ID: 1142234577

View in Genome Browser
Species Human (GRCh38)
Location 16:88915630-88915652
Sequence GTGTGGAGGAGGAGCGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 756
Summary {0: 1, 1: 1, 2: 4, 3: 74, 4: 676}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142234577 Original CRISPR GTGTGGAGGAGGAGCGTGGA GGG Intronic
900145593 1:1157561-1157583 GTGTGGAGCAGGAAGGGGGAAGG + Intergenic
900149096 1:1170533-1170555 GAGAGGAGGAGGAGGGAGGAGGG - Intergenic
900367758 1:2318200-2318222 GTGGGGAGGAAGATCCTGGAAGG - Intergenic
900582150 1:3414621-3414643 GGGTGGAAGAGCAGCGGGGACGG - Exonic
900583493 1:3421027-3421049 GTGTGAAGCTGGAGCGTGCAAGG + Intronic
901556210 1:10033107-10033129 GCGTGGAGGCGGGGCGTGGCCGG + Intronic
901641611 1:10695551-10695573 GAGGGGAGGAGGAGCCGGGATGG - Intronic
901689284 1:10962056-10962078 GTGAGGAGGAGGAGGAAGGAAGG - Intronic
902148194 1:14420884-14420906 GTGTGGAGGGGAGGTGTGGAGGG - Intergenic
902148199 1:14420897-14420919 GTGTGGAGGGGAGGTGTGGAGGG - Intergenic
902204159 1:14855054-14855076 GTGCAGAGGAGGTGGGTGGAAGG + Intronic
902231266 1:15029193-15029215 ATGGTGAGGAGGAGGGTGGATGG + Intronic
902231768 1:15032095-15032117 GTGTGGGGGTGGATCGGGGAGGG - Intronic
902278812 1:15359441-15359463 GTGAGGAGGAGGTGCTGGGATGG + Intronic
902456737 1:16538907-16538929 GGGTCGAGGAGGAGCTTGGGTGG + Intergenic
902474358 1:16673409-16673431 GTGTGGAGGATGTGGGTGGGAGG - Exonic
902480229 1:16707786-16707808 GTGGGGCGGAGGACCGTGGGCGG - Intergenic
902484445 1:16734033-16734055 GTGTGGAGGATGTGGGTGGGAGG + Exonic
902881083 1:19372168-19372190 GAGTGGAGGAGCAGGGTGGGAGG - Intronic
903463399 1:23534911-23534933 GAGGGGAGGAGGGGCCTGGAGGG - Intergenic
903576439 1:24342397-24342419 GGGTGGAGGAGGAGAGGGGAAGG - Intronic
904043669 1:27598296-27598318 GTGTGGTGGAGGGGGCTGGAAGG + Intronic
904111173 1:28127657-28127679 GTATGGAGAAGGGGCATGGATGG + Intergenic
904259930 1:29282690-29282712 TTGTGGAGGAGGAGCGGGCGCGG + Exonic
904263799 1:29306261-29306283 GTGTGGAAGAGGGGCGAGGCGGG + Intronic
904293165 1:29500468-29500490 GTGAGGAGGAGGTGCGGGAAAGG + Intergenic
904353498 1:29924049-29924071 TTGTGGAGGAGGGGAGAGGAAGG - Intergenic
904382968 1:30124045-30124067 GTGTGGAGGAGAAGCAAGAAAGG - Intergenic
904582325 1:31553846-31553868 GAGTGGGGGAGGGGGGTGGAAGG - Intergenic
904814205 1:33182819-33182841 GGGTGGAGAAGGAGCCTGGGTGG + Intergenic
905442996 1:38006251-38006273 GGGTGGTGGAGGAGAGGGGAGGG + Intergenic
905498843 1:38419744-38419766 ATGTGGAGGAGCTGAGTGGAAGG - Intergenic
905632088 1:39524588-39524610 GTGAAGGGGAGGAGAGTGGAGGG + Intronic
