ID: 1142223360

View in Genome Browser
Species Human (GRCh38)
Location 16:88865860-88865882
Sequence GCCTCCAGGAGTGCAGCAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142223360_1142223365 5 Left 1142223360 16:88865860-88865882 CCTGTTGCTGCACTCCTGGAGGC 0: 1
1: 0
2: 4
3: 14
4: 183
Right 1142223365 16:88865888-88865910 CGTCCCCTCGGCCTGCTCCATGG 0: 1
1: 0
2: 0
3: 13
4: 165
1142223360_1142223371 26 Left 1142223360 16:88865860-88865882 CCTGTTGCTGCACTCCTGGAGGC 0: 1
1: 0
2: 4
3: 14
4: 183
Right 1142223371 16:88865909-88865931 GGCACACACCTTCATCTTGATGG 0: 1
1: 0
2: 2
3: 9
4: 146
1142223360_1142223363 -7 Left 1142223360 16:88865860-88865882 CCTGTTGCTGCACTCCTGGAGGC 0: 1
1: 0
2: 4
3: 14
4: 183
Right 1142223363 16:88865876-88865898 TGGAGGCCGTGGCGTCCCCTCGG 0: 1
1: 0
2: 0
3: 16
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142223360 Original CRISPR GCCTCCAGGAGTGCAGCAAC AGG (reversed) Exonic
900536084 1:3178468-3178490 GCCTCCGGGAGAACAGCAGCTGG - Intronic
901037511 1:6345147-6345169 GCTTCCAGGACTGCAGGAGCAGG + Intronic
901445463 1:9305411-9305433 GGCTCCAGGAGGGCAGGACCCGG + Intronic
902513290 1:16977413-16977435 GCAGCCAGGAGGCCAGCAACAGG - Intronic
904290986 1:29485744-29485766 GCCTCAAGGACTGCAGCAGAAGG + Intergenic
905894000 1:41533619-41533641 GCCTCCAGAAGGCCAGCAAGAGG - Intronic
906781617 1:48577715-48577737 GCATCCAGCAGAGCTGCAACTGG + Intronic
908477604 1:64505407-64505429 GCCTCCAAGGGTGCAGCAGGAGG - Intronic
915603214 1:156935458-156935480 GCCTCCAGCACTTCAGGAACAGG + Exonic
917964230 1:180168312-180168334 GCCTCCAGACGGGCAGCACCTGG + Intronic
918182209 1:182094165-182094187 GGCTACAGGAGTGCAGACACAGG + Intergenic
922531736 1:226350130-226350152 GCCTCCAGGGCTGCAGCATGGGG + Intergenic
922703348 1:227775115-227775137 GCCTCCAGGAATGCAGCGGAGGG + Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1063466611 10:6250011-6250033 GCCTTTAGGAATGCAGCATCAGG - Intergenic
1063703667 10:8410249-8410271 GCCTCCAGGAGTGCAGCGAGAGG + Intergenic
1065965896 10:30769861-30769883 GGCTCCCGCAGTGCAGCAGCAGG + Intergenic
1066571974 10:36783598-36783620 GGCTCCAGGTGTGCAGTCACAGG + Intergenic
1067070096 10:43124889-43124911 GCTTCCAGCATTGCAGCATCAGG - Exonic
1068171404 10:53399573-53399595 GACTACAGGAGTGCACCACCAGG - Intergenic
1069653443 10:70069272-70069294 ACCCCCAGGAGCACAGCAACGGG - Intronic
1069817912 10:71210259-71210281 CCCTCCAGGACTCCAGCATCAGG - Intergenic
1070006231 10:72426819-72426841 CACTCCAGGAGTGCACCCACAGG - Intronic
1070670507 10:78374332-78374354 GACTCTGGGAGTGCAGCAAGAGG - Intergenic
1073716562 10:106114756-106114778 GCATCCAGCAGAGCAGCTACCGG - Intergenic
1077484872 11:2834004-2834026 GCCACAAGGAGTGCAGCCAGGGG + Intronic
1085022882 11:73220004-73220026 GGCTCCTGGAGGGCAGAAACTGG + Intronic
1087682400 11:101231777-101231799 GGCTCCTGCAGTGCAGCAGCAGG + Intergenic
1089793238 11:120959328-120959350 CTCCCCAGGAGTGAAGCAACAGG - Intronic
1090402462 11:126457989-126458011 GCCACCAGGAGCCCAGCAGCAGG - Intronic
