ID: 1142215627

View in Genome Browser
Species Human (GRCh38)
Location 16:88828474-88828496
Sequence CCTGCCCAGAGGGAACTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142215619_1142215627 3 Left 1142215619 16:88828448-88828470 CCAGGGCTGCAGGGACTAAAGCC No data
Right 1142215627 16:88828474-88828496 CCTGCCCAGAGGGAACTGTCGGG 0: 1
1: 0
2: 3
3: 19
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142215627 Original CRISPR CCTGCCCAGAGGGAACTGTC GGG Intronic
903264333 1:22148114-22148136 CCTTCCCATAGGGATCTGACAGG - Intergenic
904127172 1:28249239-28249261 CCTGCCCAGGGGGAACTTTCAGG - Intergenic
905233446 1:36529777-36529799 CCAGCCCAGAGGTAACAGGCTGG - Intergenic
905425842 1:37883780-37883802 CCTGCCGAGGTGGAACTATCTGG - Intronic
905647921 1:39637447-39637469 TCTGCCCTCAGGGAACTCTCAGG - Intronic
907094621 1:51766463-51766485 CCTGCCCACAGGGAACTTTTGGG + Intronic
907192787 1:52662814-52662836 CCTGCCCTCAGGGAATTCTCAGG + Intronic
907310039 1:53534015-53534037 CCAGCCCAGGGGGAGCTCTCTGG + Intronic
913488144 1:119352781-119352803 CATGCCCAGATGTAACAGTCAGG + Intergenic
913503310 1:119491844-119491866 CATGTCTAGAGGCAACTGTCTGG + Intergenic
914049474 1:144119570-144119592 CTTGCCCAGAGGACACAGTCTGG - Intergenic
914129708 1:144845870-144845892 CTTGCCCAGAGGACACAGTCTGG + Intergenic
915044468 1:153000395-153000417 CCATCCCAGAGGGAAGTGGCCGG + Intergenic
916852102 1:168714043-168714065 CCCGCCAAGAGGGATCTTTCAGG - Intronic
920193340 1:204209757-204209779 CCTGCCCAAAAGGCACTGTTTGG - Intronic
922210024 1:223479380-223479402 CCTGCCCAGGGCGACCTCTCTGG + Intergenic
924840018 1:247698874-247698896 CATGCCCAGATGGGACTGTCTGG - Intergenic
1066480878 10:35794684-35794706 CTGGCCAACAGGGAACTGTCTGG - Intergenic
1069558815 10:69415366-69415388 CATGCCCAGAGGGAAATGGTGGG - Intronic
1070309233 10:75261313-75261335 CCAGGCCAGAGGGAGCTCTCAGG + Intergenic
1070560529 10:77563466-77563488 GCTACCCAGAGAGAACTGACAGG + Intronic
1070748929 10:78952613-78952635 CTTGTCCAGAGGGACCTGCCAGG - Intergenic
1073144919 10:101274267-101274289 CCTGCACAGAGGGAACCGATGGG - Intergenic
1073217818 10:101846257-101846279 CCTCCCCAGAGGAAATTCTCAGG + Exonic
1075992486 10:126849775-126849797 CCTGCCCACAAGGAGCTGGCAGG - Intergenic
1076206646 10:128609573-128609595 AATGCCCAGAGGGCACTGTGGGG + Intergenic
1076484767 10:130808847-130808869 CCTGGACAGAGGGCACTGTGAGG + Intergenic
1076761022 10:132605668-132605690 CCTGCCCAGGGGCCACTTTCTGG - Intronic
1077340755 11:2025342-2025364 CCTGCGCAAAGGGAGCAGTCAGG - Intergenic
1077493419 11:2872776-2872798 CCTGCACAGAGGCACCTGGCTGG + Intergenic
1077700355 11:4435612-4435634 CCTACCCACACGGAACTCTCAGG - Intergenic
1078241118 11:9531426-9531448 CCTGCCCACAGGCATCTGTGAGG + Intergenic
1078317135 11:10303476-10303498 CTTGCCCAGAGTGGTCTGTCTGG - Intergenic
1078554870 11:12315320-12315342 AGTGCCCAGAGGGAAATGTATGG - Intronic