906224146 1:44107047-44107069 GTGGGGAGGAGGAGAGAGGTGGG + Intergenic
907192877 1:52663328-52663350 GGGCGGAGGAGGTGCTTGGAGGG - Intronic
907308204 1:53525282-53525304 ATGGGGAGGAGGAGAGGGGAAGG + Intronic
908401088 1:63773835-63773857 GTGTGGGGGAGGGGAGGGGAGGG + Intergenic
908516465 1:64897490-64897512 GGGGGGAGGAGGAGGGGGGAGGG + Intronic
908882937 1:68753386-68753408 GTGGGGAGTATGAGCGTGGCAGG - Intergenic
909042960 1:70675780-70675802 GGGAGGAGGAGGGGAGTGGAGGG + Intergenic
909395797 1:75169477-75169499 GTGTGAATGAGGAGAGTGGGCGG + Intergenic
909933053 1:81520357-81520379 GTGTGGCAGAGGGGCGGGGATGG - Intronic
910644424 1:89498076-89498098 GTGTAGGGGTGGAGGGTGGATGG + Intergenic
910844511 1:91592570-91592592 CTGGGGAGGAGGTGCATGGAAGG - Intergenic
911744503 1:101425622-101425644 GTGGGGTGGAGGAGGGGGGAGGG - Intergenic
912209713 1:107544870-107544892 ATGTGAAGAAGGAGCGTGGCAGG + Intergenic
912283611 1:108344464-108344486 GAGGGTAGGAGGAGGGTGGAGGG + Intergenic
913334926 1:117700652-117700674 GTGTGGAGGAAGAGCAAGGGAGG + Intergenic
913661984 1:121012550-121012572 GGGTCGAGGAGGAGCTTGGGTGG + Intergenic
914013358 1:143795735-143795757 GGGTCGAGGAGGAGCTTGGGTGG + Intergenic
914334084 1:146699423-146699445 GATTGGAAGAGGAGGGTGGAAGG + Intergenic
914651982 1:149704344-149704366 GGGTCGAGGAGGAGCTTGGGTGG + Exonic
914967817 1:152277146-152277168 GTGTGGAGGATCATGGTGGATGG + Intergenic
915106390 1:153537264-153537286 GGGTGGAGGGTGAGGGTGGAGGG + Exonic
915117126 1:153608221-153608243 GTGTGGAGGAGGAGGAGGTATGG - Intronic
915205786 1:154269558-154269580 GAGGGGAGGAGGAGAGAGGAAGG - Intronic
915325422 1:155079284-155079306 GTGTGGAGGAGGCTGCTGGAGGG + Intronic
915467116 1:156104269-156104291 TTGTTGGGGAGGAGCCTGGAAGG + Intronic
915556167 1:156661963-156661985 GTGTGGTAGAGCAGCCTGGAAGG - Intergenic
916178203 1:162060513-162060535 GGGTGGAGGTGGAGAGTGGGAGG - Intergenic
916312485 1:163412434-163412456 GTGAGGAGGAGGAGGATTGAAGG + Intergenic
916332049 1:163628292-163628314 GAGGGGAGGAGGAGGGGGGAGGG - Intergenic
916600941 1:166292966-166292988 GTCTGGAGGAGGAGTGTTGAAGG + Intergenic
916861941 1:168815386-168815408 CTGTCGAGGAGGGGCGTGCAGGG + Intergenic
916994029 1:170276437-170276459 TTGTGGAAGAGGAGCATGAAAGG - Intergenic
917392358 1:174552314-174552336 GGGTGGAGGCGGAGGGTGGAAGG - Intronic
917516658 1:175714215-175714237 GTGTGGAAGAGGGGCGTGATGGG - Intronic
918028619 1:180779817-180779839 GGGGGTAGGAGGAGCGGGGAGGG - Intronic
919384157 1:196897776-196897798 GGCTGGATGAGGAGCATGGAGGG + Intronic
