ID: 1142226759

View in Genome Browser
Species Human (GRCh38)
Location 16:88881336-88881358
Sequence GAAGGGCCCCGCTCCCGCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142226759_1142226764 16 Left 1142226759 16:88881336-88881358 CCGCGGCGGGAGCGGGGCCCTTC 0: 1
1: 0
2: 1
3: 16
4: 105
Right 1142226764 16:88881375-88881397 CGCTGTAGCGCCGCGCCCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 40
1142226759_1142226760 -10 Left 1142226759 16:88881336-88881358 CCGCGGCGGGAGCGGGGCCCTTC 0: 1
1: 0
2: 1
3: 16
4: 105
Right 1142226760 16:88881349-88881371 GGGGCCCTTCTTTGTGTCCTCGG 0: 1
1: 0
2: 0
3: 32
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142226759 Original CRISPR GAAGGGCCCCGCTCCCGCCG CGG (reversed) Exonic
900615738 1:3564927-3564949 CCATGGCCCCGCTCCAGCCGAGG + Intronic
901930258 1:12592573-12592595 GCAGGGCCCCACTCCCTCCCGGG - Intronic
902823380 1:18956710-18956732 CACTGGCCCCGCCCCCGCCGCGG + Intergenic
903115699 1:21176773-21176795 GAAGGGCGCCGCTTCCTCCGGGG - Exonic
904532955 1:31181400-31181422 GAAGGCCCCAGCTCACGCCAAGG + Exonic
905025354 1:34845841-34845863 GAAGCGGGCCGCTGCCGCCGGGG - Intronic
907908475 1:58806713-58806735 GCAGGGCCACGCTCCCTCCAAGG + Intergenic
908572177 1:65421005-65421027 GGAGGGCGCCGCTCTCGCCGAGG - Intronic
912542397 1:110427013-110427035 GAAGGGCCACGCTGCCTCTGGGG - Intergenic
913062870 1:115223904-115223926 GAATGGCACCCCTCCCGCCTTGG - Intergenic
922986700 1:229871611-229871633 GAATGGCCCTGCTCCAGCCCAGG - Intergenic
1062863758 10:831681-831703 GAAGGGCACTGCTTCCGCAGTGG + Intronic
1066464874 10:35642244-35642266 TAAGGGCGCTGCTCCCGCCGAGG - Exonic
1067142351 10:43667992-43668014 GAGGGGCCCCGCTTGCGCAGGGG + Intergenic
1067682809 10:48451044-48451066 GAAGGGCCCACCTCCCCGCGCGG - Exonic
1068600244 10:58949177-58949199 GAAGGGCCCCTCTTCCGCAGTGG + Intergenic
1070742793 10:78913617-78913639 GAAGGGCCCAGCTGCCTCCTGGG + Intergenic
1071346359 10:84697803-84697825 GAAGGGCCCTGCTCACCCCAGGG - Intergenic
1076032816 10:127173994-127174016 GAAAGGCCCAGCTCCAGCAGTGG - Intronic
1076116840 10:127907032-127907054 CCAGGCCCCCGCCCCCGCCGCGG + Intergenic
1076679724 10:132165504-132165526 GAAGGGACGGGCTCCCTCCGAGG + Intronic
1083258092 11:61508848-61508870 GCACGGCCCCCCTCCCGGCGCGG + Exonic
1083378583 11:62245691-62245713 GCAGGGCTCCGCTCCCTCTGGGG + Intergenic
1083681551 11:64354047-64354069 GGGGGGCCCCCCTCCCGCCGGGG - Exonic
1084681388 11:70668469-70668491 GCAGGGCCACGCTCCCTCCGGGG - Intronic
1084787684 11:71453030-71453052 GAAGGGCCCCGCCCCCGCCCCGG - Intergenic
1091883411 12:3998332-3998354 GAAGGGCCCAGCTGCCACCGTGG + Intergenic
1092209658 12:6638110-6638132 GGAGGGCGCAGCTCCCACCGTGG + Exonic
1094550076 12:31442308-31442330 GCAGGGCCACGCTCCCTTCGAGG - Intronic
1102036148 12:109771539-109771561 GAAGGGCCTGGGTCCCGCCCTGG - Intergenic
1108856571 13:54800083-54800105 GAAGGAGCCCGCTCCGGCCTTGG + Intergenic
1113625813 13:111845658-111845680 GGAGGTGCCCGCTCTCGCCGCGG + Intergenic
1113695431 13:112342650-112342672 TCAGGGCCCCACTCCCTCCGGGG - Intergenic
1117309786 14:54509921-54509943 GTAGAGCCCGGCTCCAGCCGCGG - Exonic
