ID: 1142219806

View in Genome Browser
Species Human (GRCh38)
Location 16:88848597-88848619
Sequence GCATCCTGGTTTTCTGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142219801_1142219806 9 Left 1142219801 16:88848565-88848587 CCGTCTGAAAAAAAAAAAAAAAG 0: 108
1: 8754
2: 102093
3: 71509
4: 100668
Right 1142219806 16:88848597-88848619 GCATCCTGGTTTTCTGCAGATGG 0: 1
1: 0
2: 1
3: 23
4: 185
1142219800_1142219806 28 Left 1142219800 16:88848546-88848568 CCTGGGTGACAGTGAGACTCCGT 0: 106
1: 844
2: 2603
3: 3957
4: 5859
Right 1142219806 16:88848597-88848619 GCATCCTGGTTTTCTGCAGATGG 0: 1
1: 0
2: 1
3: 23
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142219806 Original CRISPR GCATCCTGGTTTTCTGCAGA TGG Intronic
900541841 1:3206815-3206837 GAATCCGAGTTTTCTGCAGAGGG + Intronic
901206778 1:7502059-7502081 GCCTGCTGGTTTTCTGCTCAGGG + Intronic
903011975 1:20337758-20337780 GCAGCCTGGCTTTCCGCAGTGGG - Exonic
903688354 1:25149628-25149650 GGGTCTTGGTTTTCTGCAGAGGG - Intergenic
904569032 1:31446956-31446978 ACATTCTGGTTTTCTGCTCAGGG - Intergenic
904808141 1:33146054-33146076 GCATAGTGGCTTCCTGCAGATGG + Exonic
904907869 1:33911776-33911798 GCATCCTATTCTTCTGCAGGTGG + Intronic
905089311 1:35415320-35415342 GTTTTCTGGTTTTCTGCATAAGG + Intronic
906731223 1:48082929-48082951 GCCTCCTGGTTTCATGAAGAGGG + Intergenic
908837839 1:68245798-68245820 GAATCTAGATTTTCTGCAGATGG - Intergenic
909508296 1:76420210-76420232 CCATCCTGTTCATCTGCAGATGG + Intronic
910480225 1:87650650-87650672 GAATACTGGATTTCTGCACAAGG + Intergenic
912561825 1:110556510-110556532 ACATCCCTGTTTTCTGCAGATGG + Intergenic
914863413 1:151405501-151405523 CCACCCTGGTTTTCTACAGAGGG - Exonic
919996477 1:202756102-202756124 GCCTTCAGGTTTTCTTCAGAAGG + Intronic
921605267 1:217144823-217144845 GCATTCTGTTTTTCTGAACAAGG + Intergenic
921890385 1:220347595-220347617 GCATTCTGGATTTCTGCAATGGG + Intergenic
922555259 1:226527747-226527769 GCATCCTGGTGGTGTGCTGAAGG + Intergenic
923964257 1:239119197-239119219 CCATCCTGGTTCCTTGCAGATGG + Intergenic
1063491535 10:6468579-6468601 CCATCTTGTTTTTCTGGAGAGGG - Intronic
1063529840 10:6820558-6820580 GCTTCCTGCAATTCTGCAGATGG - Intergenic
1063686419 10:8241075-8241097 GCACCCTGGAGTCCTGCAGATGG - Intergenic
1066434674 10:35386371-35386393 GCATCCTGGTTCTTAGAAGATGG + Intronic
1068092436 10:52449149-52449171 GAATCCTGTTTTTCTTCAGCAGG - Intergenic
1069039914 10:63684766-63684788 GCATGCTGGTTTTTTGCAGATGG + Intergenic
1072658350 10:97346461-97346483 GGATCCTCATCTTCTGCAGAGGG - Intergenic
1075010649 10:118867007-118867029 GAATCCTGGTGCTCTGCAGATGG - Intergenic
