ID: 1142227179

View in Genome Browser
Species Human (GRCh38)
Location 16:88883227-88883249
Sequence TGAGGTTACCCATTGATTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142227179_1142227183 -9 Left 1142227179 16:88883227-88883249 CCGTGAATCAATGGGTAACCTCA 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1142227183 16:88883241-88883263 GTAACCTCACTGGGAGGAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 146
1142227179_1142227186 20 Left 1142227179 16:88883227-88883249 CCGTGAATCAATGGGTAACCTCA 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1142227186 16:88883270-88883292 TCATTCGCGGCAGCCCTCTGCGG 0: 1
1: 0
2: 0
3: 3
4: 61
1142227179_1142227185 7 Left 1142227179 16:88883227-88883249 CCGTGAATCAATGGGTAACCTCA 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1142227185 16:88883257-88883279 GAGCTGGTCTCAGTCATTCGCGG 0: 1
1: 0
2: 1
3: 2
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142227179 Original CRISPR TGAGGTTACCCATTGATTCA CGG (reversed) Intronic
900668588 1:3834282-3834304 TGGGCTTACCCATTGAAGCAGGG - Intronic
900668597 1:3834335-3834357 TGGGCTTACCCATTGAAGCAGGG - Intronic
900668606 1:3834388-3834410 TGGGCTTACCCATTGAAGCAGGG - Intronic
900668615 1:3834441-3834463 TGGGCTTACCCATTGAAGCAGGG - Intronic
900843127 1:5071842-5071864 TGAGGTTACCTACTGAGTAAGGG - Intergenic
901514729 1:9737345-9737367 TGCGCTTCCCCATTGCTTCATGG - Intronic
904713916 1:32452460-32452482 TGAGCTCACCTATTGTTTCAAGG + Intergenic
907500044 1:54872275-54872297 TGAGGTTGGACATTGATTTATGG - Intronic
913072024 1:115307996-115308018 TGGGGTTTCCCATTGATGCTTGG + Intronic
913653133 1:120937320-120937342 TGAGGTGACTCCTTGATTCTAGG - Intergenic
914167970 1:145191720-145191742 TGAGGTGACTCCTTGATTCTAGG + Intergenic
914518825 1:148397407-148397429 TGAGGTGACTCCTTGATTCTAGG - Intergenic
914643316 1:149631474-149631496 TGAGGTGACTCCTTGATTCTAGG - Intergenic
917861536 1:179149899-179149921 TGAAATTACTCATTGATTTATGG - Intronic
918479529 1:184963308-184963330 TGATGTTAACCATAGATTTATGG - Intronic
919548820 1:198958796-198958818 TGAAATTACTCCTTGATTCATGG + Intergenic
919612894 1:199768137-199768159 TGAAATTACTCCTTGATTCATGG - Intergenic
921304193 1:213779454-213779476 TTAGCTTACTCATGGATTCATGG + Intergenic
921450330 1:215297920-215297942 TGAGGTATCCCATTGATGTATGG - Intergenic
921807042 1:219467109-219467131 TTAGGTAACCCAGTGGTTCAGGG + Intergenic
923357204 1:233170398-233170420 TGAGGTTGCCCATATATTCATGG + Intronic
924021368 1:239787305-239787327 TGAGGTTAGCTCTGGATTCAGGG + Intronic
1067456705 10:46424328-46424350 TGAGGCTACCCAAAGCTTCATGG + Intergenic
1067630496 10:47960311-47960333 TGAGGCTACCCAAAGCTTCATGG - Intergenic
1068361293 10:55977262-55977284 GGACCTTCCCCATTGATTCACGG + Intergenic
1069128247 10:64665516-64665538 TGAGGTTTTCCATTTCTTCATGG + Intergenic
1071347288 10:84704844-84704866 TGAGGTTCTCCATTCATTCCTGG + Intergenic
