ID: 1142230388

View in Genome Browser
Species Human (GRCh38)
Location 16:88897469-88897491
Sequence TGCTCCCTGAACGCCCGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142230384_1142230388 -5 Left 1142230384 16:88897451-88897473 CCACCTGGTAAGAGCCCATGCTC 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1142230388 16:88897469-88897491 TGCTCCCTGAACGCCCGCCATGG 0: 1
1: 0
2: 0
3: 7
4: 86
1142230383_1142230388 -2 Left 1142230383 16:88897448-88897470 CCACCACCTGGTAAGAGCCCATG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1142230388 16:88897469-88897491 TGCTCCCTGAACGCCCGCCATGG 0: 1
1: 0
2: 0
3: 7
4: 86
1142230385_1142230388 -8 Left 1142230385 16:88897454-88897476 CCTGGTAAGAGCCCATGCTCCCT 0: 1
1: 0
2: 1
3: 18
4: 156
Right 1142230388 16:88897469-88897491 TGCTCCCTGAACGCCCGCCATGG 0: 1
1: 0
2: 0
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142230388 Original CRISPR TGCTCCCTGAACGCCCGCCA TGG Intronic
904535075 1:31194098-31194120 TTCTCCCTGATCTCCCGCCAGGG + Intronic
907697947 1:56753025-56753047 TGCTCTCTGAACACCCAACATGG + Intronic
918149811 1:181788619-181788641 TGCTCCCTGAACTCCAGACATGG - Intronic
922616878 1:226965828-226965850 TGCTCCCCCAACGCCCTCCCCGG - Intronic
924385829 1:243497290-243497312 TGCTGACTGAACGCTCACCATGG + Intronic
1065676058 10:28175789-28175811 TGCTCCCTGAGCCCTCTCCATGG + Intronic
1066357918 10:34702644-34702666 TGCTCTCAGAATGCCAGCCAGGG + Intronic
1070909386 10:80104311-80104333 TCCTCCCCCAACTCCCGCCATGG + Intergenic
1075664897 10:124223090-124223112 AGCTCCCTGAACCCCCTGCAAGG - Intergenic
1075869941 10:125764521-125764543 AGCTCCCTGCAGGCCCTCCATGG + Intergenic
1077279005 11:1733522-1733544 TGCTCGCTGCACTCCTGCCACGG + Exonic
1077538641 11:3136142-3136164 TGCTCTCTGACCCCACGCCAAGG + Intronic
1078469043 11:11572291-11572313 TGATCCCTGAAAGCCACCCAAGG - Intronic
1084590542 11:70087619-70087641 CACTCCCTGAGCGCCCTCCACGG - Intronic
1089417598 11:118305181-118305203 TGCTCCCCGAACGCTCTCCCAGG - Intronic
1093083773 12:14843643-14843665 TGCTCTGTGAACGCCCGTCCTGG - Intronic
1099080181 12:78168816-78168838 TGCTCCCTGAATAGCCGCCTGGG - Exonic
1100472363 12:94904931-94904953 TGCTTCCTGAATGCCAGACACGG + Intronic
1103559261 12:121783975-121783997 TGCTCACTGCAGTCCCGCCAAGG + Intronic
1112556499 13:100473204-100473226 TTCTCCCAGAACGCCCCACAAGG + Intronic
1113040517 13:106099955-106099977 TCCTCCCTGAACTCTCGCCTCGG - Intergenic
1113040528 13:106099989-106100011 TGCCCCCTGAACTCTCGCCTCGG - Intergenic
1113713390 13:112486284-112486306 TGCTCCCTGGACACCTGCCCTGG - Intronic
1115759086 14:36559876-36559898 TGTTTCCTGAAAGACCGCCATGG + Intergenic
1118352604 14:64983872-64983894 TACTCCCTAAACGCACTCCAGGG + Intronic
1123412940 15:20074177-20074199 TGCTCGCTGCACGGGCGCCAGGG - Intergenic
1123522282 15:21081290-21081312 TGCTCGCTGCACGGGCGCCAGGG - Intergenic
1129516524 15:76160734-76160756 TGCTCCCTGAGCCCCCACCTCGG - Intronic
1130099371 15:80880791-80880813 AGCTCCCTGACCCCCCACCACGG - Intronic
1132081872 15:98873047-98873069 TCCTCCCTGAAGGCAAGCCAAGG + Intronic
1132092180 15:98955755-98955777 TGTTCCCTGAAGGCCAGACACGG + Intronic
1133739313 16:8639726-8639748 TGCTCCCTGCACGGCCTGCAGGG + Intronic
1142230388 16:88897469-88897491 TGCTCCCTGAACGCCCGCCATGG + Intronic
1142358683 16:89616103-89616125 TGCTCCCTGAACTCCAGCTGGGG + Intronic
1143328696 17:6118622-6118644 TGCTCCCTGAATGCCCCACAAGG - Intronic
1146082084 17:29789574-29789596 TGCTCCCTGATCGCCACCCATGG - Intronic
1146289904 17:31599456-31599478 TGCTCCCACAACGCCCACCCTGG - Intergenic
1148740573 17:49890317-49890339 TGCTGGCTGTACACCCGCCAAGG - Intergenic
1149225028 17:54460069-54460091 TGCTCCCTGCACCCACACCAAGG + Intergenic
1150496057 17:65608587-65608609 TGCTCCCTGAACCCTCTTCATGG - Intronic