1119189556 14:72671188-72671210 GAAGAGCCTCGCTCCTGTCGAGG - Exonic
1122282631 14:100633077-100633099 GCAGGGCCACGCTCCCTCGGGGG + Intergenic
1124441407 15:29688695-29688717 GAAGGGCCTCACTCACGCCAGGG + Intergenic
1127713356 15:61623746-61623768 GAAGGGACCTGCTCTCGCAGTGG - Intergenic
1129150165 15:73683721-73683743 ACAGGGCCCCGCTCCAGCCTGGG - Intergenic
1131195617 15:90352434-90352456 GCAGCGCGCCGCTGCCGCCGCGG - Intronic
1132591682 16:728896-728918 GCACGGCCCCTTTCCCGCCGCGG + Intronic
1132839493 16:1972175-1972197 GAAGCGGCCCACTCCGGCCGCGG - Exonic
1133076344 16:3283673-3283695 GAGGAGCCCCGCTCCAGCCCAGG - Exonic
1133232094 16:4371776-4371798 GAGAGGCCCCGCCCCTGCCGCGG + Intronic
1133315365 16:4880291-4880313 CAAGGGCCCGGCTCCCTCCATGG - Exonic
1136392440 16:29974077-29974099 GCACGGCCCCTCTCACGCCGGGG - Exonic
1138478061 16:57283802-57283824 GAAGAGCCCGGCTCCCGCGCGGG + Intronic
1139806135 16:69566448-69566470 GAGGGGTCCCCGTCCCGCCGGGG + Intronic
1140927657 16:79599413-79599435 GATGGGCCCCGCCGCCGCCGTGG - Exonic
1142226759 16:88881336-88881358 GAAGGGCCCCGCTCCCGCCGCGG - Exonic
1142518807 17:491198-491220 GCGGGGACCCGCTCGCGCCGGGG + Intergenic
1144171820 17:12665712-12665734 GGCGGGCCCCGCAGCCGCCGAGG - Intergenic
1144840732 17:18184141-18184163 TAAGGACCCCCCTCCCTCCGGGG + Intronic
1147429571 17:40363152-40363174 GAAGGGCCGCCCGCGCGCCGGGG - Exonic
1147758258 17:42782099-42782121 GAAGGGTCCCTCTCCAGCCCTGG + Intronic
1147890585 17:43713959-43713981 GAGGGGCCTCTCTCCCGGCGCGG + Intergenic
1151352547 17:73540212-73540234 GCAGGGCCCTGCTCCCTCGGAGG - Intronic
1151838006 17:76596719-76596741 GAAGGGTCCCTCTCCTGCCAGGG + Intergenic
1151954439 17:77373426-77373448 GCAGGGCCCGGGCCCCGCCGGGG + Intronic
1152111563 17:78359985-78360007 GCCCGGCCCAGCTCCCGCCGCGG - Exonic
1152816032 17:82408591-82408613 GAGGGGCCCTGCTCCCTCCCAGG + Intronic
1155902692 18:31410922-31410944 GCAGGCGCCCGTTCCCGCCGTGG - Intronic
1158137580 18:54224174-54224196 AAAGGGACCGGCTCCCGCCGGGG + Exonic
1162535871 19:11262529-11262551 GAAGGGCCCCGCCCCCGCGCCGG - Intergenic
1163793372 19:19321205-19321227 GAGCGGCCCCCCACCCGCCGCGG - Intronic
1164693728 19:30228336-30228358 CAGGGCCCCCGCCCCCGCCGGGG + Intronic
1166367380 19:42284425-42284447 GACGGCCCCCGCGCGCGCCGGGG + Intronic
1166876560 19:45901458-45901480 GCAGGGCGCCGGGCCCGCCGCGG - Exonic
929781903 2:44962488-44962510 GAAGAGCCCCACTGCGGCCGGGG - Intergenic
931563466 2:63588915-63588937 AAAAGGCTCCGCTCCCGACGCGG - Intronic
945102506 2:206274954-206274976 GCCGCGCCCCGCCCCCGCCGCGG - Intronic
946416772 2:219543809-219543831 CAAGGGCCCCGCCCCCGGGGTGG + Exonic
947641466 2:231709757-231709779 AGAGCGCCCCGCTCCCGCCAAGG - Intronic
948080549 2:235202207-235202229 GCAGGGCCACGCTCCCTCTGGGG + Intergenic
948216715 2:236237816-236237838 GCAGGGCGCCGCGGCCGCCGGGG + Exonic
948852648 2:240715881-240715903 ACAGAGCCCCTCTCCCGCCGTGG - Exonic
948988717 2:241541264-241541286 GACAGGCCCCGCCCCCGCCGCGG - Intergenic
1168814738 20:728698-728720 GAGGGGCCCAGCTCCCGACAGGG - Intergenic
