ID: 1142222734

View in Genome Browser
Species Human (GRCh38)
Location 16:88863607-88863629
Sequence GCCACTGGCCCCCTCTTGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142222734_1142222739 2 Left 1142222734 16:88863607-88863629 CCCGCCAAGAGGGGGCCAGTGGC 0: 1
1: 0
2: 0
3: 17
4: 186
Right 1142222739 16:88863632-88863654 CTCTGGACACCCCTCTCCTCTGG 0: 1
1: 0
2: 0
3: 17
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142222734 Original CRISPR GCCACTGGCCCCCTCTTGGC GGG (reversed) Exonic
900409864 1:2507643-2507665 GCCACTGGGCACCTCTGGGCAGG + Intergenic
900494836 1:2971723-2971745 GACACTGGCCCCCTGGGGGCTGG + Intergenic
903642731 1:24870981-24871003 GCCTCTGGTACCCTCTGGGCCGG - Intergenic
903953472 1:27009946-27009968 GCCACTGCCCCCTCCATGGCTGG - Intronic
905223790 1:36466532-36466554 TCCACTCAGCCCCTCTTGGCGGG - Exonic
907303209 1:53500908-53500930 CCTAATGGCCCCCTCTGGGCGGG + Intergenic
910190216 1:84587311-84587333 GCCACTGGAATCCTCTTGACAGG + Intergenic
914947779 1:152081174-152081196 CCCAGTGGCCCTGTCTTGGCCGG + Intergenic
915737360 1:158093544-158093566 GCTTCTGGCTCCCTCTGGGCTGG - Intronic
919749842 1:201030685-201030707 GCCACTAGCCCCTTCTTGGGAGG - Intergenic
920037453 1:203075496-203075518 GCGACTGGCCCCCTCCAGGCAGG + Intronic
922327453 1:224541975-224541997 GCCACTGGACTTGTCTTGGCTGG - Intronic
923105672 1:230851577-230851599 CCCACTGGCCCCCTCTCCCCTGG + Intronic
923273864 1:232380056-232380078 GCCTCAGGCCCCCACTGGGCAGG - Intergenic
923512448 1:234664171-234664193 GCCACTGGCCCACATTTGGGAGG + Intergenic
1067836112 10:49642822-49642844 GCCTATGGCCCCGGCTTGGCTGG + Intronic
1067848116 10:49738855-49738877 GCCACTTGCCCTCTCTTGGTGGG + Intronic
1068669714 10:59710220-59710242 GCCGCTGGCGCCCTCCTGGCCGG + Intronic
1069900241 10:71702720-71702742 CCCACTGCCCACCTCTGGGCTGG - Intronic
1070155023 10:73827927-73827949 GGCAATGGCCCCCGCCTGGCAGG + Intronic
1070668284 10:78360709-78360731 GCCACCTGCACCCTCCTGGCTGG + Intergenic
1070807222 10:79277684-79277706 GGCTCTGTCCCCATCTTGGCTGG - Intronic
1071568064 10:86681629-86681651 GTCCCGGGCCCCCTCTGGGCTGG - Exonic
1074599083 10:114895606-114895628 GATACTGGTCCCCTCTTGACAGG - Intronic
1075721121 10:124588044-124588066 GCCACTGCCCCTCTCCAGGCAGG + Intronic
1076403989 10:130200571-130200593 GCCTCTGGCCCCCTCTTCTCTGG - Intergenic
1077443289 11:2578598-2578620 GCCAGGGGCCTCCTCATGGCTGG + Intronic
1077453233 11:2663288-2663310 GCTTCTGGGCCCCTCCTGGCTGG + Intronic
1077895565 11:6450891-6450913 GCCACTGACCGCCACTTTGCAGG - Exonic
1079162325 11:18006616-18006638 GCCACAGGCCACCTGTTGGATGG + Exonic
1082105181 11:48214103-48214125 GCCATTGTCTCCCTGTTGGCTGG - Intergenic
1083023872 11:59533476-59533498 GCCACTGCACCACTCTTGCCTGG + Intergenic
1084192189 11:67504325-67504347 GCCTCTGCCTCCCTCGTGGCGGG - Intronic
1084562072 11:69910802-69910824 GCCACTGTCTCCCTCCTGACAGG + Intergenic
1087165515 11:94998783-94998805 GCCAAGAGGCCCCTCTTGGCGGG + Exonic
