ID: 1142212693

View in Genome Browser
Species Human (GRCh38)
Location 16:88816019-88816041
Sequence GACACGCGTGTGAAGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142212693_1142212697 -5 Left 1142212693 16:88816019-88816041 CCCCCAGGCTTCACACGCGTGTC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1142212697 16:88816037-88816059 GTGTCTGTGCATCTCCCCCATGG 0: 1
1: 0
2: 0
3: 19
4: 209
1142212693_1142212701 10 Left 1142212693 16:88816019-88816041 CCCCCAGGCTTCACACGCGTGTC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1142212701 16:88816052-88816074 CCCCATGGCTCTGCTCACGGTGG 0: 1
1: 0
2: 0
3: 17
4: 150
1142212693_1142212704 17 Left 1142212693 16:88816019-88816041 CCCCCAGGCTTCACACGCGTGTC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1142212704 16:88816059-88816081 GCTCTGCTCACGGTGGCATCTGG No data
1142212693_1142212705 18 Left 1142212693 16:88816019-88816041 CCCCCAGGCTTCACACGCGTGTC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1142212705 16:88816060-88816082 CTCTGCTCACGGTGGCATCTGGG 0: 1
1: 0
2: 3
3: 19
4: 156
1142212693_1142212698 7 Left 1142212693 16:88816019-88816041 CCCCCAGGCTTCACACGCGTGTC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1142212698 16:88816049-88816071 CTCCCCCATGGCTCTGCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142212693 Original CRISPR GACACGCGTGTGAAGCCTGG GGG (reversed) Intronic
901082914 1:6593529-6593551 GACTCGCGCGTGGAGCGTGGTGG - Exonic
902055317 1:13595842-13595864 AACTCGGGGGTGAAGCCTGGTGG + Intronic
915988405 1:160489419-160489441 GACCCACATGTGAAGCCTGAGGG - Intronic
1066086340 10:31975325-31975347 GAAACGTGGGTGGAGCCTGGGGG + Intergenic
1066206240 10:33191886-33191908 GAGAATCGTGTGAAGCCAGGAGG + Intronic
1070390312 10:75964727-75964749 GACATGCGTTTGAAGCCTAGTGG + Intronic
1075392463 10:122102248-122102270 GATATGCGGGTGTAGCCTGGGGG + Intronic
1075595757 10:123727984-123728006 TACACTTGTGTGAAGGCTGGTGG - Intronic
1076127495 10:127986852-127986874 GAAACAAGTGAGAAGCCTGGTGG + Intronic
1077198435 11:1293203-1293225 GACACGGGGGAGAAGCCGGGAGG + Intronic
1082997005 11:59262784-59262806 GACACCTGGGAGAAGCCTGGTGG + Intergenic
1083839370 11:65295157-65295179 GACTCGCGTGTGAAGCGAGACGG + Intronic
1096613518 12:52818607-52818629 GACAGGGGTGTGGAGCCAGGCGG + Intergenic
1102884523 12:116511491-116511513 GTCAAGGGTCTGAAGCCTGGAGG - Intergenic
1103783563 12:123415574-123415596 GACACGCGTCTGCACGCTGGAGG + Exonic
1108849539 13:54710549-54710571 GACACTGGTCTGTAGCCTGGGGG + Intergenic
1113563096 13:111299430-111299452 GAGAATGGTGTGAAGCCTGGTGG - Intronic
1115025002 14:28733852-28733874 GACACGTGTGTTAAGCCTCCTGG - Intergenic
1127029768 15:54849143-54849165 GACCTGTGTGTGAAACCTGGGGG - Intergenic
1134441756 16:14302791-14302813 GAGGGGCGTGTGAAGCCGGGAGG + Intergenic
1136484407 16:30561967-30561989 GAGAAGCGTGTGAACCCGGGAGG + Intergenic
1137672633 16:50288157-50288179 GACACGCGTGCCAAGGGTGGAGG + Exonic
1142212693 16:88816019-88816041 GACACGCGTGTGAAGCCTGGGGG - Intronic
1146612840 17:34322959-34322981 GACACCCAGGAGAAGCCTGGGGG - Intergenic
1165008054 19:32822655-32822677 GAGAAGGGTGTGAACCCTGGAGG + Intronic
1165352240 19:35282115-35282137 GACACTCCTGAGGAGCCTGGCGG + Intronic
1170393207 20:15898184-15898206 GCCACACGTGTGAGGCATGGAGG - Intronic
1175221667 20:57420877-57420899 GACACGCCTGTGGAAGCTGGAGG + Intergenic
1175892797 20:62322878-62322900 GACACGAGTGGGTAGCCGGGTGG - Intronic
1176308057 21:5134707-5134729 CACAGGCCTGTGGAGCCTGGCGG - Intronic
1179849003 21:44127325-44127347 CACAGGCCTGTGGAGCCTGGCGG + Intronic
1182276149 22:29190039-29190061 GGCACCCAGGTGAAGCCTGGAGG + Intergenic
1184264093 22:43337531-43337553 GCCATGAGTGAGAAGCCTGGTGG - Intronic
950893615 3:16427767-16427789 GGCAGGCATGAGAAGCCTGGAGG - Intronic
950935599 3:16835780-16835802 AACAGCCGTGTGAGGCCTGGTGG - Intronic
955402991 3:58606840-58606862 TACAAGAGTGTGAAGGCTGGAGG - Intronic
957313713 3:78551108-78551130 GAGAATCGTGTGAACCCTGGAGG - Intergenic
967880581 3:194298606-194298628 GCCACGCGTGGGAAGCCAGGAGG + Intergenic
971771136 4:30898678-30898700 GACACTGGTGTGAACCCGGGAGG - Intronic
979430562 4:120624560-120624582 GACACAGATGTGAAGCCCGGGGG + Intergenic
986664712 5:10091023-10091045 GACAAGAGTGACAAGCCTGGAGG + Intergenic
986708420 5:10470429-10470451 GACAGGAGTGTGAGGCCAGGTGG - Intronic
991696178 5:69274972-69274994 GACAAGCATGTGAACCCGGGAGG + Intronic
997357700 5:133274573-133274595 GACACAGGTCTGAAGCCTAGGGG + Intronic
1000706445 5:164518995-164519017 GACACACGAGTGAGGCCTGTTGG + Intergenic
1018799904 6:167213921-167213943 GAACCTCGTGGGAAGCCTGGAGG + Intergenic
1018813101 6:167311965-167311987 AACCCTCGTGGGAAGCCTGGAGG - Intronic
1029545414 7:101207808-101207830 AACACAGGTGTGAAGGCTGGAGG - Intronic
1034550494 7:151817516-151817538 GACAGCCTTGGGAAGCCTGGGGG - Intronic
1037879297 8:22565362-22565384 GCCCCGCGGGTGAACCCTGGGGG - Intronic
1039822207 8:41144425-41144447 GACATGAATGTGAAGGCTGGGGG + Intergenic
1041494136 8:58467501-58467523 GTCACTTTTGTGAAGCCTGGTGG + Intergenic
1049632179 8:143664777-143664799 GCCACACATGTGAAGCCTGTGGG + Intergenic
1049756501 8:144313398-144313420 TACACGGGGGTGCAGCCTGGGGG + Intronic
1055169806 9:73242374-73242396 TACAGGCATGTGAGGCCTGGAGG - Intergenic
1056799327 9:89680588-89680610 GACACGCATGTGCAGCCATGAGG - Intergenic