGCCCTGAGAAATACAGG + Intronic
1090624672 11:128595982-128596004 GCTTGTGCCTGGAGAGAATCTGG + Intergenic
1092159404 12:6307819-6307841 ACTTCTGCCCTGAGAGATATGGG + Intergenic
1093426893 12:19037908-19037930 ACTTTTGGCTTGAGAGCTGCAGG + Intergenic
1094718716 12:33039246-33039268 ACTTGTTTCTTGAGTGTTACAGG - Intergenic
1095606646 12:44075743-44075765 ACTTGTGCCTTGGGGTATAGGGG + Intronic
1098211065 12:68165933-68165955 ACTTTTATCATGAGAGATACAGG - Intergenic
1101795759 12:107971980-107972002 ACTTGTGCCTTGCCAGATCTGGG - Intergenic
1102423335 12:112821359-112821381 ACTTCTGGCCTGAGAGATGCAGG - Intronic
1103244405 12:119443984-119444006 AATTGAGCCTTCAGAGATATTGG - Intronic
1106398317 13:29403198-29403220 ACTTGTGCCTTGATAAGAACTGG + Intronic
1108535533 13:51372677-51372699 ACGTATGTCTTGAGAGACACTGG - Intronic
1109924178 13:69112808-69112830 TATTGAGCCTTGAGAGAAACAGG + Intergenic
1110275426 13:73636691-73636713 ATTTGTGACTTGAAATATACAGG + Intergenic
1112642867 13:101296755-101296777 ATTTGTGCCTTGAGAGTTTGGGG - Intronic
1117964596 14:61193840-61193862 CTTTGTGCCTTAAGAGAAACAGG - Intronic
1126025362 15:44441251-44441273 ACTTGTGCCTTGCGGGTAACTGG + Intronic
1126789088 15:52204350-52204372 AGTTGTGCCTTGAGTGATAAAGG - Intronic
1128561248 15:68669303-68669325 AGTTGTGTCCTGAGAGATAAAGG - Intronic
1129417566 15:75395357-75395379 ACTTCTGGCTTTTGAGATACAGG - Intronic
1131045520 15:89311732-89311754 ACTGGAGCCATGAGAGAAACAGG - Intronic
1131335181 15:91542207-91542229 ACGTGTTCCTTGACAGATAACGG - Intergenic
1132015312 15:98310393-98310415 AATTGTTCCTTTAGATATACAGG + Intergenic
1136227065 16:28866408-28866430 ACCTGTCCCTTGAGAGCTGCAGG + Exonic
1138288102 16:55825233-55825255 ACATGTGCTTTGTGAGACACAGG - Intronic
1142210663 16:88806956-88806978 ACTTGTGCCTTGAGAGATACCGG + Intronic
1145816741 17:27800393-27800415 ACCTGTGCCTTGAGAACTTCGGG + Exonic
1146973327 17:37090581-37090603 AGTTTGGCCTTGAGAGATGCTGG - Intronic
1151155115 17:72118577-72118599 ACTTGTGTCTGTAGAGATCCGGG - Intergenic
1154029437 18:10739602-10739624 ACTTGTGACTTGATAGAAATAGG + Intronic
1155644839 18:28064757-28064779 ACTGGAGCCTTGAGAGAATCAGG + Intronic
1156107629 18:33684851-33684873 AATTGGGCCTTGAGATATAGAGG + Intronic
1156841237 18:41612173-41612195 AGTTGTGCCTGCAGAGACACAGG + Intergenic
1160100898 18:75918132-75918154 ACTTGTACCTTGAGAGCCCCTGG - Intergenic
1163383920 19:16987281-16987303 AGTTGACCCTTGAGAAATACAGG + Intronic
1165013422 19:32864521-32864543 ACATGTGCCAAGAGGGATACTGG + Intronic
1166801786 19:45462404-45462426 ACTTGAGCCCTGAGAGATTGAGG - Intronic
925986814 2:9223066-9223088 AAGTGTGACTTGAGAGATGCAGG - Intronic
927484075 2:23477083-23477105 ACTTGAGCCTTTAGAAGTACAGG + Intronic
930223549 2:48769078-48769100 ACATCTGCCTGGAGAGATTCAGG + Intronic
932020626 2:68082495-68082517 ACTTGTGGCTTGAAAGACAGTGG + Intronic
940965496 2:159832665-159832687 ACATATGCCTTAAGAAATACTGG - Intronic
946626600 2:221618824-221618846 ACTGGTGCCTTAAGATAGACTGG - Intergenic
1170910627 20:20563717-20563739 ACATTTGCCTTGACAGATAATGG + Intronic
1173692185 20:44969401-44969423 ACTTGTGTTTGGAAAGATACAGG + Intronic
1175003599 20:55657774-55657796 TCTTGTGCCTTAAGAGGTATAGG + Intergenic
1180622770 22:17172678-17172700 CCCAGTGCCTTGGGAGATACAGG + Intergenic
1184162295 22:42704101-42704123 ATTTGTGCCTTGAAAGATTGTGG - Intronic
953820192 3:46201557-46201579 TCTTGAGCCATGAGAGACACTGG - Intronic
956435060 3:69226911-69226933 ACTTGTGCTTTGAGGGACATAGG - Intronic