1087210928 11:95446082-95446104 GCCCCTGGCTCCCCCTTGGCAGG - Intergenic
1088011395 11:105005628-105005650 GCCACTGGACCCCTCCTGCAGGG + Intronic
1089258394 11:117206222-117206244 GCCACTGGCCCCATCGGAGCCGG - Exonic
1090419553 11:126564775-126564797 TCCACTGGCCCCCTCCTGGAAGG - Intronic
1092864101 12:12744790-12744812 GCTCCTGGCCTCCTCTTGCCAGG + Intronic
1097960334 12:65526215-65526237 GCCTCTGGTCCCCTCTAGGGAGG - Intergenic
1098621854 12:72610932-72610954 GGCAGTGGCCCTCTCTTGGTTGG - Intronic
1099687402 12:85907882-85907904 GCCTCTGGCCACCTCCTGCCAGG + Intergenic
1101898022 12:108770301-108770323 GCCGCTGGCCCCCACCAGGCTGG + Intergenic
1101898072 12:108770450-108770472 GCCGCTGGCCCCCACCAGGCTGG + Intergenic
1104379789 12:128297306-128297328 GCCACTGGCCTCCTATCGGCAGG - Intronic
1105280366 13:18959564-18959586 TCCACTGGCCCTCTCTGGCCTGG + Intergenic
1106303458 13:28490130-28490152 AGCACTGGCCTCCTCTGGGCCGG + Intronic
1106553065 13:30788157-30788179 GTCACTGACCCTCTCCTGGCAGG + Intergenic
1107832899 13:44390263-44390285 GCCACAGGCTGCCTCTTGGTTGG + Intronic
1110811492 13:79815887-79815909 GCCCCTGGTCCCCTCTTTGTGGG + Intergenic
1112086247 13:96034859-96034881 GCACCTGGCTCCCCCTTGGCAGG + Intronic
1112478333 13:99752394-99752416 GCCACAGGCCCCCTGTGGGCAGG - Intronic
1113294025 13:108938432-108938454 CCCACAGGTCCCCTCTTGGCAGG + Intronic
1113387958 13:109868628-109868650 AGCACTGGCCCCCTCCTGCCTGG + Intergenic
1113518387 13:110920341-110920363 GCCACTGACCGGCTCCTGGCTGG + Intergenic
1113636379 13:111921650-111921672 GCCGCCGGCGCCCTCCTGGCCGG + Intergenic
1114554767 14:23555714-23555736 GCCACTGGCCTGCGCTTAGCTGG + Intronic
1117278330 14:54212425-54212447 ACCACTGCCCCCTGCTTGGCAGG - Intergenic
1119623136 14:76148101-76148123 GCCATTGGCCTCATCTGGGCAGG - Intergenic
1119932324 14:78560061-78560083 GCCAATGGCCCCTTATTGTCAGG - Intronic
1120405860 14:84092241-84092263 ACCCCTGGCTCACTCTTGGCAGG + Intergenic
1122372312 14:101235495-101235517 GCCATGGGCCCCCTCTGTGCAGG + Intergenic
1122688018 14:103519070-103519092 GCCACTGGTCCCCCCTTTACTGG - Intergenic
1122902538 14:104787751-104787773 GTCACTGGCCCTCTCTGGGCAGG - Intronic
1125887200 15:43237943-43237965 GCCTCCGGCCTCATCTTGGCTGG - Intronic
1126665624 15:51074355-51074377 TCTACTGGTCCCCTCTTGGTAGG + Intronic
1128383943 15:67133943-67133965 GCCACTGCCCCCCTCTCTCCTGG + Intronic
1128473321 15:67974937-67974959 GACACTGGGCCCCACTGGGCAGG - Intergenic
1129329949 15:74821929-74821951 AGCACTGGCCCCAGCTTGGCTGG + Intronic
1129518606 15:76171777-76171799 CCCACTGGGCCACTCTTGTCTGG + Intronic
1129591211 15:76916556-76916578 GCCCCTGGCTCACACTTGGCAGG + Intergenic
1132769146 16:1551358-1551380 GCCACTGTCCCCGGCTTGACTGG - Intronic
1132773141 16:1575855-1575877 GCCACTGGCCCTCTCCCTGCAGG + Intronic
1132806049 16:1775607-1775629 GCTACTGGTGGCCTCTTGGCAGG + Exonic
1135504851 16:23027554-23027576 ACCACTGGGACCCCCTTGGCAGG + Intergenic
1138829637 16:60360067-60360089 CCCAGTGGCCCTGTCTTGGCCGG + Intergenic