1075722104 10:124593285-124593307 GCAGCCTGGTTCTGGGCAGATGG - Intronic
1078509976 11:11977719-11977741 GCCTCCTGATCTTCTGCATATGG - Intronic
1080034991 11:27700807-27700829 ACAGCCGGGGTTTCTGCAGAGGG - Intronic
1082796446 11:57381349-57381371 ACACCCTGGTTTGCTTCAGAAGG + Intergenic
1084862217 11:72026763-72026785 GCAGCCTAGTTCTCAGCAGAAGG - Intronic
1086433506 11:86758941-86758963 TGATCCTGCTTTTCTGCAGGAGG + Intergenic
1090095187 11:123735690-123735712 GGAGACTGGTTATCTGCAGAGGG - Intronic
1090593639 11:128297223-128297245 ACAGCCTGGCTTTCTGCAGAGGG + Intergenic
1090669618 11:128937234-128937256 GGATCCTGCTTTTGTCCAGATGG - Intronic
1090743290 11:129686548-129686570 GCATTCTGTTTTTCTACATATGG - Intergenic
1092052964 12:5485999-5486021 ACACCATGGTTTTCTGGAGAAGG + Intronic
1094419304 12:30253964-30253986 CCATCATGCTTTGCTGCAGATGG + Intergenic
1095849051 12:46780446-46780468 CCCCTCTGGTTTTCTGCAGATGG + Intronic
1098306302 12:69106191-69106213 GAATCCTGAGTTGCTGCAGAGGG - Intergenic
1100109274 12:91218373-91218395 GCTTCCTGGTTTTTTTCTGATGG + Intergenic
1100358875 12:93858040-93858062 TCATGCTGGTTTTCTGCTGAGGG + Intronic
1102441189 12:112965016-112965038 GCATCCTGGTGTTCTTTGGAGGG - Intronic
1103055409 12:117816270-117816292 GCCACCTGGAGTTCTGCAGACGG + Intronic
1105869528 13:24491923-24491945 GCTTCCTCGTGATCTGCAGATGG - Intronic
1106127571 13:26912882-26912904 GCACCCTGGCTTTCTGGAGTTGG + Intergenic
1109376753 13:61505140-61505162 ACATCCTGGTTTCATGCAGGAGG - Intergenic
1117616895 14:57543434-57543456 GCTTCTGGGGTTTCTGCAGAGGG + Intergenic
1118349172 14:64961224-64961246 ACATGCTGGTTTCCTGCAGTGGG - Intronic
1118444554 14:65839563-65839585 TGTTCCTGCTTTTCTGCAGAAGG + Intergenic
1118701568 14:68438744-68438766 GCATCTTCCCTTTCTGCAGAAGG - Intronic
1119949809 14:78733063-78733085 GGGTCCTGGTTCTCTGCTGATGG + Intronic
1120757362 14:88256737-88256759 GCATCGTGGAGTTCTGCTGAGGG - Intronic
1202938311 14_KI270725v1_random:114922-114944 GAATAGTGGTTTTCAGCAGATGG + Intergenic
1126104990 15:45141589-45141611 ACTTCCTGGAGTTCTGCAGAGGG - Intronic
1127884657 15:63189088-63189110 GCCTACGGGTTATCTGCAGAGGG - Intergenic
1128417656 15:67461496-67461518 GCATGCTTGTTTTGTGCACAGGG - Intronic
1128886004 15:71288883-71288905 GCATGGGGGATTTCTGCAGAAGG + Intronic
1131185660 15:90271853-90271875 ACAGCCTGGATTTCTGCATATGG + Exonic
1132568686 16:634785-634807 CCATTCTGGGTTCCTGCAGAGGG + Exonic
1133056454 16:3147793-3147815 GCATCCCTGTTTCCTGAAGAGGG - Exonic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1133774251 16:8885204-8885226 GCTTCCTGGCATTCTGCATAAGG + Intergenic