919928362 1:202205065-202205087 GTGTGGAGGAGGTGTGTGTTAGG - Intronic
920097623 1:203496848-203496870 CTGTGGAGGAGGAGGAGGGAAGG - Intronic
920335419 1:205241945-205241967 TGGTGGAGGAAGAGCGGGGACGG - Exonic
920655003 1:207868512-207868534 GTGTGGAGGAGGAGGCGGGAAGG - Intergenic
920915127 1:210252819-210252841 GTGGGGAGCTGGAGCCTGGAAGG - Intergenic
921076221 1:211702201-211702223 GTGAGGAGGAGGTGTCTGGAGGG + Intergenic
921399306 1:214703165-214703187 GTGTGGAGGAGAGGTGAGGATGG - Intergenic
922113711 1:222589131-222589153 GTGTGGAGGAGGGGTGCGGAAGG + Intronic
922132136 1:222790373-222790395 GTGTGGAGGAGGGACCTGGTGGG + Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922383298 1:225055677-225055699 GTGTGGTGGGGGAGGGGGGAGGG - Intronic
922504453 1:226118535-226118557 GTGTGGAGGAGGGGAGGAGATGG + Intergenic
922689440 1:227676663-227676685 GTGGGGAGGGGGAGGGGGGAGGG - Intronic
1062796489 10:348425-348447 GTGTGGAGGCAGAGGCTGGATGG - Intronic
1063953947 10:11248417-11248439 ATGGAGAGGAGGAGGGTGGAAGG - Intronic
1065477623 10:26157902-26157924 GTGTGGTGTAGGGGCGTGGGGGG + Intronic
1065780587 10:29162868-29162890 GTGTAGAGGAGGAGAGAAGAAGG + Intergenic
1067080221 10:43208501-43208523 GCCTGGAGGAGGAGCATGCAGGG + Intronic
1067100938 10:43334034-43334056 GGGAGGTGGAGGAGGGTGGATGG + Intergenic
1067558247 10:47287084-47287106 GGGTGGAGTAGCAGGGTGGAGGG + Intergenic
1067798856 10:49342922-49342944 GGGTGGAGGAGGAGTGGTGATGG - Intergenic
1068233435 10:54201035-54201057 GAGTGGAGGAGGTTCGTGCAGGG - Intronic
1068963698 10:62890834-62890856 GTGTGAAGGAGGATTGTGGTGGG - Intronic
1069333478 10:67321000-67321022 GGGTGGAGCAGGAGGGAGGATGG - Intronic
1069640762 10:69954108-69954130 GGATGGAGGAGGAGTGTGGAGGG - Intronic
1069848612 10:71390583-71390605 TTGTGGAGGAGCAGGCTGGAAGG - Intergenic
1069886569 10:71627614-71627636 GTGTGGAGGAGGTGAGGGGTGGG - Intronic
1070039707 10:72763907-72763929 GTGTGGAAGGGGAGTGTGAAGGG - Intronic
1070346104 10:75543471-75543493 GTGGGGAGGAGGAGAGAGGAAGG + Intronic
1070400486 10:76049180-76049202 GTGGGGAGGATGGGCTTGGAGGG - Intronic
1070716726 10:78727850-78727872 GTTTGGAGGGGGAGGGTGGGTGG - Intergenic
1071294179 10:84207254-84207276 GTGAGGAGGAGGAGAGGGGCAGG + Intronic
1071345879 10:84692081-84692103 ATGTGGAGGTAGAACGTGGAGGG + Intergenic
1071354431 10:84779244-84779266 GTTTGGAGGAGGAGCCAAGATGG - Intergenic
1073051066 10:100667775-100667797 GTGCTGAGGAGGAGCGGGGAGGG + Intergenic
1073577981 10:104641202-104641224 GTGTGTAGGGGGAGTGGGGAGGG - Exonic
1073784610 10:106875110-106875132 CTCAGGAGGAGGAGAGTGGAAGG - Intronic