1139298818 16:65926499-65926521 TCCACTGGCCCCTTCTTTCCTGG + Intergenic
1139309014 16:66012603-66012625 GTCACTTCCCCACTCTTGGCTGG - Intergenic
1139721678 16:68861198-68861220 GCCAGTGGTCCTCTCATGGCGGG - Intronic
1142222734 16:88863607-88863629 GCCACTGGCCCCCTCTTGGCGGG - Exonic
1142279720 16:89141536-89141558 GGCAAAGGCCCCCTCTAGGCCGG - Intronic
1143603019 17:7961635-7961657 GCCACTAGCCCCCTCTCTGGAGG + Intergenic
1144674534 17:17153441-17153463 GCCACTGGCCCTCCCCTGCCTGG + Intronic
1145031160 17:19506372-19506394 GCCTCAGGCCCCCACTTAGCTGG - Intronic
1147599962 17:41739395-41739417 GCCACTGAGCCCCTCTGGCCTGG + Intergenic
1147646627 17:42038167-42038189 CCCTCTGTCCCTCTCTTGGCTGG - Intronic
1148558401 17:48592185-48592207 GCCGCTGGGCTCCTCTGGGCGGG + Exonic
1148865880 17:50628366-50628388 TCCACTGGCTCCCGCTAGGCAGG - Intergenic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1149840492 17:59960522-59960544 GCCACTGCCCCCGTCCTGGGTGG - Intronic
1150060798 17:62066157-62066179 GGCCCTGGCCCTCTCTTTGCGGG + Intergenic
1151803107 17:76389226-76389248 TCCTCTGGCCTCCTCCTGGCCGG - Intergenic
1152736946 17:82001680-82001702 CCCACTGGCCCCTTCTGGCCTGG + Intronic
1154229312 18:12540104-12540126 GCCACTGGCCCTCCCATGCCTGG - Intronic
1155043196 18:22082286-22082308 GCCACTGGGCCCCTTTTGTAAGG + Intergenic
1158419162 18:57277768-57277790 CAGACTGGCCCCCTCTTGCCAGG + Intergenic
1161036507 19:2087968-2087990 GCCCCTGGCTCCCACTGGGCGGG - Intronic
1161688986 19:5719937-5719959 GCCATTGGCCCCCAATTGCCGGG + Exonic
1162744712 19:12791944-12791966 GCCACCGCCGCCCTCTGGGCCGG - Exonic
1162931380 19:13959523-13959545 GCCAGGGGCCCCGTCTGGGCTGG - Intronic
1163443491 19:17333583-17333605 GCCTTGGGCCCCCTCGTGGCAGG - Intronic
1163556632 19:17997076-17997098 GGCACTGTCCCCCTATGGGCAGG - Intronic
1163664315 19:18595928-18595950 CTCACTGGCCCCCTCTTAGGAGG + Intronic
1165756186 19:38294429-38294451 GCCACTGACCCACTGTTGGGTGG - Intronic
1166106052 19:40598503-40598525 GCCACTGAGACCCTCTGGGCTGG + Intronic
1166107353 19:40603931-40603953 GCCCCAGGCCACCTCTGGGCGGG - Intronic
927040838 2:19228813-19228835 GCCAATGGCTCCCTCTGGGTAGG + Intergenic
927919599 2:26961767-26961789 GCCCCTGGCCACCTCCAGGCTGG + Intergenic
928022509 2:27715751-27715773 GCCTCTGGGCCCCTCTGGCCGGG - Intergenic
929014701 2:37482475-37482497 GCACCTGGCTCACTCTTGGCAGG + Intergenic
929571085 2:43023494-43023516 TCCACTGGGCCCTTCTTGTCAGG - Intergenic
932063540 2:68529829-68529851 CCCAGTGGCCCTGTCTTGGCCGG + Intronic
935046987 2:99490912-99490934 ACCACTTTCTCCCTCTTGGCAGG + Intergenic
936519514 2:113202687-113202709 AGCAGAGGCCCCCTCTTGGCGGG - Exonic
938299691 2:130201242-130201264 GCCACTGGCCCCTTCTCCCCAGG + Intergenic
938457017 2:131473244-131473266 GCCACTGGCCCCTTCTCCCCAGG - Intronic
938696058 2:133836680-133836702 GCCACAGGCAGCCTCTCGGCTGG + Intergenic
939932591 2:148253998-148254020 GCCAGGGGCACCCTCTGGGCAGG + Intronic
940533560 2:154908960-154908982 TCCACTGGCTCCCTCTGTGCAGG - Intergenic