1137754909 16:50893551-50893573 GCATCATGGTTTTCTCAGGAAGG + Intergenic
1139907442 16:70376361-70376383 GCAGCCTGGTTCTCTCCAGAGGG - Exonic
1140236271 16:73161765-73161787 GAATCCTTCTTTTCTGCAGTGGG + Intergenic
1140240175 16:73193084-73193106 GCATCCACCTTTCCTGCAGAGGG - Intergenic
1141391099 16:83664682-83664704 GATTCATTGTTTTCTGCAGATGG + Intronic
1141921609 16:87139254-87139276 GGATCCTTGTTATCTTCAGAGGG + Intronic
1142219806 16:88848597-88848619 GCATCCTGGTTTTCTGCAGATGG + Intronic
1144952647 17:19002474-19002496 GCATTCTGGTCTTCTGCAATTGG + Intronic
1146793589 17:35766384-35766406 GCTGCCCGGTCTTCTGCAGAGGG + Exonic
1147951585 17:44110797-44110819 GAATCCTGTTTCTCAGCAGATGG - Exonic
1149437230 17:56643643-56643665 ACCTCATGCTTTTCTGCAGAAGG - Intergenic
1149597729 17:57874161-57874183 GCATGCTGGTTTGCTGAGGAAGG + Intronic
1155526432 18:26720724-26720746 GGATCCTGGATTTTTACAGATGG + Intergenic
1156364469 18:36413087-36413109 GCACCCTGGTTTTCAGCAAAAGG + Intronic
1157575756 18:48742015-48742037 CCTGCCTGGCTTTCTGCAGATGG - Intronic
1158130884 18:54151344-54151366 GCATGCTGGTTTTCTCTATAAGG - Intergenic
1158243266 18:55401869-55401891 ACATCCTTCCTTTCTGCAGATGG - Intronic
1158404807 18:57151619-57151641 GCACCCTGGTTTCCTGCATGGGG - Intergenic
1158425831 18:57338857-57338879 GCCTCATGGTGTTCTCCAGAGGG + Intergenic
1158944479 18:62436734-62436756 CCATCCTGGGCTGCTGCAGATGG + Intergenic
1162087302 19:8256519-8256541 GTATCCTGGTTTTGAGCAAACGG + Intronic
1163241367 19:16065868-16065890 GCCTCCTTGTTTTCTGCCCAAGG - Intergenic
1163321766 19:16578673-16578695 GCATCCTGGGTTTCAGCAGGTGG - Intronic
1165199109 19:34130954-34130976 ACCTCCTGGTTTTCTGCTGCTGG - Intergenic
1166376469 19:42330259-42330281 GCATCCTGCTTTTGAGCAGGAGG + Intronic
1167464564 19:49643614-49643636 GCATCTTTGTATACTGCAGAGGG + Intronic
928127097 2:28624509-28624531 CCATCCTGGTTTATTGGAGAGGG + Intronic
931460537 2:62446779-62446801 CCATCCTGGTTTTCTCTGGAGGG + Intergenic
933344470 2:81065870-81065892 CCATTCTGGGGTTCTGCAGATGG + Intergenic
935131453 2:100264281-100264303 GCATGGTGGTCTTCGGCAGATGG + Intergenic
936713240 2:115157619-115157641 GCATACTGGTTTTCTGTCCAGGG + Intronic
940179229 2:150913642-150913664 GTAATCTGGTTTTCTGCAGTAGG + Intergenic
940882071 2:158956777-158956799 TCATCCTGGTTATCTGGATAGGG + Intergenic
943099084 2:183466120-183466142 GCACCCTTGTTTACTGCATAAGG - Intergenic
943995860 2:194764732-194764754 GCATCCTTGCTTTCTCCAGTTGG + Intergenic
944910474 2:204305809-204305831 GCAGCCTGCTTTTGTTCAGATGG + Intergenic