1074326366 10:112455288-112455310 GAGTGGAGGAGGGGAGGGGAGGG - Intronic
1074418729 10:113290335-113290357 GTGTTGAGGAGGAACCTGGTGGG - Intergenic
1074902718 10:117833027-117833049 GTGGGGAGGGGGAGGGAGGAGGG - Intergenic
1074919476 10:117992981-117993003 GTGAGGGGAAGGAGCGGGGAGGG + Intergenic
1075399633 10:122151660-122151682 GTGGCGAGGAGGAGGGTGGGTGG + Intronic
1075575195 10:123572745-123572767 GAGAGGAGGAGGAGAGGGGAGGG + Intergenic
1075786060 10:125050941-125050963 ATCTGGATGAGGAGGGTGGATGG + Intronic
1075808321 10:125205904-125205926 GGGTGGAGGAGCTGCCTGGAAGG - Intergenic
1075974779 10:126685827-126685849 ATGGGGAGGAGGAGATTGGATGG - Intergenic
1076117178 10:127908440-127908462 GTGGGGAGGGGGGGTGTGGAGGG + Intronic
1076519340 10:131071029-131071051 GCATGGAGGAGGAGCAAGGAAGG + Intergenic
1076542714 10:131224234-131224256 GTGTGGGGCAGGAGCATGTAGGG - Intronic
1076580350 10:131504703-131504725 GTGGGGTGGAGGAGAGGGGAGGG - Intergenic
1077034217 11:487137-487159 GTGCGAGGCAGGAGCGTGGATGG - Intronic
1077121378 11:910520-910542 GGGTGGAGGGCGAGTGTGGACGG - Intronic
1077204720 11:1336805-1336827 GCGTGGGGGCGGGGCGTGGAGGG + Intergenic
1077234822 11:1475700-1475722 GGGTGGAGGAGGTGAGAGGATGG - Intronic
1077236985 11:1486574-1486596 GTGGGGAGGAGAAGCGGGGCGGG + Exonic
1077254237 11:1573279-1573301 GGGTGGAGAGGGAGCGTGGGGGG + Intergenic
1077355343 11:2114271-2114293 GTGAGGTGGTGGAGGGTGGAGGG - Intergenic
1077375203 11:2202445-2202467 GGGTGGGGGAGGGGCGAGGAGGG - Intergenic
1077791537 11:5446104-5446126 GTGGGGTGGGGGAGAGTGGAGGG + Intronic
1078090484 11:8261915-8261937 GTGTGTAGGAAGAGAGAGGATGG - Intronic
1078660648 11:13282863-13282885 TTGTGGAGGAGGAGATGGGATGG + Intronic
1081000188 11:37659739-37659761 GTGGGGTGGGGGAGGGTGGAGGG + Intergenic
1081622018 11:44624265-44624287 GTGTGGAGGTGGGGAGTGGAAGG + Intergenic
1082097561 11:48143793-48143815 GGGAGGAGGAGGAGAGGGGAGGG - Intronic
1082097575 11:48143826-48143848 GGGAGGAGGAGGAGAGGGGAGGG - Intronic
1084670380 11:70603340-70603362 GCCTGGAGGAGGAGCGGTGATGG - Intronic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085326568 11:75610975-75610997 GTGAGGAGGAGGGGTGAGGAAGG - Intronic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1088519095 11:110675494-110675516 TTGTGGAGGAGGAGGAAGGATGG + Intronic
1088821636 11:113461984-113462006 GTTTGGAGGAAGAGAGGGGAAGG - Intronic
1089379079 11:118014832-118014854 GTCTGGAGGAGTAGGGTGGCTGG + Intergenic
1089737091 11:120557005-120557027 GTGGGCAGGAGGAGACTGGACGG - Intronic
1089792143 11:120953038-120953060 GTGGGGAGGAGGAGAGGGGGAGG + Intronic