1091277892 11:134364636-134364658 TCCTCTAGGAGTGCACCAAAAGG - Intronic
1092205335 12:6611386-6611408 GCCACAATGAGTGCAGCAAGAGG - Intergenic
1098271389 12:68773542-68773564 GACTACAGGTGTGCACCAACAGG + Exonic
1098965361 12:76782383-76782405 TTCTCCAGGAATGCAGCAGCAGG - Intronic
1100662617 12:96716662-96716684 GCCTCCAGGATAGCAGCACTTGG - Intronic
1101918267 12:108912613-108912635 GACTGCAGGAGTCCAGCCACCGG - Exonic
1102865670 12:116372170-116372192 GACTACAGGTGTGCACCAACAGG - Intergenic
1103731913 12:123033369-123033391 GCAGCCAGGACTGCAGCAAGTGG + Intronic
1107851094 13:44574348-44574370 GCCACTATGAGTGCTGCAACTGG - Exonic
1108561569 13:51649174-51649196 GTCTCAAGCAGTTCAGCAACTGG - Intronic
1108921730 13:55683339-55683361 GACTATAGGAGTGCAGCATCAGG + Intergenic
1113463603 13:110498356-110498378 GCATCTGGGAATGCAGCAACGGG + Intronic
1118002100 14:61532899-61532921 GCCTCCATCAGTGGAGCAGCTGG - Intronic
1119427750 14:74546837-74546859 GGAACCAGGAGTGCAGCAAGTGG + Intronic
1119679531 14:76581817-76581839 GCCTCCAGGCGTTCAGCTACAGG + Intergenic
1121043827 14:90773792-90773814 GCCTCCAGGGGTGGAGGAGCAGG - Intronic
1121304417 14:92897104-92897126 CCCTTCAGGACTGCAGCCACAGG + Intergenic
1121898139 14:97667906-97667928 GCCTCCATGAGTGGAGTAGCAGG - Intergenic
1122418562 14:101561586-101561608 GCCTCAAGGAGTGAAGCAGCAGG - Exonic
1122469822 14:101958769-101958791 GGCTCCAGCAGTGCAGCTAGAGG + Intergenic
1122534825 14:102454900-102454922 GGCTCCAGCAGTGCAGAACCTGG - Intronic
1124258312 15:28164003-28164025 GCCTCCTGGAGGGCAGCACTGGG + Intronic
1124500611 15:30224301-30224323 GCCGCGAGGAGTCCAGCGACTGG - Intergenic
1124742961 15:32314366-32314388 GCCGCGAGGAGTCCAGCGACTGG + Intergenic
1125452727 15:39825958-39825980 TCCACCATAAGTGCAGCAACAGG + Intronic
1127631227 15:60829192-60829214 GCCTCCAGGAGTTTTGCAGCAGG + Intronic
1128770395 15:70277626-70277648 TTCTCCAGGAGGGCAGCAACTGG - Intergenic
1129067098 15:72914499-72914521 GCCTCCATGACTGCCACAACAGG - Intergenic
1129164246 15:73767321-73767343 GACTCCAGGAGGGCAGCACGGGG + Intergenic
1129689988 15:77707723-77707745 GCCTCCAGGAGGGCAGACTCAGG + Intronic
1130043881 15:80429410-80429432 GCCTCCATGTGTTCACCAACCGG - Intronic
1130305779 15:82711332-82711354 GCCAGCAGGAGCGCAGCAGCGGG + Intergenic
1131005034 15:88971029-88971051 GGCTCCCAGAGTGCAGCAGCGGG + Intergenic
1131118911 15:89811012-89811034 GCCTCCATGAGGGTAGCACCAGG + Intronic
1135155567 16:20050050-20050072 GCCTCCAGGAGGGCAGAAACTGG - Intronic
1135309059 16:21391271-21391293 GACTACAGGCGTGCACCAACAGG + Intergenic
1135544166 16:23354647-23354669 GCCTCCAGGGGAGCTGCATCTGG + Intronic
1136305803 16:29370402-29370424 GACTACAGGCGTGCACCAACAGG + Intergenic
1136514449 16:30759513-30759535 GCCTCCAAAAGCCCAGCAACAGG + Exonic
1137003306 16:35250631-35250653 GCCTCATGGAGTGCAGGAAGAGG - Intergenic
1138496593 16:57412731-57412753 GCCTTCAGGTGGGCAGCACCAGG - Intronic
1141180770 16:81752205-81752227 GCCTCCAGGCTTCCAGCATCAGG - Intronic
1142223360 16:88865860-88865882 GCCTCCAGGAGTGCAGCAACAGG - Exonic