941179731 2:162244626-162244648 GCCACTGTCCTGCTCTTTGCTGG - Intronic
941772813 2:169362325-169362347 GCCACTGGCCGGCGCTAGGCAGG + Exonic
945981007 2:216310608-216310630 GCCACTGGCCCTCTCTTCTGGGG + Intronic
946420174 2:219560549-219560571 GCCTCTGGCCCCCTGGTGGCTGG + Intronic
947874805 2:233461088-233461110 GCCACTGTGTCCCTCGTGGCTGG + Intronic
948600696 2:239106116-239106138 GCCCCTGGCCCAGTCGTGGCTGG + Intronic
1168896822 20:1329282-1329304 GCCAAAGGCCTCCTCTGGGCTGG - Intronic
1168954929 20:1828134-1828156 GGCCCTGGCCCCATCTTGCCGGG + Intergenic
1171390566 20:24799126-24799148 GCTACTGTCCCCCACCTGGCCGG + Intergenic
1172599375 20:36173425-36173447 GCCAGTGGCCGCCTCCAGGCAGG - Intronic
1174538948 20:51274363-51274385 CCCACTGGCTGCCTCTTTGCAGG + Intergenic
1175603026 20:60290128-60290150 GCCTCTGGGCCTCTCGTGGCGGG + Intergenic
1176185408 20:63775684-63775706 GCGAGTGGGCCCCTCTGGGCAGG + Exonic
1181082124 22:20422968-20422990 GCCACTGGAACCCTCCTGGGGGG + Intergenic
1181491268 22:23262302-23262324 GCCTCGGGCCTCCCCTTGGCTGG + Intronic
1182279393 22:29209186-29209208 TCCCCTGGGCCCCTCGTGGCAGG + Intronic
1183247313 22:36703595-36703617 GCCAGCGCCCCCCTCCTGGCGGG - Intergenic
1183581757 22:38730632-38730654 GGCGCTGGCCCCCTCGTCGCCGG - Exonic
1183672790 22:39283027-39283049 CACACTGGCCACCCCTTGGCTGG + Intergenic
1184373544 22:44097740-44097762 CCCACTGTTCCCCTCTAGGCGGG + Intronic
953257764 3:41306447-41306469 GCCAGTGGCCCCATCTGGGAGGG + Intronic
953469818 3:43157033-43157055 GCCCTAGGCCCACTCTTGGCAGG - Intergenic
954458160 3:50611211-50611233 GCCCCTGGCCCCCTCTGTCCTGG - Intronic
954754478 3:52831788-52831810 GCAGCTGGCCCCCTCAGGGCTGG - Intronic
955907543 3:63823438-63823460 GTCAGTGGAGCCCTCTTGGCTGG - Exonic
956139801 3:66134459-66134481 CCCACTGGCCCCAGATTGGCTGG - Intronic
961170087 3:124791472-124791494 GCCCCTAGCCCTGTCTTGGCAGG + Intronic
961458131 3:127034291-127034313 GCCACTGGGCAGCTCTTGCCAGG - Exonic
962601767 3:136996411-136996433 GACACTGGCTCCCTCTTCCCAGG - Intronic
963098865 3:141578613-141578635 GACACTGGCCCACTCTCTGCTGG - Intronic
966548333 3:181176832-181176854 GCCACTGCCACCGTCTTGGCAGG - Intergenic
968954195 4:3709928-3709950 GCCAATGGAGCCCTCCTGGCAGG + Intergenic
971056774 4:22922263-22922285 GCCACTGCCCTCGCCTTGGCTGG + Intergenic
982611185 4:157575581-157575603 GCACCTGGCCCGCCCTTGGCAGG + Intergenic
992029560 5:72708235-72708257 GCAGCTGGCTCCCCCTTGGCAGG - Intergenic
995881948 5:116853095-116853117 GCCACTGTGCCCGGCTTGGCTGG - Intergenic
997360300 5:133290696-133290718 GCCCCTGGAGCCCTCTTGGATGG + Intronic
1000084696 5:157879244-157879266 ACCACTGCCCCTCTCTGGGCTGG + Intergenic
1002321332 5:178377769-178377791 TCCACTGGCCACCTCTACGCAGG - Intronic
1003525457 6:6893127-6893149 GCCCCTGGCTCCCCCTGGGCTGG + Intergenic
1005243007 6:23853824-23853846 CCCAGTGGCCCTGTCTTGGCCGG - Intergenic
1006418564 6:33919525-33919547 GCCTGTTGCCCCCTCTAGGCTGG - Intergenic