1078690583 11:13576220-13576242 CTTGGCCAGAGGGAGCTGCCAGG + Intergenic
1078690666 11:13577217-13577239 CTTGGCCAGAGGGAGCTGCCAGG - Intergenic
1078866252 11:15300598-15300620 CCTCCCCAGCGAGAACTGTGAGG - Intergenic
1083329357 11:61890513-61890535 CCTGGCCCCAGGGTACTGTCTGG - Intronic
1084419583 11:69053621-69053643 GCTCCCCAGAGGGTACTGTGAGG - Intronic
1084560966 11:69905172-69905194 CCTGCCCAGAGGACACTGTGGGG - Intergenic
1084958703 11:72704739-72704761 CTTGCCCAGAGAGGAATGTCAGG - Intronic
1085338805 11:75718112-75718134 CCTGCCCAGAGAGAACTCCTGGG + Intronic
1085963796 11:81496580-81496602 CCTGGACATAGGGATCTGTCTGG - Intergenic
1087150496 11:94855238-94855260 CATACCCAGAGGGAACTGCATGG - Intronic
1087424652 11:97971280-97971302 CCTGCCCAGATGCAACTGTTAGG - Intergenic
1088648542 11:111937511-111937533 CCTGACCCGAGGGAACTTACTGG + Intronic
1088756446 11:112889413-112889435 ACTGCCCCGAGGGATCTGTGAGG + Intergenic
1088921614 11:114263387-114263409 CTTGCCCAGAAGGGAGTGTCTGG - Intronic
1202823740 11_KI270721v1_random:80531-80553 CCTGCGCAAAGGGAGCAGTCAGG - Intergenic
1092332773 12:7600902-7600924 CCTTCCCATAGGAAACTGGCTGG - Intergenic
1093422505 12:18991104-18991126 TCTGCCCAGAAAGAACAGTCTGG + Intergenic
1097514117 12:60582159-60582181 TCTGCATAGAAGGAACTGTCTGG + Intergenic
1097720806 12:63018814-63018836 CCTGCCCAGAGGTCCCTTTCTGG - Intergenic
1103283917 12:119784511-119784533 CCTGCCCAGAGGCAACGCTCTGG - Intronic
1103508417 12:121456647-121456669 CCTGCCCCGAGGACAGTGTCTGG + Intronic
1104523958 12:129500541-129500563 CCTGCCCAAAGGGACCTGGATGG + Intronic
1104648191 12:130511890-130511912 CCTGGCCAGAGGCAGCTGCCTGG - Intronic
1104828742 12:131733686-131733708 CCTGTCCTGAGGGGACTGTATGG - Intronic
1104931087 12:132339834-132339856 CCTGCCCAACGGGACCTGTGGGG - Intergenic
1105552458 13:21410619-21410641 TCTGCCCAGTGGGAACTTCCTGG + Intronic
1111135470 13:84036715-84036737 CCTGCCCAAACCGGACTGTCAGG - Intergenic
1112431721 13:99355919-99355941 CCTCCCCAGATGGAACTGGCTGG + Intronic
1113320041 13:109224163-109224185 CCTCCCCTGAGGCAGCTGTCAGG - Intergenic
1113891056 13:113735855-113735877 CCTGCACAGAGGGACCTGGGGGG - Exonic
1113902242 13:113803798-113803820 CCTGCCCAGCGGGCACTGGAAGG - Intronic
1113914193 13:113861224-113861246 CCTGCCCAGGGGAAACAGCCAGG + Intronic
1113966717 13:114156637-114156659 CCTCCACAGAGGAAACTTTCCGG - Intergenic
1117493396 14:56275482-56275504 CATCCCCAGATGGGACTGTCTGG - Intronic
1118432762 14:65737936-65737958 CCTGTCCAGAGCCATCTGTCTGG - Intronic
1123782690 15:23643938-23643960 CCTGGCCAGAGGCCACTGACAGG - Exonic
1124220429 15:27846166-27846188 AGTGCCCAGAGGGGGCTGTCTGG - Intronic
1125581362 15:40788265-40788287 CCTGGCCAGAGGGGACTTTTAGG - Intronic
1126881816 15:53107025-53107047 TCTGAGCAGAGGCAACTGTCAGG - Intergenic