1143480668 17:7225978-7226000 CCCTCCAGCAGTGCAGCCTCCGG - Exonic
1144612926 17:16740424-16740446 ACTTCCAGGAGTACAGCAACTGG + Intronic
1144899858 17:18575168-18575190 ACTTCCAGGAGTGCAGCAACTGG - Intergenic
1145132586 17:20370501-20370523 ACTTCCAGGAGTGCAGCAACTGG + Intergenic
1147230607 17:39015219-39015241 GACTACAGGAGTGCACCACCAGG - Intergenic
1148157798 17:45433233-45433255 ACCTCCAGGAGTCCAGCCCCAGG + Intronic
1150328767 17:64277777-64277799 GACTCCAGGAATGCAGAAATTGG + Intergenic
1153753290 18:8255764-8255786 CCCTCCAGGAGGGCAGCACAAGG - Intronic
1154251562 18:12749263-12749285 GATTCCAAGAGTGCAGAAACGGG - Intergenic
1154316050 18:13304099-13304121 GAGTCCAGGACTGCAGCAGCAGG - Intronic
1158448230 18:57539838-57539860 ACCTTCAGGAGGGCAGAAACAGG + Intergenic
1160723597 19:608143-608165 GCCGCGAGGAGTCCAGCGACTGG - Exonic
1161477077 19:4492007-4492029 GCCTCCAGGAGCCCACCATCTGG + Intronic
1164685139 19:30161502-30161524 GCCTCCAGGCCTGCAGCTAGTGG - Intergenic
1164999519 19:32749466-32749488 GCCCCACGGAGTGCAGCACCCGG - Intronic
1165187309 19:34033122-34033144 GCCTCCAGGAGTGCAGAGGCAGG + Intergenic
1165767509 19:38360496-38360518 ACCTCCTGGAGGGCAGCTACCGG + Exonic
1167821446 19:51932128-51932150 GCCTCCAGGAGCCCAGCGCCAGG + Intronic
1168074069 19:53969640-53969662 GGCTCCAGGGGTGTAGAAACGGG + Intronic
1168281246 19:55306519-55306541 GGGCCCAGGAGTGCAGCAGCAGG + Intronic
1168634967 19:57989056-57989078 GCCTGGACCAGTGCAGCAACAGG + Intronic
927200534 2:20575557-20575579 GCCTCCAGGGATGCTGCAAGAGG - Intronic
931438964 2:62273802-62273824 ACCTCCATGTGTTCAGCAACGGG - Intergenic
935389623 2:102536688-102536710 GCATCCAGTAGTGCAGCAGAGGG + Intergenic
935890797 2:107675526-107675548 GCCCCCACGATTGGAGCAACAGG - Intergenic
936004427 2:108870382-108870404 GACTCCAGTAATGCATCAACTGG - Intronic
936145934 2:109980652-109980674 CCCTCCAGGAGCGCACCATCTGG - Intergenic
936198756 2:110390826-110390848 CCCTCCAGGAGCGCACCATCTGG + Intergenic
937089840 2:119198823-119198845 GATTCCAGCAGTGCAGCATCCGG - Intergenic
937222552 2:120350146-120350168 GCCTCCAGGATACCAGCAAATGG + Exonic
938014800 2:127858245-127858267 GCCTCCAGGACCTCACCAACCGG - Intergenic
938168791 2:129056840-129056862 CCCTCCTGGACTGCAGCCACGGG + Intergenic
939126127 2:138179720-138179742 GCTTCCAGGAGTGCAGAGAAGGG - Intergenic
939672574 2:145031477-145031499 TCTTCCAGGATTGCAGCACCAGG - Intergenic
940846792 2:158650864-158650886 GCAGCAGGGAGTGCAGCAACTGG + Intronic
943679096 2:190749065-190749087 TCCTCCAGGAGGGGAGGAACTGG - Intergenic
1169258534 20:4118310-4118332 GGCTCCTGGAGAGCAGCAATGGG - Intergenic
1170141439 20:13128826-13128848 GACTACAGGTGTGCACCAACAGG + Intronic
1172501943 20:35433844-35433866 GATTCCAGGAGTGCAGGAAGGGG + Exonic
1172756788 20:37290820-37290842 GCCTCCAGGAGTTCAAGACCAGG - Intronic
1175911043 20:62405753-62405775 CCCTGCAGGTGTGCAGCAAAGGG - Intronic
1178929129 21:36802230-36802252 GCCTCCAAGATTGCAGCATAAGG + Intronic
1179576917 21:42313549-42313571 CCCCCAAGGAGTGCAACAACCGG - Exonic