1152648941 17:81483100-81483122 TGTCCCCTGAAAGCACGCCAAGG + Intergenic
1166270877 19:41713014-41713036 TGCTCACTGAAGGCCGGGCACGG + Intronic
1167772368 19:51529437-51529459 AGCTCCCTGAGCCCCTGCCAGGG - Intronic
925293418 2:2763067-2763089 TGCTCCCTTCAAGCCAGCCAAGG + Intergenic
925627271 2:5853790-5853812 TGCTGCCTGAATACCCACCAGGG + Intergenic
931434470 2:62234985-62235007 TGCTCCCTCCACCCCCGCCCTGG - Intergenic
932701539 2:73995750-73995772 TGGTCCCTGAACCCTCACCAAGG + Intronic
935105689 2:100041212-100041234 TGCTCCCTGAAGTCCAGCTATGG - Intronic
937305988 2:120871205-120871227 TGCTCCCAGAGCCCCTGCCATGG + Intronic
938708910 2:133958485-133958507 TGCTCCCTGAACGCCTGGCTTGG - Intergenic
939997101 2:148930199-148930221 TGCTCCCTGAAGGCACTTCAGGG + Intronic
942279078 2:174342751-174342773 GGCTCCCTGAACTCGCGCCGGGG + Intergenic
948603232 2:239119344-239119366 TGCTTCCTGAAGGCCCGTCCTGG - Intronic
948662371 2:239515356-239515378 TGCTCCCTGCCCTCCTGCCAAGG + Intergenic
948697881 2:239742506-239742528 TGCTCCCTGAACGCCGGTCCCGG + Intergenic
1170450766 20:16481237-16481259 TGCTCACTGTACTCCAGCCAGGG - Intronic
1171425053 20:25043780-25043802 TGCTTCATGCACGCCTGCCAGGG + Intronic
1171876814 20:30585285-30585307 TGCTCCCGGCCCGCCCGCCCGGG + Intergenic
1178708068 21:34890253-34890275 AGCTCCCGGAACGCCCCCGACGG + Intronic
1180230022 21:46421586-46421608 TGCACCCTCCACGCCAGCCACGG - Intronic
1184422491 22:44390149-44390171 TGTTCCCTGAGCACCTGCCAGGG + Intergenic
1184788799 22:46686450-46686472 TGCTCCCAGAACAGACGCCAAGG + Exonic
952905845 3:38138682-38138704 GGCTCCAGGACCGCCCGCCATGG + Exonic
952955125 3:38552104-38552126 TGCTCCCTGATGCCACGCCATGG + Intronic
955083185 3:55676790-55676812 TGCTCCCTGTGCGCCAGCCCTGG + Intronic
961484728 3:127208752-127208774 TGCTCCCTGACCTCCAGCCCGGG - Intergenic
965348551 3:167583569-167583591 TACTCCCTGAAGGCCCAGCAAGG - Intronic
967877480 3:194277068-194277090 TGCTCCATGAGCACCGGCCAGGG - Intergenic
968360059 3:198140237-198140259 GACACCCTGCACGCCCGCCAGGG - Intergenic
969257357 4:6011430-6011452 AGCCCCCTGAACACACGCCATGG + Intergenic
985607253 5:864646-864668 TGCTTCCTGACCTACCGCCAGGG + Intronic
996016988 5:118550400-118550422 TGCTCCCTGCACCCACGCCTGGG + Intergenic
997444293 5:133930080-133930102 TGCTTCCAGAACGCCTCCCACGG - Intergenic
997462152 5:134060005-134060027 TGCACCCTGCACGCCCTCCAGGG + Intergenic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
1005969735 6:30751680-30751702 TGCTCCCGGAACTCTTGCCATGG - Intergenic
1006085179 6:31590033-31590055 TGCTCCTTCAATGCCAGCCAAGG - Exonic
1006644487 6:35506356-35506378 TGCTCCCTGGCAGCCCGGCACGG + Intronic
1013179711 6:107707822-107707844 TGCTCCCTCAATCCCCCCCAAGG + Intronic
1020101526 7:5396898-5396920 TGCTCACTGACCGCCTCCCAGGG + Intronic
1022739617 7:33109008-33109030 GGCTCCCTGAACGCCCCGCCAGG + Intronic
1024173111 7:46810594-46810616 TTCTTCCTGAACGCCTGACAAGG - Intergenic
1033453522 7:141482304-141482326 TCCTCCCTGAACACCCACCTGGG + Intergenic
1040905614 8:52467258-52467280 TGCTGCATGAAGGGCCGCCACGG + Intergenic
1041662410 8:60412971-60412993 TGGTCCCTGAACACCGGCCTGGG + Intergenic
1048012478 8:130469341-130469363 TGCTCCCAGAACTCCTTCCAAGG + Intergenic
1049800783 8:144516615-144516637 AGCTCCCTGAGCCCCAGCCAAGG - Exonic
1050087197 9:1978333-1978355 TCCTCCATGAATGCCAGCCAAGG - Intergenic
1056248567 9:84723996-84724018 TGATCCCTGAATTCCCTCCAAGG - Intronic
1059848365 9:118306987-118307009 TGCTGCCTGAACCACTGCCATGG + Intergenic
1062744765 9:138204078-138204100 GACGCCCTGCACGCCCGCCAGGG - Intergenic
1187125170 X:16447953-16447975 CGCTCCCTCCACGCCCCCCAGGG + Intergenic
1196895232 X:120329655-120329677 TGCTTCCTGAAGGCAGGCCAGGG - Intergenic
1200150539 X:153949283-153949305 TGCTTCAGGAACACCCGCCAGGG - Exonic