1128358360 15:66943770-66943792 AGTGTCCCGAGGGAACTGTCAGG - Intergenic
1130870895 15:87971342-87971364 CCTGGCCAGGGTGAGCTGTCAGG + Intronic
1130969491 15:88721010-88721032 CCTTCCCTGAGGAAAATGTCAGG - Intergenic
1132576644 16:667340-667362 CATGCCCAGTGGGGACAGTCTGG + Intronic
1132622475 16:874369-874391 CCTGCCCACAGCGGGCTGTCCGG - Intronic
1132766052 16:1534668-1534690 CCTGCCCAGAGGCCACGCTCAGG - Intronic
1133284370 16:4683774-4683796 CCTGCCCAGAGGGACCTGCCGGG + Intronic
1133618251 16:7500263-7500285 CTTGCCAAGATGGAACTGTTTGG + Intronic
1135348751 16:21711287-21711309 GCTGCAGAGAGGGAACTGTCAGG + Intronic
1137252430 16:46749860-46749882 GCTGCCCAGGGGCAACTATCGGG - Intronic
1138348260 16:56332947-56332969 CCTGCCCAGATGCCACTGGCTGG + Intronic
1142215627 16:88828474-88828496 CCTGCCCAGAGGGAACTGTCGGG + Intronic
1203137739 16_KI270728v1_random:1739916-1739938 CTTGCCCAGAGGACACAGTCTGG + Intergenic
1143545738 17:7594086-7594108 CCTGCCCAGTGGGATCATTCTGG + Intronic
1145863880 17:28227934-28227956 CCTGCCCAGACGCCGCTGTCCGG - Intergenic
1147885329 17:43680344-43680366 CCTGCCCAAAGTGATCTGACAGG - Intergenic
1147955885 17:44134266-44134288 CCTGCCCAGAGAGGACACTCTGG - Intergenic
1148204740 17:45773070-45773092 CCACCCCAGAGGTAACTGTGGGG + Intergenic
1148744796 17:49912217-49912239 ACTGCCCAGAGTGAACTGACTGG + Intergenic
1149420276 17:56503870-56503892 CCTGCCCAGTGGGCCCTCTCAGG + Intronic
1151664164 17:75535937-75535959 GCTGCCCACAGGGAGCTCTCAGG + Intronic
1151756618 17:76078981-76079003 CCTGCCCAGGGGGACCTGGCAGG - Intronic
1154454610 18:14509666-14509688 CCTGCTTAGAGGGCACTTTCGGG - Intronic
1155065919 18:22268665-22268687 GCTGCCCAGAGGAAAGTGGCGGG - Intergenic
1155693112 18:28651499-28651521 CCGGGCCAGAGGGATCTGACTGG - Intergenic
1157471680 18:47993680-47993702 GCTGCCCAGAGGCAAGTGACTGG + Intergenic
1157535777 18:48456301-48456323 CCTGCCCAGGGGGAAGAGGCAGG + Intergenic
1157637066 18:49169153-49169175 CCTCCCCAGAGGGCGCAGTCAGG + Intronic
1157985758 18:52435860-52435882 CCTGCCCAGGGGGAGATCTCAGG + Intronic
1160216672 18:76938811-76938833 CGTGCCCCCAGGGACCTGTCGGG + Intronic
1160900357 19:1424814-1424836 CCTCCCCAGATGGAAGTGCCCGG - Intronic
1161383205 19:3977368-3977390 CCTGCCCAGCGGCCACTGACAGG - Intronic
1161456208 19:4370840-4370862 CCTTCCCAGAGGCCACTGCCAGG - Intronic
1161981005 19:7630354-7630376 CCAGCTCAGAGGGAACTTTCAGG + Intronic
1163140564 19:15345322-15345344 CCTGCCCTGTGGGAAATGCCTGG - Intergenic
1164300762 19:23960640-23960662 CATGCCCTGATGGAACTCTCTGG + Intergenic
1164582501 19:29443066-29443088 CCTGCACAGAGGCCACTCTCAGG - Intergenic
1164832286 19:31331909-31331931 CCTGCCCAGAAGAAAGTGCCCGG - Intronic
1165061932 19:33209082-33209104 CCTGCCCAAGGGGAGGTGTCCGG - Intronic
1167476023 19:49701382-49701404 CCTGCACAGAGGGCACGGGCTGG - Exonic
1202688864 1_KI270712v1_random:72138-72160 CTTGCCCAGAGGACACAGTCTGG - Intergenic