1180189280 21:46154874-46154896 GCCTCCCAGAGCGCAGCACCAGG - Intronic
1180662723 22:17482669-17482691 GACTCCAGGCGTGCACCACCAGG + Intronic
1182047781 22:27289154-27289176 GGCTCCTGGGGAGCAGCAACTGG + Intergenic
1182089736 22:27585959-27585981 GACTCTTGGGGTGCAGCAACAGG - Intergenic
1182279424 22:29209276-29209298 GCCTCCAGGAGGGGAGAAACAGG - Intronic
1182559816 22:31150803-31150825 GCCACCAGGGGTGCACCACCAGG - Intergenic
1182763747 22:32743749-32743771 GTCTCCAGGAGGGAAGGAACAGG - Intronic
1183027456 22:35076533-35076555 GCCTACAGGAGGGCTGCAAAGGG + Intronic
1183279525 22:36924470-36924492 GCCCACAGGAGTGCAGCGCCTGG + Intronic
1183284081 22:36951835-36951857 GCCCACAGGAGTGCAGCGCCTGG - Intergenic
1185234920 22:49706167-49706189 GCCTCCAGGTGCGCAGCTCCGGG + Intergenic
949896050 3:8768280-8768302 GTCTCCAGGAGTGGAGCCCCGGG - Exonic
950504004 3:13382430-13382452 AGCTCCAGGAGGGCAGGAACCGG + Intronic
954262934 3:49452935-49452957 GCCTCCAGGAGTCCACAAACTGG + Intergenic
954878012 3:53815855-53815877 GCCTGCAAGAGTGCAGAAACAGG - Exonic
955699282 3:61667665-61667687 GACTGCAGGTGTGCAGCACCAGG - Intronic
956302143 3:67783610-67783632 GTCTCCAGGAGTGCAACTGCTGG + Intergenic
958582166 3:96040548-96040570 GTCTCCAGCAGTTCATCAACTGG + Intergenic
960721821 3:120631991-120632013 GCCTCCAGGACTGCACCTCCAGG + Intronic
960921813 3:122754830-122754852 GCCTCCAGGTGTGGGCCAACGGG - Intronic
962092805 3:132262867-132262889 GGCCCCAGGAGAGCAGTAACAGG - Intronic
963419879 3:145048175-145048197 TCCTCCAAGGGTACAGCAACAGG + Intergenic
965530734 3:169768019-169768041 GCCTCATGGTGTGCAGCAACTGG - Exonic
965911458 3:173782624-173782646 GCCCCCAGGAGAGCAGGAAAGGG + Intronic
966290351 3:178349004-178349026 GACTTCAGGAGTGAAGCCACAGG + Intergenic
966943672 3:184762405-184762427 CCCTCAAGGAGTGCAGGATCCGG - Intergenic
967860605 3:194148592-194148614 GCCTTCACGACTGCAGAAACTGG + Intergenic
967891070 3:194364988-194365010 GCCTCTAGGAGCCCAGCACCTGG + Intronic
969574004 4:8025821-8025843 GCCTCCTGGCATGGAGCAACAGG + Intronic
969868306 4:10089612-10089634 GCCTGCAGGTGGGCAGCAAGAGG - Intronic
969872719 4:10115006-10115028 CCCTCCAGGAGGCCAGCAACTGG - Intronic
972023924 4:34352652-34352674 GCCTCCCGAAGTGCAATAACAGG + Intergenic
973039992 4:45457557-45457579 GGCTCCCAGAGTGCAGCAGCAGG + Intergenic
977031309 4:91888009-91888031 GGCTCCATGAGTGTAGAAACAGG - Intergenic
981823617 4:148914520-148914542 GCAGCCAGGACTGCAGCAACAGG + Intergenic
983172343 4:164550104-164550126 GGCTCCAGGAAGGCAGCAGCAGG - Intergenic
985856209 5:2429424-2429446 CCACCCAGGAGTGCAGAAACGGG - Intergenic
985872696 5:2569962-2569984 GCCTGCAGGGGTGCAGGAAGTGG - Intergenic
986602793 5:9490583-9490605 GCCTGCTTGAGTACAGCAACTGG - Intronic
986863350 5:11953611-11953633 CCCTCCAGGAGTTCAGCACAGGG + Intergenic
987178143 5:15338005-15338027 GCCTCCAAACATGCAGCAACAGG - Intergenic
990618873 5:57538563-57538585 GCCTGCAGAGCTGCAGCAACTGG - Intergenic
991977770 5:72199748-72199770 GCCTCCAGGAGGAAAGCAACAGG + Exonic