1071691876 10:87829083-87829105 TGAAGTTACTCTTTGATCCATGG - Intronic
1071937760 10:90549837-90549859 TGAGATTATACACTGATTCATGG + Intergenic
1075871634 10:125775465-125775487 TCAGGTTAAGCATCGATTCATGG + Intronic
1076265183 10:129104034-129104056 TGAGGTTTCCCATGGTTTCATGG - Intergenic
1084137903 11:67200855-67200877 TGAGATTACTCCTTGATCCATGG - Intronic
1086323471 11:85674231-85674253 TGAAGTAACTCCTTGATTCATGG + Intronic
1093031792 12:14295393-14295415 TGAGATTACATACTGATTCATGG - Intergenic
1095605894 12:44067445-44067467 TGAAGTTACTCCTTGATCCATGG + Intronic
1099864215 12:88258759-88258781 AGAGGTTAGGCATTGATTCCTGG - Intergenic
1101235834 12:102788807-102788829 TGAGGTTACAAAATTATTCATGG + Intergenic
1102510294 12:113410538-113410560 TGAGGTTACCCACGAAGTCAGGG + Intronic
1104514392 12:129411121-129411143 TAATGTTTCCCATTGATTCCTGG + Intronic
1111935446 13:94552367-94552389 TCATATTCCCCATTGATTCATGG - Intergenic
1113701179 13:112389836-112389858 TGAGGTTACCCACTCAATAAGGG + Intronic
1114190941 14:20438948-20438970 TGAGGATACACATTTCTTCATGG - Intergenic
1116115511 14:40644900-40644922 TGAGATTACCAATTAATTCAGGG + Intergenic
1117779097 14:59213919-59213941 TGAGGTTGCCCTTTGATAGATGG - Intronic
1119452493 14:74724078-74724100 TGAGAATTCCCATTGCTTCATGG - Intronic
1125310602 15:38374598-38374620 TGAGGTTAATCACTGATTTATGG - Intergenic
1128795340 15:70462600-70462622 CAAGGTTACCCAGTGCTTCAGGG + Intergenic
1130809525 15:87361853-87361875 TGTAGTTACCCATTCATTCATGG + Intergenic
1132231282 15:100186107-100186129 TGATGTTACTCATTGATCCCAGG - Intronic
1135492635 16:22923077-22923099 TCAGCTTTCCCATAGATTCAAGG + Intergenic
1142227179 16:88883227-88883249 TGAGGTTACCCATTGATTCACGG - Intronic
1143280057 17:5747204-5747226 TGAGGATACGCAGTGATACACGG - Intergenic
1146267773 17:31464365-31464387 TGATGTTTCCCTTTGATTCTGGG - Intronic
1153704538 18:7732370-7732392 TGAGAATACCTATTGCTTCAAGG + Intronic
1154249317 18:12730118-12730140 TGAGATTACTCCTTGATCCATGG + Intergenic
1158813556 18:61066979-61067001 TGAGGTGATCCATTGATACTTGG - Intergenic
1158938058 18:62383297-62383319 AGAGGTTACCCAGTGGGTCAGGG + Intronic
1160047272 18:75398543-75398565 TGATATTAGCCATTGCTTCAAGG + Intergenic
1163584215 19:18155347-18155369 CAAGGTCACCCAGTGATTCAGGG + Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1165020559 19:32920825-32920847 TGAGGTCACCCAGTGATTCAGGG + Intronic
926505171 2:13705309-13705331 TTAGGTTGCCCATTAAATCATGG + Intergenic
930753979 2:54957745-54957767 TGAGGCTCCTCATTGCTTCATGG - Intronic
931509583 2:62976129-62976151 TGAGGTCACACACTGAATCAAGG - Intronic
931931799 2:67146236-67146258 TCACATTACCAATTGATTCAGGG + Intergenic
934864738 2:97797516-97797538 TCTGTTTACCCAATGATTCAAGG - Exonic
935288878 2:101592257-101592279 TGAAGTTACTCCTTGATTCATGG + Intergenic
935695534 2:105767794-105767816 GGAGGATACCCATTGTCTCAGGG + Intronic
