ID: 1142210943

View in Genome Browser
Species Human (GRCh38)
Location 16:88808187-88808209
Sequence GTCCAGCTTGACGTAGGTGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142210943_1142210949 14 Left 1142210943 16:88808187-88808209 CCGACACCTACGTCAAGCTGGAC 0: 1
1: 0
2: 1
3: 3
4: 47
Right 1142210949 16:88808224-88808246 CGCCCACATCACTGCACGCCTGG 0: 1
1: 0
2: 2
3: 29
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142210943 Original CRISPR GTCCAGCTTGACGTAGGTGT CGG (reversed) Exonic
905836738 1:41130792-41130814 GTCCAGCTTGAAGTGGGGATGGG - Intronic
908654969 1:66378837-66378859 GTCCAGATTGGCCTAGGTGATGG - Intergenic
916901182 1:169225405-169225427 GTCCAGTTTGACGTTAGTGGAGG + Intronic
1066072789 10:31837565-31837587 GTCCATCTTGATGGAGGTATAGG + Intronic
1066673689 10:37865702-37865724 TTCAAGCTTGATGTAGATGTGGG - Intergenic
1074853209 10:117455229-117455251 GCCCAGCTTGAGGAAGGTGCAGG + Intergenic
1075438553 10:122462020-122462042 GCACAGGTTGGCGTAGGTGTTGG - Exonic
1083208980 11:61170879-61170901 GTCCAGCTAGCCTTAGGGGTTGG - Intergenic
1084953692 11:72680228-72680250 CTCCAGCTTGACCTAGGGATTGG + Intergenic
1094288207 12:28817567-28817589 GGTCACCTTGACGTAGGTGTGGG - Intergenic
1094488962 12:30946783-30946805 GACCAGCTTCACGGAGGTGGGGG + Intronic
1099150731 12:79109442-79109464 ATCTAGCTGGGCGTAGGTGTTGG - Intronic
1103522453 12:121545589-121545611 GTCCAGCTGGACATAGATTTAGG - Intronic
1103984029 12:124755262-124755284 GTCCAGATGGACGTGGGGGTGGG - Intergenic
1112006084 13:95254889-95254911 GCCCAGCATGTTGTAGGTGTGGG - Intronic
1120117174 14:80633623-80633645 GTCTTGCTTGTCCTAGGTGTGGG - Intronic
1123939897 15:25211753-25211775 GTCCCGCTGGATGTATGTGTGGG + Intergenic
1127237327 15:57068716-57068738 GTGAAGCTTGAAGTAGGTGGTGG + Intronic
1132599133 16:766191-766213 GTCCAGCTGCTCGTAGGTGAAGG - Exonic
1136399296 16:30009223-30009245 GTGCAGCTTGACGTAGGGGTCGG + Exonic
1137490423 16:48927842-48927864 CTCCAGCTAGATGTAGCTGTGGG - Intergenic
1142210943 16:88808187-88808209 GTCCAGCTTGACGTAGGTGTCGG - Exonic
1147495398 17:40910830-40910852 GTCCAGCTTGGAGTGGGTTTAGG + Intergenic
1156682738 18:39610556-39610578 GTCCAGGTTGACATAGGCCTGGG + Intergenic
1160781960 19:881587-881609 GGCCACCTTGAGGTCGGTGTTGG + Exonic
1164474239 19:28562917-28562939 GTGCTGCTTGAGGTTGGTGTAGG + Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1167264112 19:48474902-48474924 GTCCGGGTTGAAGAAGGTGTGGG - Exonic
933184155 2:79260128-79260150 GGCCAGCTTGCCATGGGTGTTGG + Intronic
935744495 2:106178786-106178808 GCCCAGCTTGCCGCAGGTGATGG - Intronic
1169280033 20:4259218-4259240 GTCCTGCCTGATGTGGGTGTTGG + Intergenic
1170775799 20:19373701-19373723 GTCCAGACTGATGTAGGTGAGGG + Intronic
1173593640 20:44244876-44244898 GTCCAGCTGGCAGCAGGTGTGGG + Intergenic
1181690388 22:24555725-24555747 GTCCAGCCTGTCCTTGGTGTGGG + Exonic
951659950 3:25052131-25052153 GTCCAGTTTAAGTTAGGTGTAGG - Intergenic
953754705 3:45636240-45636262 GTGCAGCTTGCAGTAAGTGTGGG + Exonic
966206367 3:177410697-177410719 GAAGAGCTTCACGTAGGTGTAGG - Intergenic
968447041 4:657388-657410 GTTCATCTTGTCGTAGGTGTCGG - Exonic
981486719 4:145294665-145294687 GGCCAGGATGATGTAGGTGTAGG - Intergenic
983330643 4:166323393-166323415 GTACAGCTTGACATATGTGAAGG - Intergenic
997580464 5:135013633-135013655 GGCGAGCTTGACGCTGGTGTTGG + Intergenic
1006010270 6:31037234-31037256 GTCCAGCTTGGCCTTGGTGAGGG + Intergenic
1009435027 6:63607940-63607962 GTCCAGCTTGACTTAGAGGTTGG - Intergenic
1012365398 6:98433008-98433030 GCCCAGCCTGCCATAGGTGTGGG + Intergenic
1020257278 7:6509183-6509205 GTCCAGGCTGGCGTAGGGGTGGG + Exonic
1021795672 7:24251298-24251320 GTAGAGCTTGTCGTAGGAGTTGG - Intergenic
1030069917 7:105689579-105689601 GTCAAGCTTGAGGTGTGTGTTGG - Intronic
1035240739 7:157527665-157527687 GTCCACCATTGCGTAGGTGTGGG - Intergenic
1035719091 8:1778018-1778040 GTCCAGCCTCACCTGGGTGTGGG + Intronic
1035887387 8:3306487-3306509 TTTCAGCTTCACGTATGTGTAGG + Intronic
1049758116 8:144319810-144319832 GCCCAGCTTAATGGAGGTGTTGG - Intronic
1188152057 X:26688935-26688957 GTACATCTTGATGGAGGTGTGGG + Intergenic