1090071814 11:123550560-123550582 GTGGGGTGGAGGAAGGTGGAGGG + Intronic
1090262242 11:125330094-125330116 GTGGGAAGGAGGAGCATGGAGGG + Intronic
1091112882 11:132987060-132987082 GTGAAGAGGGAGAGCGTGGATGG - Intronic
1091218813 11:133918946-133918968 AGGGGGAGGAGGAGCGGGGACGG + Intronic
1091286697 11:134412099-134412121 GCGGGGAGGGGGAGCGGGGAGGG + Intergenic
1091671701 12:2456746-2456768 CTGAGGAGGAGGAGCGGGGAGGG - Intronic
1092011470 12:5116568-5116590 GTGGGGTGGGGGAGCGGGGAGGG - Intergenic
1092138451 12:6166418-6166440 CTGTGGAGAGGGAGCATGGAAGG - Intergenic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1093889454 12:24502058-24502080 GTTTGTAGGTGGAGCCTGGAAGG - Intergenic
1095414875 12:41965599-41965621 GTGGAGGGGAGGAGCGCGGAAGG - Intergenic
1095476473 12:42590929-42590951 GTGTGTGGGGGGAGTGTGGAGGG + Intergenic
1095702775 12:45207752-45207774 TGGTGGAGGAGGAGAGTGGTAGG - Intergenic
1095745164 12:45650054-45650076 GTGTGAAGGAGGAGTCCGGAGGG - Intergenic
1095825819 12:46530435-46530457 TTGTGGGGGAGCAGCGTGGCAGG + Intergenic
1095945000 12:47748788-47748810 GTGTGGAGAGGGAGCATGGCAGG + Intronic
1096490241 12:52009067-52009089 GTGTGGATGTGGAGCTGGGAAGG + Intronic
1096656937 12:53097848-53097870 GCGTGGAGGAGGAGGATGGGGGG + Exonic
1096661589 12:53128737-53128759 CGGTGGAGGAGGCGCCTGGATGG - Intergenic
1096826852 12:54285855-54285877 TTGGGGAGGAGGAGGGTGGTGGG + Intronic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1098268425 12:68746597-68746619 GCCAGGAGGAGGAGCCTGGAGGG - Exonic
1098504852 12:71237605-71237627 AAGAGGAGGAGGAGGGTGGATGG - Intronic
1100386520 12:94109215-94109237 GCGTGGAGGAGGAGGGAGAAGGG + Intergenic
1100698930 12:97125332-97125354 CTGTGGAGGAGGAGGATGTAAGG + Intergenic
1100813549 12:98363672-98363694 GTTTGGAGGTGGAGCCTGGTAGG - Intergenic
1101881721 12:108630264-108630286 GTGTGGAGGAGCAGGCTGCAGGG + Intronic
1101968338 12:109295809-109295831 GAGTGGAGGAAGCGGGTGGAAGG - Intronic
1102394417 12:112574745-112574767 GTGTGGTGGAGGAGAGAGAAGGG + Intronic
1102811627 12:115829291-115829313 GTGTGGGGGAAGAGGGTGTATGG - Intergenic
1103884006 12:124187571-124187593 GGGTGGAGGGGGAGAGTGGAGGG + Intronic
1103963906 12:124626181-124626203 CAGAGGAGGAGGAGTGTGGAGGG - Intergenic
1104781276 12:131422094-131422116 AGGTGGAGGAGGAGGGAGGAGGG - Intergenic
1104963361 12:132498471-132498493 GTCTGTAGGATGAGAGTGGAGGG - Intronic
1105338058 13:19493302-19493324 GTGTTGAAGAGAAGTGTGGATGG + Intronic
1106356622 13:28989652-28989674 ATGGGGAGGATGAGGGTGGACGG + Intronic