936702360 2:115027806-115027828 TGAGGTTTCCTATTCCTTCATGG + Intronic
936920329 2:117682051-117682073 TGAAATTACTCCTTGATTCATGG - Intergenic
937342914 2:121103200-121103222 TTAAGTTACACATTAATTCAAGG - Intergenic
939114073 2:138040570-138040592 TGAAGTTTCCCACTGATTCCAGG - Intergenic
940605849 2:155923754-155923776 TGAGGTTACATACTGATTCATGG - Intergenic
941160805 2:162031980-162032002 TGTAGTAACCCATTCATTCAGGG - Intronic
941852993 2:170202619-170202641 TGATGTTATCCATTGGGTCATGG + Intronic
943694987 2:190917649-190917671 TGAAGTTACTCCTTGATCCATGG + Intronic
944661745 2:201927097-201927119 TGAGTTTCCCCATTGACTTAGGG + Intergenic
945126263 2:206514111-206514133 TGAAATTACTCCTTGATTCATGG - Intronic
1168889779 20:1287500-1287522 TGAGGTTACCCAGAAAGTCAGGG - Intronic
1168918496 20:1511336-1511358 TTAGATTACCCATTGACTCTGGG + Intergenic
1169032749 20:2423825-2423847 TAAAATTACTCATTGATTCATGG + Intronic
1169716438 20:8623925-8623947 TGAGGATAAGCATTGATTCAAGG + Intronic
1176726126 21:10434492-10434514 TGAAATTACTCATTGATGCATGG + Intergenic
1180288244 22:10772626-10772648 TGAAATTACTCATTGATGCATGG - Intergenic
1181547577 22:23611079-23611101 TGGTGTTACCCATTGCTCCATGG - Intronic
1182555394 22:31126054-31126076 TGAGGTTAGCCATTCTTCCAGGG + Intronic
1183268093 22:36842823-36842845 TGAAATTACTCCTTGATTCATGG - Intergenic
951667185 3:25140138-25140160 TGAAGTTACTTCTTGATTCATGG - Intergenic
952709813 3:36418675-36418697 TGAGATTAACCATGGATTGAAGG + Intronic
956526727 3:70172166-70172188 TGTGGTTACCAATTGAATAAAGG - Intergenic
958613519 3:96459208-96459230 TGAGGTTGCCTATTCCTTCATGG - Intergenic
959178233 3:102945092-102945114 TGAAGCTAGCCATTCATTCAAGG - Intergenic
961907556 3:130278053-130278075 TTAGGCTACCAATTGAATCATGG - Intergenic
962029003 3:131579427-131579449 TGAAATTACCCCTAGATTCATGG - Intronic
965831150 3:172790680-172790702 TGAAATTACTCCTTGATTCATGG + Intronic
967021558 3:185527546-185527568 TGAGGTTTCCCGTTGAATAAAGG + Exonic
970026956 4:11633960-11633982 TGAGTTTACCCATATATTAATGG - Intergenic
970528854 4:16961785-16961807 TGAGATTACTTATTGATCCATGG - Intergenic
971604978 4:28647228-28647250 TCAGCTTATCCATTCATTCATGG + Intergenic
973702091 4:53547493-53547515 TGAGATGACCTAGTGATTCAAGG - Intronic
974513028 4:62869895-62869917 TGAAGATACTCATTTATTCAAGG + Intergenic
982620768 4:157701694-157701716 TGAGCTTGCCCATTCAGTCATGG - Intergenic
990621123 5:57559834-57559856 TGATATTGCCCTTTGATTCATGG + Intergenic
991558838 5:67926710-67926732 TGATGTTAACCATAGATTTATGG + Intergenic
991574807 5:68091774-68091796 TCAGCTGACCTATTGATTCATGG + Intergenic
991946833 5:71906355-71906377 AGAGGTTAGGCATTGATTTATGG - Intergenic
992540359 5:77758331-77758353 TGATGTTATCCATGGATTCCAGG + Intronic
993412504 5:87591281-87591303 TGCGATTACATATTGATTCATGG - Intergenic
993603241 5:89954850-89954872 TTAGGTTTCCAATTAATTCAAGG + Intergenic