945412393 2:209526783-209526805 GCATCCCTGTTTTCTGATGATGG + Intronic
946612497 2:221474475-221474497 GGATCCTGGTTTACTTCATAAGG - Intronic
946792746 2:223318058-223318080 GCTTGCTGGTTATCTGCTGAAGG + Intergenic
947674428 2:231964341-231964363 GCTTACAAGTTTTCTGCAGAAGG + Intronic
948570454 2:238914196-238914218 GCATCCTGCTTCTCTGTAGGCGG + Intergenic
1168961280 20:1871623-1871645 GCCTCCTGGTTCTCTGGGGAGGG - Intergenic
1169192351 20:3666397-3666419 GCCTCCTGCTTTTCTGCTGTTGG + Intergenic
1172108872 20:32533773-32533795 GCTTCCTCGTTTTCCTCAGATGG + Intronic
1172190381 20:33058781-33058803 CCATCCTGGTTTTCTGCCTCGGG - Intronic
1172584731 20:36074879-36074901 GCATCCTGCTTTTGAGCAGGAGG + Intergenic
1173046842 20:39520977-39520999 TGATCCGGGTTTCCTGCAGAGGG + Intergenic
1174130640 20:48341431-48341453 CCCTCCTGGGTGTCTGCAGAGGG + Intergenic
1174412625 20:50345856-50345878 GCATCCTGGTTTCCTGAGAAGGG + Intergenic
1175412126 20:58777330-58777352 CCATCCTGGTCTTTTACAGAGGG - Intergenic
1176343119 21:5716347-5716369 GCATCCTGGCTTTCCCCACAGGG - Intergenic
1176475373 21:7148498-7148520 GCATCCTGGCTTTCCCCACAGGG - Intergenic
1176501708 21:7608109-7608131 GCATCCTGGCTTTCCCCACAGGG + Intergenic
1176537440 21:8114416-8114438 GCATCCTGGCTTTCCCCACAGGG - Intergenic
1179066193 21:38026903-38026925 GCATCCTGCTTTTCTGCTGCTGG + Intronic
1179310024 21:40186962-40186984 ACATCCTGGCTTTCTGCTGTGGG - Intronic
1179564875 21:42241006-42241028 GCCTCCTGGATTCCTTCAGAGGG - Intronic
1181404656 22:22674095-22674117 GCATCCTGATGTTCTGAACATGG + Intergenic
1181413238 22:22739611-22739633 GCATCCTGATGTTCTGAACATGG + Intronic
1184565792 22:45291105-45291127 GAAGACAGGTTTTCTGCAGACGG - Intronic
1203236841 22_KI270732v1_random:11404-11426 GAATAGTGGTTTTCAGCAGATGG - Intergenic
1203242383 22_KI270733v1_random:30772-30794 GCATCCTGGCTTTCCCCACAGGG - Intergenic
950017153 3:9762319-9762341 CCATCCAAGTTTTCTACAGAAGG + Intronic
950871368 3:16232552-16232574 GCAGCCTTGTTTTCTGTATATGG + Intergenic
951967994 3:28409625-28409647 GCATTCTGTTATTCTGAAGAAGG + Intronic
952023358 3:29049700-29049722 GCATACTGGTTTTCTAGAAATGG - Intergenic
959520732 3:107320514-107320536 GTATACTTGTTTGCTGCAGATGG - Intergenic
960495931 3:118374887-118374909 GCATCCTTGGTTTCTGCACAAGG - Intergenic
962893679 3:139695154-139695176 GCAACCAGGTTTTCTGCTGGAGG + Intergenic
964157951 3:153608832-153608854 GCATCCAGCTTTTCTGCATTTGG - Intergenic
968791774 4:2669813-2669835 GCAGCCTGGCTTTCTCAAGAAGG + Intronic
968834887 4:2955809-2955831 GCCTCCTGGTGTGCCGCAGATGG + Intronic