925027243 2:619888-619910 CCTGCCCAGAGAGGCCTCTCAGG - Intergenic
925117745 2:1394699-1394721 CCTGCCCAGAGAGTCCTGCCTGG + Intronic
925733178 2:6937386-6937408 CCTGCCCAGAGGGGTGTGTTGGG - Intronic
926119923 2:10236282-10236304 GCTGCCCAGAGGGCACAGGCAGG + Intergenic
926301300 2:11605099-11605121 CCTGACCTGGGGGTACTGTCTGG + Intronic
927174406 2:20395516-20395538 CCAGCCCAGAGGGAAATGATAGG + Intergenic
927189477 2:20507396-20507418 CCTGTCCATAGGGGCCTGTCTGG + Intergenic
928280575 2:29942875-29942897 GCTGCCTAGTGGCAACTGTCTGG + Intergenic
928286774 2:29996827-29996849 CTTGCCCAGTGGGAACAGCCTGG + Intergenic
928324347 2:30307835-30307857 CCTGCCCTCAAGGAACTGACAGG - Intronic
931809915 2:65844938-65844960 CCTGCACAGGGGCAGCTGTCTGG - Intergenic
932441280 2:71737141-71737163 CCAGCACATGGGGAACTGTCTGG + Intergenic
932714322 2:74090494-74090516 ACTGCCCAGAGACATCTGTCCGG - Intronic
933957571 2:87383961-87383983 CTTGCCCAGAGGACACAGTCTGG + Intergenic
934241691 2:90275856-90275878 CTTGCCCAGAGGACACAGTCTGG + Intergenic
934271482 2:91540829-91540851 CTTGCCCAGAGGACACAGTCTGG - Intergenic
934948223 2:98557707-98557729 CCTGATCAGAGAGCACTGTCTGG + Intronic
936259836 2:110949235-110949257 CCTCCCAAGAAGGATCTGTCTGG + Intronic
936615978 2:114048163-114048185 CCTGCACATAGGGAAGGGTCTGG + Intergenic
938288415 2:130136939-130136961 CAGACCCAGAGGGAGCTGTCTGG + Intergenic
938468113 2:131535997-131536019 CAGACCCAGAGGGAGCTGTCTGG - Intergenic
941754005 2:169165082-169165104 CCATCCCAGAGGAGACTGTCAGG - Intronic
944973076 2:205016441-205016463 CCTGCCCAGAGGAGACACTCAGG + Intronic
945046018 2:205782522-205782544 CCTCCCCAGAGGTAACTGTGAGG + Intronic
948447197 2:238042204-238042226 GCTGCCCAGAGGAAACTGGCTGG + Exonic
948491355 2:238315207-238315229 ACTGCCCAGATGGGACTTTCTGG + Intergenic
1168978683 20:1987026-1987048 CCTGCCCATAAGGGACTGACAGG - Intronic
1169741238 20:8897075-8897097 GCAGCCAACAGGGAACTGTCAGG - Intronic
1174186727 20:48711451-48711473 CCTGCCCACCGGGAGCTGACTGG - Intronic
1174500098 20:50978026-50978048 TCTGCCGAGAGGAGACTGTCAGG + Intergenic
1176067255 20:63204513-63204535 CCTGCACAGAGGGCCCTGGCTGG + Intronic
1176819558 21:13643642-13643664 CCTGCTTAGAGGGCACTTTCGGG + Intergenic
1177169020 21:17635196-17635218 CCTGCCCAAAGTCAATTGTCTGG + Intergenic
1180001927 21:44998991-44999013 ACTGCCCACAGGAATCTGTCAGG + Intergenic
1180552559 22:16552459-16552481 CTTGCCCAGAGGACACAGTCTGG + Intergenic
1180922298 22:19527200-19527222 CCTGCCCAGAAGGAGCTGACAGG + Exonic
1181351474 22:22261573-22261595 CTTGCCCAGAGGACACAGTCTGG - Intergenic
1181764814 22:25083871-25083893 CCTGCCCAGGGGGGAGTGCCTGG + Intronic
1182282175 22:29224170-29224192 GCTGGCCAGAGGGACCCGTCTGG + Intronic
1184595129 22:45509288-45509310 GCTGCCTGGAGGGAACTGTGGGG + Intronic
1185117482 22:48945914-48945936 CCTGCCCAAACAGACCTGTCTGG + Intergenic
