ID: 1142210835

View in Genome Browser
Species Human (GRCh38)
Location 16:88807741-88807763
Sequence CTGCAGTCCTTGGTCAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142210820_1142210835 26 Left 1142210820 16:88807692-88807714 CCTCTGGAGGCAGCTTCCCCCTC 0: 1
1: 0
2: 2
3: 38
4: 317
Right 1142210835 16:88807741-88807763 CTGCAGTCCTTGGTCAGAAGGGG No data
1142210822_1142210835 10 Left 1142210822 16:88807708-88807730 CCCCCTCACAGCTCTGGCCCTTT 0: 1
1: 0
2: 1
3: 43
4: 392
Right 1142210835 16:88807741-88807763 CTGCAGTCCTTGGTCAGAAGGGG No data
1142210826_1142210835 -7 Left 1142210826 16:88807725-88807747 CCCTTTCCCTGACCACCTGCAGT 0: 1
1: 0
2: 3
3: 63
4: 544
Right 1142210835 16:88807741-88807763 CTGCAGTCCTTGGTCAGAAGGGG No data
1142210827_1142210835 -8 Left 1142210827 16:88807726-88807748 CCTTTCCCTGACCACCTGCAGTC 0: 1
1: 0
2: 4
3: 41
4: 379
Right 1142210835 16:88807741-88807763 CTGCAGTCCTTGGTCAGAAGGGG No data
1142210825_1142210835 7 Left 1142210825 16:88807711-88807733 CCTCACAGCTCTGGCCCTTTCCC 0: 1
1: 0
2: 5
3: 53
4: 467
Right 1142210835 16:88807741-88807763 CTGCAGTCCTTGGTCAGAAGGGG No data
1142210824_1142210835 8 Left 1142210824 16:88807710-88807732 CCCTCACAGCTCTGGCCCTTTCC 0: 1
1: 1
2: 3
3: 38
4: 430
Right 1142210835 16:88807741-88807763 CTGCAGTCCTTGGTCAGAAGGGG No data
1142210823_1142210835 9 Left 1142210823 16:88807709-88807731 CCCCTCACAGCTCTGGCCCTTTC 0: 1
1: 0
2: 5
3: 42
4: 449
Right 1142210835 16:88807741-88807763 CTGCAGTCCTTGGTCAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142210835 Original CRISPR CTGCAGTCCTTGGTCAGAAG GGG Intronic
No off target data available for this crispr