1107630011 13:42333700-42333722 GATTGGAGGAGGAGAGTGCAGGG + Intergenic
1108192775 13:47959472-47959494 GGGCGGAGGAGGAGGGGGGAAGG + Intronic
1108477090 13:50831102-50831124 GTAAGGAGGAGGAGAGGGGAGGG + Intronic
1108586532 13:51874844-51874866 TTGTGGAGGAGGAGGGAGGCAGG - Intergenic
1109268845 13:60231820-60231842 GTGGGTGGGAGGAGCGGGGAGGG + Intergenic
1111087827 13:83400160-83400182 GTGGGGTGGGGGAGCGGGGAAGG - Intergenic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1112703952 13:102044726-102044748 GAGTGGTGGAGGATGGTGGAAGG - Intronic
1113073145 13:106441149-106441171 GTGTGGGGGTGGAGGCTGGAAGG + Intergenic
1113179805 13:107612122-107612144 GAGGGGAGGAGGAGTGGGGAGGG + Intronic
1113319219 13:109215576-109215598 GTGAGCAGGAGGAGGGTGCAGGG - Intergenic
1113467829 13:110524643-110524665 GTGTAAAGGAGGAGGGTGAAGGG - Intronic
1113567086 13:111325574-111325596 GGGTTGTGGAGGAGGGTGGAGGG + Intronic
1113662746 13:112118236-112118258 GTGTGGTAGAGGAGAGAGGACGG + Intergenic
1113851288 13:113419914-113419936 GTGTGGAGGAGGCTCCTGGGAGG + Intergenic
1113933455 13:113980871-113980893 GGGTGGAGGAGGAGAGAGGGAGG + Intronic
1113954344 13:114089240-114089262 GTTCGGAGGAGGAGAGAGGAGGG + Intronic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114566903 14:23639569-23639591 CTGTGGAGGAGGAGTCTGAAGGG + Intronic
1114598567 14:23935140-23935162 GTGTGGAGGTGGGGCCTGGAGGG - Intergenic
1117292197 14:54344755-54344777 GTGGGGAGGAGGAGCATGGGGGG - Intergenic
1117490260 14:56240212-56240234 GTGTGGAGGGGAAGACTGGAGGG + Intronic
1117831136 14:59752070-59752092 GTGTGGATGTGGAGGTTGGAAGG - Intronic
1119539452 14:75428646-75428668 GGGTGGAGGTGGAGGGTGAAGGG + Intronic
1119566965 14:75636973-75636995 GTGTGAGGGAGGAGCGTGAAGGG + Intronic
1119757228 14:77127724-77127746 ATGTGGAGGAGGGGCTGGGAGGG + Intronic
1120045422 14:79800274-79800296 GTTTCCTGGAGGAGCGTGGATGG + Intronic
1120049353 14:79847234-79847256 GTGTGGAGATGGAGATTGGAAGG - Intronic
1121545347 14:94759045-94759067 GTCTGGAGGTGGGGAGTGGAGGG - Intergenic
1121620782 14:95346864-95346886 GTGGGGAGGTGGAGCTGGGAGGG - Intergenic
1122080360 14:99262857-99262879 GGGGGGAGGAGAAGGGTGGAGGG + Intronic
1122159473 14:99773044-99773066 GTGTGGAGGAGGAGAGAACATGG - Intronic
1122329759 14:100904355-100904377 GTGTGGACGGGGAGAGGGGAGGG + Intergenic
1122557584 14:102590043-102590065 GGGTGGAGGAGGTGAGTGTAGGG + Intergenic
1122692659 14:103538550-103538572 GTGTGGAGTGGGGGAGTGGACGG + Intergenic
1122835085 14:104426936-104426958 GCGGGGAGGAGGAGGGTGGGCGG - Intergenic
1122943344 14:104993367-104993389 GTGTGGATGACGAGGCTGGAAGG + Intronic