1169262382 20:4148593-4148615 CAGGGGCCCCCCTCCCGCAGGGG - Intronic
1172326815 20:34042221-34042243 GACGATCCCCGCTCCCGCCGAGG + Intronic
1176002077 20:62836719-62836741 GATGGCCCACGCTCCCGCCCCGG + Intronic
1180338070 22:11597732-11597754 GAGGAGCCCGGCTCCAGCCGGGG + Intergenic
1180669277 22:17540705-17540727 GAAGTGCCCACCTCCCGCGGGGG - Exonic
1181135678 22:20764514-20764536 GAAGGGCCTCGCTCAGTCCGTGG + Intronic
1184155228 22:42662653-42662675 GTAGGGCCCCCATCCCGCCCCGG - Intergenic
1184838666 22:47039648-47039670 GAATGGCCCTGCTCCCCCAGGGG + Intronic
1185051035 22:48554078-48554100 GAAGAGCTCAGCTCCCGCCTGGG + Intronic
1185272156 22:49934661-49934683 GAAGGGCCCAGGTCCTGCAGGGG + Intergenic
1185313746 22:50170251-50170273 CGGCGGCCCCGCTCCCGCCGCGG - Intergenic
1185409216 22:50673866-50673888 GAAGGGCCCCGGGCCCTCCCCGG + Intergenic
952744372 3:36763889-36763911 GAAGGGCCCCCCTGCTGGCGAGG + Intergenic
953910933 3:46892739-46892761 GCAGGGCCCCGGCCCCGCCTTGG + Intronic
954412987 3:50379252-50379274 GCAGGGCCTCCCTCCCGCAGTGG + Intronic
975118520 4:70705023-70705045 GCCGCGCCGCGCTCCCGCCGGGG + Intronic
985671077 5:1206985-1207007 GAAGGGCCACGCTGCAGCCGGGG - Intronic
998385203 5:141753457-141753479 GCAGGGCCTCTCTCCAGCCGCGG - Intergenic
1007764492 6:44152709-44152731 GCAGGGCCCAGGTCCCGGCGCGG - Intronic
1012582109 6:100881515-100881537 GGAGCGTCCCGCTCCCGCCCTGG - Intergenic
1014098387 6:117483318-117483340 GCAGGGCCCAGCGCCGGCCGAGG - Intronic
1015729690 6:136335137-136335159 GTAGGGCCCTGCTCCCTCTGAGG + Intergenic
1018494626 6:164337218-164337240 GAAGGGCCTCTCTCCCACCACGG + Intergenic
1018945132 6:168342686-168342708 GCAGGGCCCCGGTGCCGCCAGGG - Intergenic
1019179124 6:170176152-170176174 AAGGGGTCCTGCTCCCGCCGCGG + Intergenic
1019394233 7:808411-808433 GAAGGGCCCCTGACCCGCCTGGG - Intergenic
1020073156 7:5240618-5240640 GGAGGGCGCCTCTCCCTCCGGGG + Intergenic
1020131681 7:5562475-5562497 GAAGGCCCCTGCTCCCGCTGAGG - Intronic
1021805208 7:24348694-24348716 GAAGGGCCCCCCTCACTCCCAGG + Intergenic
1028852574 7:95552869-95552891 GAGGGAGCCCGCTCCCGCCTTGG + Intergenic
1030982355 7:116201025-116201047 GAAGGGCCATGCTCCCTCTGAGG - Intergenic
1032306037 7:130733496-130733518 GGCAGGCCCCGCCCCCGCCGCGG - Exonic
1034677027 7:152899207-152899229 GAAGGTCCCCACTTCAGCCGGGG - Intergenic
1034940347 7:155226607-155226629 CAACGGCCCCGCTGCTGCCGCGG + Intergenic
1037754119 8:21700468-21700490 GAACAGCCCCACTCCCACCGTGG + Intronic
1040039064 8:42897544-42897566 GACGGGCCCGGCTCCGGCCCGGG + Intronic
1043284868 8:78516252-78516274 GAGCGGCCCCGCTCCCCCCGTGG + Exonic
1045111194 8:98940598-98940620 GAAGGCCCCCGCGCCATCCGTGG + Intronic
1057304325 9:93903564-93903586 GAGGGGCCCAGCTCCTGCTGTGG - Intergenic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1061666626 9:132163675-132163697 CAGGGGCCCCGCGCCCGCCGCGG + Intronic
1061714813 9:132512126-132512148 GCAGGGCCACGCTCCCTCTGCGG + Intronic
1185451184 X:281214-281236 GAAGGGGCCAGCTCCCTCCTGGG + Exonic
1185505524 X:630328-630350 GAAGCGCCCGGGTCGCGCCGGGG - Intronic
1189331250 X:40146221-40146243 GCGGGGCTCCGCTCCCGCGGAGG + Intronic