957692603 3:83592066-83592088 ACTTGTGCCATACGAAATACAGG - Intergenic
960179985 3:114564529-114564551 ACTTGTGCCAGAAGAGAAACTGG - Intronic
960730177 3:120718532-120718554 AATAATGCCTTGAGAAATACTGG - Intronic
961917452 3:130392172-130392194 ACTTTTGCCTTCAAAGATCCAGG + Intronic
967330282 3:188283105-188283127 CCTTGTGCCTCTAGAGAGACAGG - Intronic
968788113 4:2639554-2639576 CTGTGTGCCTTGAGACATACAGG + Intronic
969833689 4:9819959-9819981 CCTTGTTCTTTGAAAGATACTGG - Intronic
970902863 4:21179674-21179696 ATTTCTGGCTTGTGAGATACAGG + Intronic
976139425 4:81975294-81975316 TCTTGTGCCTTCAAAGACACAGG + Intronic
977902909 4:102442982-102443004 CCTTGTGCTTTGAGAGAGACAGG - Intergenic
978040909 4:104060730-104060752 AGTTGTGGCTTGTAAGATACTGG + Intergenic
984925796 4:184805643-184805665 ACTTGTGCCCTGAGAGACCTTGG - Intronic
987122330 5:14778826-14778848 ACTTGGGCTTTGAGAGTTGCTGG + Intronic
991594160 5:68285564-68285586 ATTTGTGTCCTGAGAGACACAGG + Intronic
993186879 5:84633638-84633660 ACCAGTGCCTTGAGAGTTGCAGG - Intergenic
996062303 5:119045669-119045691 TCTTGTGCCTTGAGAAATGAGGG + Intronic
996342985 5:122458495-122458517 ACTCCAGCCTTAAGAGATACAGG - Intronic
996412203 5:123170490-123170512 ACTTATGACTTCAGACATACAGG - Intronic
997592717 5:135085756-135085778 ACTTGTGCCCTGATAGACTCAGG + Intronic
997985177 5:138495654-138495676 CCTTGTGCCCTGAAAGCTACTGG + Intergenic
999769410 5:154763929-154763951 ACTTGAGCCTTGGGAGGTAAAGG + Intronic
1001910208 5:175510433-175510455 ACTCGTGCCTTTGGAGGTACTGG + Intronic
1007049420 6:38811890-38811912 ACTGGCCCCTGGAGAGATACTGG + Intronic
1009412522 6:63382577-63382599 ATTTGACCATTGAGAGATACAGG + Intergenic
1009747789 6:67841438-67841460 ACCTGTGTCTTGAGATATTCTGG - Intergenic
1013458510 6:110354672-110354694 ACTTGTCCCTAGAGAGATATGGG + Intronic
1014787095 6:125631595-125631617 ACATGTGCCTAGAGAGGTATTGG - Intergenic
1018409544 6:163529746-163529768 ACTTGTGCTTTGACAGAGACTGG - Intronic
1020986568 7:15142295-15142317 ACTTGGACCTTGAAAGATAATGG - Intergenic
1021388647 7:20064883-20064905 ACTTGAGACTTGAGTGATGCAGG + Intergenic
1028736191 7:94215317-94215339 ATTTGTGCCTAGAAAGCTACTGG - Intergenic
1030846225 7:114415724-114415746 ACTTGCGCCCTGACACATACTGG - Intronic
1032259360 7:130322548-130322570 ACATTTGAGTTGAGAGATACCGG + Exonic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1035010265 7:155709532-155709554 ACATGTGTCTGGAGAGGTACAGG - Intronic
1040883011 8:52228933-52228955 ATTTGTACCTTGAGTGACACAGG + Intronic
1042386545 8:68181998-68182020 ACTACTGACTTGAAAGATACAGG + Intronic
1047518456 8:125575893-125575915 ACTTGTGTCTTGAGGATTACAGG + Intergenic
1047639964 8:126808091-126808113 ATTTGTCCATTGAGAGAGACAGG + Intergenic
1048481254 8:134795837-134795859 TCTTGTGCTTTGGGAGAGACAGG + Intergenic
1050981153 9:12017779-12017801 ACTTGGGCTTTGAGAGTCACAGG - Intergenic
1053217931 9:36288402-36288424 GCTTGTGACTTGAGAGATAGTGG + Intronic
1055059187 9:72050950-72050972 ACTTGAGCCTTGAGAGCTTGAGG + Intergenic
1058093894 9:100837192-100837214 ACTTGTGCTTTGGGAGTCACAGG + Intergenic
1059101135 9:111472554-111472576 ACTTGAGCCTTGGGAGATCAAGG + Intronic
1187450389 X:19391070-19391092 ACTTGAGCATTGAGAGGGACTGG - Intronic
1187811904 X:23188519-23188541 ACTTATGCCTTGAGTTATAAGGG - Intergenic
1193470739 X:81899643-81899665 AATTGTGCCTTTTCAGATACAGG + Intergenic
1199296600 X:146165965-146165987 ACTTATTCTTTGAGAAATACTGG + Intergenic
1199505278 X:148554446-148554468 ACCTGTGCCTGGAGGGAGACAGG + Intronic