1185258252 22:49848507-49848529 CTTCCCTAAAGGGAACTGTCGGG - Intergenic
950100243 3:10352268-10352290 CCTGTGCAGAGGGCACTGCCTGG + Intronic
952354174 3:32570083-32570105 CCTTCCCAGGGGAAGCTGTCAGG + Intronic
952784727 3:37141904-37141926 GCTGCCCAGAGGAAACTGGCTGG - Intronic
952820277 3:37480502-37480524 CCTGGCATGAGGGAACTTTCTGG + Intronic
953173585 3:40529382-40529404 CCTGCGCAGAGGGCCCTGTACGG + Exonic
953547896 3:43877708-43877730 CCTGCCCACAGGGACCAGGCAGG + Intergenic
953666114 3:44927758-44927780 CCTGCCCAGAGGGAAAGGACAGG + Intronic
955076696 3:55620659-55620681 GCTGCACAGAGGGAACTGGGTGG + Intronic
955135108 3:56209418-56209440 CCAGGCCAGAGGGAACAGGCAGG + Intronic
959377716 3:105605660-105605682 CCTCCCCTGAGGCAACTGCCAGG - Intergenic
961445564 3:126979434-126979456 CCTCCTCAGAGGGCAGTGTCAGG + Intergenic
966215555 3:177498527-177498549 CATGTCCACAGGGAACTGTCAGG - Intergenic
968135689 3:196217949-196217971 CCTCCTCAGAGGGAACTGAGAGG + Intronic
968922274 4:3528527-3528549 CCTGCCCAGCCTGAACTGTGCGG - Intronic
969527170 4:7709750-7709772 CCTGGCCAGAGGCAACTTTTGGG + Intronic
969626696 4:8309257-8309279 TCTGCCCGGAGGGAACAGTCAGG - Intergenic
970580133 4:17467515-17467537 CCTGCCCCGAGGGCACAGTGTGG + Intronic
976417604 4:84796612-84796634 CCTGACCAGGGTGAAGTGTCTGG - Exonic
981783605 4:148453193-148453215 CTTGACCACAGTGAACTGTCTGG - Intergenic
985713997 5:1445688-1445710 CCTTCCACGCGGGAACTGTCTGG + Intergenic
986469368 5:8058968-8058990 GCTGCCGTGAGGGAACTGGCTGG + Intergenic
986484361 5:8220391-8220413 TCTGCCCAGTCGGAACTTTCTGG - Intergenic
989234590 5:39131694-39131716 CATGCTCAGAGGGAAGAGTCAGG - Intronic
990998613 5:61758944-61758966 CCTGGGCAGAGAGAACTGCCTGG + Intergenic
991730561 5:69583505-69583527 TCTGCACAGAGAGAACTCTCTGG + Intronic
991806996 5:70438670-70438692 TCTGCACAGAGAGAACTCTCTGG + Intergenic
991864390 5:71044346-71044368 TCTGCACAGAGAGAACTCTCTGG - Intronic
991913484 5:71584075-71584097 CCTGGGCAGAGGGAACGGTGCGG + Intergenic
996540886 5:124629343-124629365 CCTCAGCAGAGGGAACGGTCTGG + Intergenic
997529662 5:134573997-134574019 CCTGCCCTCAGGGAGCTTTCTGG + Intronic
998702780 5:144723379-144723401 CATGTACAGAGGGAACTGTAAGG + Intergenic
998780121 5:145647210-145647232 CCTGCCCAGAGAGAAATCTAGGG + Intronic
999693127 5:154166042-154166064 CCCGCCCAGAGGGTCCTGACAGG + Intronic
1001685633 5:173592975-173592997 TCTACCCAGATGGATCTGTCAGG - Intergenic
1001852426 5:174981081-174981103 ACTGACCAGAGGGAAGTGTAGGG + Intergenic
1002300428 5:178254614-178254636 CCTTCCCAGAGGACACTGGCTGG - Intronic
1005808914 6:29501536-29501558 CCTGCCCAGTGGATACTGTGTGG + Intergenic
1006066858 6:31468298-31468320 CATGCCCAGAGGGTACTGGAGGG + Intergenic
1006779863 6:36625029-36625051 CCTGCCTGGAGGGAACTGTCAGG + Intergenic
1007684149 6:43655424-43655446 CCTGCCCAGCGTGATCTGTGTGG + Intronic