971572131 4:28226544-28226566 GCATCCTTGTTGTCTGAAGTTGG + Intergenic
971906669 4:32735112-32735134 GCATCATGGCTTTATGGAGATGG - Intergenic
975491495 4:74994160-74994182 GCAAGCTGGTTTTCTTCAAAAGG - Intronic
976437276 4:85032675-85032697 GCATCCTCTTTATTTGCAGAAGG - Intergenic
980847868 4:138345478-138345500 GCATCCTGGATTTATCCAGGTGG + Intergenic
981484111 4:145267150-145267172 GGAACCTGGTTTTCTGCATGTGG + Intergenic
984349658 4:178574399-178574421 GCTTCTTGGCTTTCTGTAGAGGG - Intergenic
985617341 5:931413-931435 GCATCCTGGTTTTACGCTGAAGG + Intergenic
986167488 5:5287923-5287945 GCATCCAGGTTCGCTGCAGGAGG + Intronic
987295626 5:16548277-16548299 GCCTCCTGGTTATCAGCAGGTGG + Intronic
988600830 5:32638317-32638339 GCAGACTGGTTATATGCAGAGGG - Intergenic
988893807 5:35650298-35650320 GCATCAGGAGTTTCTGCAGAGGG - Intronic
988988079 5:36640508-36640530 CCATCCAGGTTTTCTTCAAAGGG + Intronic
991559503 5:67934686-67934708 TCATCCTGGTGATCTTCAGATGG - Intergenic
995018147 5:107336038-107336060 GCATCCAGGTTTTCTGGTGGTGG - Intergenic
996185219 5:120465416-120465438 GCGTCCTGGCTCTCTGCAGCTGG + Intronic
998237227 5:140408598-140408620 CCATCCTGATTTTCTCCAGTAGG + Intronic
999727363 5:154447248-154447270 GCATCCTCGGTATCAGCAGAGGG + Intronic
1000276934 5:159746182-159746204 CCATCTTGGTTCTCTGCTGAAGG + Intergenic
1000291319 5:159874130-159874152 GCATCCTGGGAATCTTCAGAGGG - Intergenic
1000395935 5:160774806-160774828 GCCTCTTTGTTTTCTGCAGGGGG + Intronic
1001141496 5:169147745-169147767 GCCTCCTGCTTTTCAGTAGAGGG + Intronic
1003419376 6:5941990-5942012 CCATTCTGGTTTTCTGAATAAGG - Intergenic
1003518995 6:6841758-6841780 GCAGCCTGGGTGCCTGCAGATGG + Intergenic
1003604245 6:7544305-7544327 GCATTCTGGTTTTGTGTGGAGGG + Intronic
1004111176 6:12720468-12720490 GCCTTCTGGTTTTCAGCAGATGG + Intronic
1004473763 6:15952107-15952129 GCCTCCTGGTTTGCTCCAGTGGG + Intergenic
1004819852 6:19355702-19355724 GCATGCCTGTTTTCTGCACAAGG - Intergenic
1007062301 6:38952637-38952659 GTAGCTTGGTTTTATGCAGAGGG - Intronic
1007290449 6:40782286-40782308 ACATAGTGGTTTTCTGCAAAGGG + Intergenic
1007814708 6:44513333-44513355 GCAGACTGGCTTTCTGCACATGG - Intergenic
1008144927 6:47879594-47879616 CGATCCAGGTATTCTGCAGAAGG + Exonic
1012194391 6:96321556-96321578 GCTTCCCGGTTTGCTGCAGTAGG + Intergenic
1013414574 6:109913290-109913312 GAATCGTGGTTGTCTGGAGAAGG - Intergenic
1016397006 6:143635086-143635108 ACATTCTTGTTCTCTGCAGATGG + Intronic
1017578412 6:155832721-155832743 GCAAACTGCTTCTCTGCAGATGG + Intergenic
1020087438 7:5318576-5318598 TCATGCTGGGTATCTGCAGAGGG - Intronic