1006717532 6:36130264-36130286 GCCGCTGGCCCGCGCTCGGCTGG + Intronic
1007476170 6:42121528-42121550 CCCACTGGCCTCCTCATGCCTGG + Intronic
1009398833 6:63230702-63230724 CCCAGTGGCCCTGTCTTGGCCGG + Intergenic
1016758729 6:147715241-147715263 GCGCCTGGCTCACTCTTGGCGGG - Intronic
1018750509 6:166800232-166800254 GCCACTGGAAGCCTCTTTGCCGG - Intronic
1020035417 7:4960351-4960373 CCCGCTGGCCCCAACTTGGCTGG + Intergenic
1020219112 7:6220879-6220901 GCCACTGCCTCCCAATTGGCTGG - Intronic
1020670381 7:11099924-11099946 GCCCCTTCCTCCCTCTTGGCAGG + Intronic
1024763412 7:52628322-52628344 CCCATGGGCCCCCTGTTGGCTGG - Intergenic
1026874502 7:73871594-73871616 CCCACAGGCACCCTCATGGCGGG - Intergenic
1026976641 7:74502740-74502762 GCCACCTGCCCCGTCTTGCCAGG - Intronic
1029605852 7:101599018-101599040 GCCACTGGCACCCTGGTGGAAGG + Intergenic
1031915650 7:127560376-127560398 GGCACTGGCACTCACTTGGCAGG + Intergenic
1032591073 7:133193058-133193080 GCCCCTGGCTCACTCTTGGCAGG - Intergenic
1032894994 7:136240684-136240706 CCCTCTGGCCCCCTCCTGGATGG - Intergenic
1035389026 7:158492868-158492890 GCCACTTGCCGCCACATGGCGGG - Intronic
1035398559 7:158550501-158550523 CCCACAGGCCCACTCATGGCTGG + Intronic
1038373220 8:27012737-27012759 TCCAGTGGCCCTGTCTTGGCCGG + Intergenic
1041138746 8:54790119-54790141 GCCAGTGGCTCCATCTTGCCAGG + Intergenic
1047106223 8:121733410-121733432 GCCACTGCTCCCCTCTAAGCTGG + Intergenic
1047251179 8:123182968-123182990 GCCACGGACGCCCTCTTGGATGG + Exonic
1047536542 8:125725326-125725348 GCCACAGAGCCCCTCCTGGCAGG + Intergenic
1049257059 8:141619799-141619821 GGCTCTGGCCCTCTCTTGGGAGG - Intergenic
1052413120 9:28147598-28147620 CCCAGTGGCCCTGTCTTGGCCGG - Intronic
1053284159 9:36839652-36839674 GCCTCAGGCCCCTCCTTGGCTGG + Exonic
1053493146 9:38526770-38526792 GCCACTGGCCTTCGCTTGGCGGG - Intergenic
1055551139 9:77433164-77433186 GCCACTGTCACCCTCTGAGCAGG - Intronic
1056020490 9:82433496-82433518 CCCAGTGGCCCTGTCTTGGCCGG + Intergenic
1057673837 9:97121316-97121338 GCCGCTGGCCTTCGCTTGGCGGG - Intergenic
1059277606 9:113109154-113109176 CTCCTTGGCCCCCTCTTGGCAGG - Intergenic
1059278645 9:113115397-113115419 CTCCTTGGCCCCCTCTTGGCAGG + Intergenic
1061816706 9:133201631-133201653 GTCACTGGCATCCTCTGGGCAGG + Intergenic
1061858121 9:133454256-133454278 GCCACTGAGCCCCTCCTGTCTGG - Intronic
1062471427 9:136707244-136707266 GCCACTGGCCACCTGTGGGCAGG + Intergenic
1185518758 X:720811-720833 GCCACTTGGCCCCTAATGGCAGG - Intergenic
1192561937 X:72132840-72132862 TCCACTGAGCACCTCTTGGCAGG - Intergenic
1197347803 X:125345642-125345664 GCCACTTGCACCCTCTGGACTGG + Intergenic
1200184978 X:154176260-154176282 GCCACTGGGGCCGTCTTCGCTGG + Intergenic
1200190631 X:154213398-154213420 GCCACTGGGGCCGTCTTCGCTGG + Intergenic
1200196382 X:154251200-154251222 GCCACTGGGGCCGTCTTCGCTGG + Intergenic
1200202037 X:154288318-154288340 GCCACTGGGGCCGTCTTCGCTGG + Exonic
1200470440 Y:3579671-3579693 ACCACTGGCCCTGACTTGGCCGG - Exonic