993806845 5:92420958-92420980 TTAGATTAACCATTAATTCATGG - Intergenic
995445823 5:112242732-112242754 TGAAGTTACCTCTTGATCCATGG + Intronic
996594303 5:125183992-125184014 TGAGGTGACACATTGCTTCAGGG - Intergenic
998064486 5:139146815-139146837 TGAGCTTACCCAAGAATTCACGG - Intronic
999259129 5:150227400-150227422 TGAGGCTACACAGTGATTTAGGG - Intronic
999523002 5:152371781-152371803 TGAGGTTAACCATTGGTTACAGG + Intergenic
999734936 5:154506035-154506057 TGAAGTTACCCATTAGGTCAGGG + Intergenic
1001385895 5:171338417-171338439 TGGGGTTATCCAGTGAGTCAGGG + Intergenic
1001781395 5:174371939-174371961 TGAGGTTACCAATGGGGTCAAGG - Intergenic
1013629215 6:111969215-111969237 TGAATTTACCCATTCATCCATGG - Intergenic
1013816512 6:114104752-114104774 TCAAGTTACCCATGGATTAAGGG + Intronic
1016162298 6:140897206-140897228 TGAGGTTACAAACTGCTTCATGG - Intergenic
1017422370 6:154285866-154285888 TTATGTTACCAAGTGATTCAAGG - Intronic
1020423929 7:8042206-8042228 TGAAATTACTCCTTGATTCACGG - Intronic
1025991482 7:66500641-66500663 TAATGTTATCCATTGATTCATGG - Intergenic
1026256046 7:68712321-68712343 TGATATTACTCTTTGATTCATGG + Intergenic
1027206514 7:76104320-76104342 TAATGTTATCCATTGAGTCATGG - Intergenic
1027213747 7:76170499-76170521 TAATGTTATCCATTGATTCATGG - Intergenic
1030727581 7:112943494-112943516 TGAGGTAACCCGTAGATTCTGGG + Intergenic
1031774452 7:125889986-125890008 TGAAGTGACCTATTGATTAATGG - Intergenic
1036218684 8:6902450-6902472 TTAGTTTGCCCATTTATTCATGG + Intergenic
1036478096 8:9112277-9112299 TGAAATTACTCCTTGATTCATGG + Intronic
1043325808 8:79049666-79049688 TTAGTTTATTCATTGATTCAGGG + Intergenic
1044645700 8:94441013-94441035 CGATGTTACCCATAGATTCCAGG + Intronic
1044790929 8:95846211-95846233 TGATGATTCCCTTTGATTCATGG + Intergenic
1046099353 8:109597041-109597063 TAAGGTGACCCATTGTCTCATGG + Intronic
1047106431 8:121735662-121735684 TGAAATTACTCTTTGATTCATGG + Intergenic
1050600399 9:7244585-7244607 TGAAGTTATCCATTTCTTCATGG + Intergenic
1051974848 9:22937116-22937138 TGAAATTAGCCATTGATCCAAGG + Intergenic
1053421278 9:37980746-37980768 TGAGATTACTCCTTGATCCATGG + Intronic
1055618857 9:78102317-78102339 AGTGGTAACCCAGTGATTCATGG + Intergenic
1062187010 9:135223619-135223641 TGTGGCTCCCCATTGTTTCAGGG - Intergenic
1187026740 X:15443414-15443436 TGAAATTACTCCTTGATTCATGG - Intronic
1192193439 X:69012844-69012866 TGATTTGACCCATTAATTCAAGG - Intergenic
1193622214 X:83768971-83768993 TTAGGTTTCCTATTGCTTCAAGG + Intergenic
1194940296 X:100001242-100001264 TGAAATTACTCCTTGATTCATGG - Intergenic
1195281799 X:103342824-103342846 TGAGTATACCCATTTGTTCAAGG + Intergenic
1196520597 X:116666979-116667001 TGAGGTTACAAACTGATTTATGG - Intergenic
1198104472 X:133449183-133449205 AGAGGCTACCCATGGAATCAGGG + Intergenic
1199245212 X:145596607-145596629 TGAGGTTTCCTATTTCTTCATGG - Intergenic
1199369716 X:147033431-147033453 TGAAATTACTCCTTGATTCATGG - Intergenic