1020693639 7:11389955-11389977 GCTTGCAGGGTTTCTGCAGAGGG + Intronic
1021198454 7:17698616-17698638 GCTTCCTGTTTCTCTGCAGAAGG + Intergenic
1023254845 7:38302624-38302646 GCATTCTTCTTTTCTGTAGAGGG + Intergenic
1024236572 7:47403159-47403181 GCATCCTGGATTCCTGAAGAGGG - Intronic
1028783587 7:94766327-94766349 ATATCCTGATTTTCTGCAGCAGG + Intergenic
1029660902 7:101960921-101960943 GCCTCCTGGTGTTGTGGAGAGGG + Intronic
1031356854 7:120797570-120797592 GCCTCCTGGGTTTCTGCACATGG + Intronic
1031395866 7:121273124-121273146 GCATCCTGGTTTACAAAAGAAGG - Intronic
1033044608 7:137950310-137950332 ACACCCTGGATTTCTCCAGAGGG + Intronic
1033499071 7:141929481-141929503 GCTGCCTGGTTTTCTTCAAAGGG + Exonic
1037407297 8:18556349-18556371 GCATCATGATTTCCTGCAGGAGG - Exonic
1037893891 8:22639123-22639145 TCAGCCTGGTTTTCTCCAGCAGG + Intronic
1038191747 8:25328078-25328100 GCATTCTGGTCTTCTGCAGCTGG + Intronic
1038781913 8:30575394-30575416 GGATCCTGCTCTTCAGCAGATGG - Intergenic
1041158348 8:55011053-55011075 TAATCCAGGTTTTCTCCAGAAGG + Intergenic
1043252899 8:78098138-78098160 GAATCCTCTTTTTCTGCAGGAGG - Intergenic
1046692938 8:117306393-117306415 ACATCCTTGTTGTCTGCATAAGG + Intergenic
1047634447 8:126744771-126744793 GCACCCAGGTTTTCAGCAGATGG - Intergenic
1048750765 8:137671677-137671699 TCATCCTGGGTTTCTCCACATGG - Intergenic
1049009411 8:139877357-139877379 GCATGCTGGGTTTCTGCAGCAGG + Intronic
1049569821 8:143364123-143364145 GCACACTGGGTTTCTGCAGTGGG - Intergenic
1050457101 9:5844929-5844951 GCCTTGTGGTTTTCTTCAGAGGG + Intergenic
1053271107 9:36750077-36750099 GCTTCCTGGAGTTCTGCAAAAGG - Intergenic
1055042992 9:71895497-71895519 CCATACTGGTATTCTACAGAAGG - Intronic
1056495583 9:87151729-87151751 GCATCCTCCTATGCTGCAGATGG - Intronic
1057750682 9:97790335-97790357 CCATCCTGGTTTTCTCAAGATGG + Intergenic
1059662750 9:116418083-116418105 GCATCCTAGTTTTCTCCTAATGG + Intergenic
1059764025 9:117366406-117366428 GCATCCCTGTTTTATACAGAAGG + Intronic
1060206433 9:121685259-121685281 GCATCCCCCTTTTCTGCAGAGGG + Intronic
1060859921 9:126945903-126945925 GCATTCTGTTTTTCTCCAGCTGG + Intronic
1062275707 9:135729498-135729520 TGAGCTTGGTTTTCTGCAGAGGG - Intronic
1203458711 Un_GL000220v1:13849-13871 GCATCCTGGCTTTCCCCACAGGG - Intergenic
1185699731 X:2221820-2221842 ACACCCTGGTTTTCTGCAGTGGG + Intronic
1191729024 X:64314292-64314314 GCATGCTTGTTTGCTGCAGCAGG + Intronic
1193871384 X:86803015-86803037 CCAGGCTGGTTTTCTGGAGAAGG + Intronic
1197683707 X:129415712-129415734 CCATGCTGATTTTCTGGAGATGG - Intergenic
1197830677 X:130639167-130639189 CCATCCTGGTCTTCTTCACAAGG + Intronic