994911161 5:105910104-105910126 GCCTCAAGAAGGGCAGTAACAGG + Intergenic
998834868 5:146193872-146193894 GACTACAGGAGTGCACCATCTGG + Intergenic
999398540 5:151246890-151246912 TCCTCCAGGAAAGCAGAAACAGG - Intronic
1000891881 5:166810636-166810658 GGCTCCTGCAGTGCAGCAGCGGG + Intergenic
1002680606 5:180960001-180960023 GCATCCATGAGTGCAGAAGCTGG - Intergenic
1002807848 6:594569-594591 TTCTCCAGGAGTACAGCAAGAGG + Intronic
1003246036 6:4382983-4383005 GCCAGCAGGAATGAAGCAACTGG + Intergenic
1009229342 6:61043552-61043574 GCCCCCAGGAGACCAGCAAAAGG - Intergenic
1011338406 6:86285216-86285238 GGCTCCTGCAGTGCAGCAGCAGG + Intergenic
1012523297 6:100146462-100146484 GCCTCCAGGTCTGCAGCCTCTGG - Intergenic
1014750156 6:125246033-125246055 GCCTCCAGGAAGGCAGCCAGTGG - Intronic
1015541433 6:134317860-134317882 GCCTCCAGGAGCGCATCACCTGG - Exonic
1017426145 6:154323348-154323370 GCCTCCAGGAATTCTGCAGCAGG + Intronic
1018835129 6:167477408-167477430 GGCTACAGGTGTGCACCAACAGG + Intergenic
1018972804 6:168540266-168540288 GCCTCTAGGAGGGCACCAAATGG - Intronic
1019150202 6:170000528-170000550 GCCTCCAGGGGGACAGCAGCAGG - Intergenic
1020120445 7:5500377-5500399 CCCTCCAGGAGTGCAGAGGCTGG - Intronic
1020442811 7:8236741-8236763 GCTTCCATGAGTGGAGCAAATGG - Intronic
1020739841 7:12000827-12000849 GTTCCCAGAAGTGCAGCAACTGG + Intergenic
1021367538 7:19798985-19799007 GCCTCCAGCAGTACATCAAGTGG - Intergenic
1026296391 7:69056576-69056598 GTCACCAGCAGTGCAGCAAAGGG - Intergenic
1032326741 7:130936051-130936073 GCCTTCAGGTGTCCAGCAAGTGG - Intergenic
1033645999 7:143304876-143304898 GGCTTCAGGAGAGCAGCAAACGG - Intronic
1034893599 7:154860707-154860729 GCCTCCTTGGGTGCAGCAGCAGG + Intronic
1035415254 7:158678295-158678317 GCCTCAAGAGGTGCAGCACCAGG + Intronic
1035618294 8:1018513-1018535 GCCTCCAGGCCTTCAGCCACTGG - Intergenic
1035690330 8:1555584-1555606 GTCTGCAGGAGTGCAGGAGCTGG + Intronic
1040337582 8:46423879-46423901 GCCTCCAGGACTGTACCAGCGGG + Intergenic
1047151710 8:122271457-122271479 GCATCCAGGAGTGGAGGAGCGGG + Intergenic
1050921323 9:11204664-11204686 GACTCCAGGAGTGCACCTAGCGG + Intergenic
1051126153 9:13808057-13808079 GCCTCCTGGAGTGTACAAACTGG + Intergenic
1053485465 9:38451283-38451305 GCTTAAAGGAGTGCTGCAACTGG - Intergenic
1056164964 9:83932222-83932244 GCCTCCTGGTGTGTTGCAACAGG - Intergenic
1056619954 9:88204122-88204144 GCCTACAGGTGTGCACCACCAGG - Intergenic
1057185926 9:93057754-93057776 GCCTCCAGGAGCGCAGAAGGTGG - Intergenic
1059536537 9:115086207-115086229 GCCCCAGGGACTGCAGCAACAGG - Exonic
1060186886 9:121568945-121568967 GCTTCCAGGAGATCAGCAACCGG - Intronic
1060341895 9:122784848-122784870 GCTTCCAGGGGTACAGAAACAGG - Intergenic
1187576033 X:20556512-20556534 GCATCCAGATGTGCAGCACCAGG + Intergenic
1187672334 X:21680607-21680629 GCCTCCATTAGTGCTGCCACTGG + Intergenic
1192366446 X:70477655-70477677 TCCTCCAGGATTTCAGGAACAGG + Intronic
1192478134 X:71461295-71461317 GGCTCCAGAAGTGTAGCAAGGGG + Intronic
1199773329 X:150989243-150989265 GCATCCAGGAGACCAGCAGCAGG - Exonic