1007743923 6:44030645-44030667 CCTGCCCAGAGGGGACAGAGGGG + Intergenic
1010580397 6:77589560-77589582 CCTTACCAGAGAGAACTTTCAGG + Intergenic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1015559562 6:134500069-134500091 CCTGCCTAGAGGCAATGGTCTGG - Intergenic
1016017577 6:139201717-139201739 CCAGTAAAGAGGGAACTGTCGGG - Intergenic
1016417779 6:143851120-143851142 CCTGCCCAGAAGGAAGGGTATGG + Intronic
1017702393 6:157088107-157088129 CCTGCCCAGTGGTCACTGCCAGG + Intronic
1017793807 6:157823597-157823619 CATGCCCAGAAGGGACTGGCTGG - Intronic
1019064161 6:169281991-169282013 CCAGCTCAGCGGGGACTGTCAGG + Intergenic
1019101406 6:169633511-169633533 CCTGCCGACATGGCACTGTCTGG - Intronic
1019350680 7:552598-552620 CCTGCCCAGAGACCACCGTCCGG + Intronic
1019403017 7:867135-867157 GCTGCCCCGGCGGAACTGTCCGG + Intronic
1019887825 7:3920610-3920632 GCTGCCAAGATGGAACTATCCGG + Intronic
1021496715 7:21283206-21283228 CATGCCCATAAGGAACTGTGGGG + Intergenic
1026606978 7:71824770-71824792 CCTGCCGAGAGAGAGCTGCCTGG + Intronic
1027235883 7:76297631-76297653 CCACCCCAGAGGGAGCTGTCAGG - Intergenic
1028146764 7:87328243-87328265 CTTTCCCAGAGTGAACTGTAGGG + Intergenic
1029543488 7:101198354-101198376 CCTGCCCACAGGACTCTGTCCGG - Exonic
1029635711 7:101782349-101782371 CTTGCACAGTGGGTACTGTCTGG + Intergenic
1030992339 7:116315474-116315496 TCTGCCCGGTGGGGACTGTCTGG - Intronic
1033307928 7:140238712-140238734 CCTGCCCCGAGTGGAGTGTCAGG - Intergenic
1034293189 7:149948487-149948509 CCTGCCCTGAGGGAACCGGGAGG - Intergenic
1034812885 7:154148392-154148414 CCTGCCCTGAGGGAACCGGGAGG + Intronic
1036935310 8:12996558-12996580 GCTGCCCAGAAGGCACTGACTGG + Intronic
1048011273 8:130458162-130458184 CCTGCAGAAAGGGGACTGTCTGG - Intergenic
1049947372 9:610483-610505 TATCCACAGAGGGAACTGTCAGG - Intronic
1052991661 9:34522298-34522320 CTTGCACAGAGGGAACTTTGTGG + Intronic
1057201399 9:93142259-93142281 CCGGCCTAGAGGGAGTTGTCTGG + Intergenic
1057266444 9:93621053-93621075 CCTGCCAAGTGGCCACTGTCGGG + Intronic
1057486302 9:95487188-95487210 CCTGCACAGAGGGTCCTGCCAGG - Intronic
1060214181 9:121728508-121728530 CCTGCCAATAGGGAACTCACGGG + Intronic
1061354266 9:130092269-130092291 CCTGCTGAGAGGTAGCTGTCAGG - Exonic
1061545889 9:131304066-131304088 CCTGCCCTGGGGGTGCTGTCTGG + Intronic
1061619392 9:131801728-131801750 GCTGCCCAGAGGGACCTCTCTGG - Intergenic
1062489662 9:136799091-136799113 CCTGCCCACAGAGCAGTGTCGGG + Exonic
1062566454 9:137165956-137165978 CCCGGCCACAGGGGACTGTCAGG + Intronic
1203527801 Un_GL000213v1:105928-105950 CCTGCTTAGAGGGCACTTTCGGG - Intergenic
1185594746 X:1299076-1299098 CCTGCCCAGTGAGAACTATGAGG - Intronic
1187051667 X:15702516-15702538 TCTGCCCAGAGCTAAGTGTCTGG + Intronic
1188262400 X:28036338-28036360 CCTGCTCAGGGGAAACTTTCAGG - Intergenic
1189481663 X:41396669-41396691 CCTCCCCAAAGGCAGCTGTCAGG + Intergenic