1123632964 15:22274918-22274940 GTGTGGGGGTGGTGCATGGATGG - Intergenic
1124842689 15:33258251-33258273 GTGTGAAGGACTAGCATGGAGGG - Intergenic
1125196280 15:37050679-37050701 GAGTGGAGGGGCAGGGTGGAGGG - Intronic
1125613701 15:40991014-40991036 GGGTGGTGGAGGTGGGTGGAGGG + Intronic
1125724791 15:41862707-41862729 GTGGGGAGGAGGGGCTTGGGTGG - Intronic
1126776190 15:52102607-52102629 GTGAGGAGGAGGAGCCTTGAAGG - Intergenic
1126855465 15:52834664-52834686 GGGTGGAGGAGGAGGAGGGAAGG + Intergenic
1127002791 15:54529720-54529742 GTGTGGAGGAGGAGAGGAGTGGG + Intronic
1127324381 15:57881054-57881076 GGGTGGAGATGGAGCATGGACGG - Intergenic
1128783357 15:70377414-70377436 GGTTGGAGGAGGAAGGTGGAGGG - Intergenic
1129233179 15:74208098-74208120 GTGAGGAGGAGGAGGGTAGCCGG + Intronic
1129663270 15:77565186-77565208 TTGTGGAGGAGGAGCATGAGGGG + Intergenic
1129774860 15:78230035-78230057 TTGTGGAGGAAGGGCTTGGAAGG - Intronic
1131090672 15:89622695-89622717 CTGGGGAGGTGGAGCGGGGAGGG - Intronic
1131115435 15:89792351-89792373 GTGTGGAACAGCAGCGGGGAGGG + Intronic
1131229166 15:90647470-90647492 GTGTGGAGGAGGAGGGGTGAGGG - Intergenic
1131832331 15:96361641-96361663 GTGTTGAGGGGGAGCGGGGGTGG - Intergenic
1132207982 15:99999522-99999544 GGGTGGAGGCGGAGTGAGGAAGG + Intronic
1132599645 16:767915-767937 GCGTGGAGGGGGCACGTGGAGGG + Intronic
1132606094 16:794357-794379 GTGGGGAGCAGGAGCCAGGAGGG + Intronic
1132887186 16:2187447-2187469 GCTTGGAGGAGGAGCCTGGCGGG + Exonic
1133276458 16:4641006-4641028 GTGTGGAGGGAGAGCCTGGTGGG + Intronic
1133520249 16:6549432-6549454 GGGAGGAGGAGGAGGGAGGAGGG + Intronic
1133578943 16:7124492-7124514 GAGGGGAGGGGGAGCGAGGAAGG - Intronic
1134739377 16:16529180-16529202 GGTTGGAGGAGGAGCGTTGATGG + Intergenic
1134840904 16:17400777-17400799 GTGTGGAGTTAGAGCGAGGAAGG + Intronic
1134928123 16:18182971-18182993 GGTTGGAGGAGGAGCGTTGATGG - Intergenic
1135526372 16:23216320-23216342 GTGGGGAGGGGGAGCATGGTGGG + Exonic
1135818782 16:25660455-25660477 TTGTGGAGTAGGAGGTTGGAAGG - Intergenic
1136370240 16:29831563-29831585 GTGTGGAGGATGGGGGTGGCTGG - Intronic
1136670777 16:31855058-31855080 GTGTGGATGAGGAGAGTAGTGGG - Intergenic
1136699366 16:32117117-32117139 TTGTGGAGCAGGTGCGTGGTGGG + Intergenic
1136799858 16:33060288-33060310 TTGTGGAGCAGGCGCGTGGTGGG + Intergenic
1137027459 16:35492298-35492320 GTTGGGAGGCGGAGGGTGGAGGG - Intergenic
1137585183 16:49659999-49660021 GGGTGGAGGAGGAGGAAGGAAGG - Intronic
1137942491 16:52702603-52702625 CAGGGGAGGAGGAGGGTGGATGG - Intergenic
1138439789 16:57027027-57027049 GAGTGGAGGAGGACCGGGGAGGG + Intronic
1138519105 16:57560660-57560682 GTGTGGAGCAGGATTGGGGATGG + Intronic
1138637423 16:58352191-58352213 GAGTGGAGAAGGAGGTTGGATGG - Intronic
1139999534 16:71011826-71011848 GATTGGAAGAGGAGGGTGGAAGG - Intronic
1141251648 16:82364088-82364110 GTGTGGAGTGGGAGGGTGGGGGG + Intergenic
1141638467 16:85328212-85328234 CTGTGGAGGAGGAGCGGAAAGGG - Intergenic
1141775718 16:86121601-86121623 GGAGGGAGGAGGAGGGTGGAAGG - Intergenic
1141993938 16:87625359-87625381 GTGTGGAGGAGGAGAGTGACTGG - Intronic
1142004733 16:87684297-87684319 GTGGGGAGGGGGTGCGTGGATGG + Intronic
1142234538 16:88915520-88915542 GTGTGGAGGGGGAGCGTGGAGGG + Intronic
1142234577 16:88915630-88915652 GTGTGGAGGAGGAGCGTGGAGGG + Intronic
1142234581 16:88915643-88915665 GCGTGGAGGGGGAGCGTGGACGG + Intronic
1142234590 16:88915670-88915692 GTGTGGAGGGGGAGCGTCGACGG + Intronic
1142234606 16:88915712-88915734 GCGTGGAGGGGGAGCGTGGAAGG + Intronic
1142269166 16:89080162-89080184 CTGAGGAGGAGGAGTGTGGTGGG + Intergenic
1142285777 16:89171011-89171033 GTCGCGAGGAGGTGCGTGGAAGG + Intergenic
1142307056 16:89291586-89291608 GTTTGGAGGAGGGACGGGGAAGG - Intronic
1142679130 17:1535362-1535384 CTGTGGAGGAGGGGCATGGCTGG - Intronic
1143651736 17:8267520-8267542 GTGGGGAGGGGGAGTGTGGGTGG - Intronic
1143818632 17:9541293-9541315 ATGTGGAAGAGGAGAATGGAGGG + Intronic
1143965862 17:10756136-10756158 GTGGGGTGGAGGAGCATGGAGGG - Intergenic
1143976868 17:10836774-10836796 GTCTGGGGGAGAAGCGGGGAAGG + Intronic
1144077481 17:11732467-11732489 GTGGAGAGGAGGAGAGGGGAGGG - Intronic
1144097733 17:11917070-11917092 GTGAGGAGGAGAAGCGGGGATGG + Intronic
1144329668 17:14212471-14212493 GTTTGGAGGCGGGGCGTGGTGGG - Intergenic
1145252856 17:21305809-21305831 CTGTGCAGGAGACGCGTGGAAGG + Intronic
1145323719 17:21782107-21782129 CTGTGCAGGAGACGCGTGGAAGG - Intergenic
1146974066 17:37096151-37096173 GTGTGGAGGAGGGAATTGGAGGG - Intronic
1147325531 17:39667861-39667883 GCCTGGAGGAGGGGCGGGGAGGG + Intergenic
1147683089 17:42266651-42266673 GTGTGGAGGTGGAGGTGGGAGGG + Intronic
1148095056 17:45046783-45046805 GTGTGAAGGAGGAGCTGGGTAGG - Intronic
1148289475 17:46431591-46431613 CTGTGGAGGAGGAGAGTGCAGGG + Intergenic
1148311644 17:46649163-46649185 CTGTGGAGGAGGAGAGTGCAGGG + Intronic
1148384238 17:47222845-47222867 GTGGGGAGAAGGTGGGTGGAGGG - Intronic
1148749388 17:49935773-49935795 GTGTGGGGGATGCGGGTGGAGGG + Intergenic
1149315189 17:55431972-55431994 GAGTGGAGGGGGAGCGGGGAGGG + Intergenic
1149431462 17:56597672-56597694 GTGGGGAGGAGGGGCGCGGGCGG - Intergenic
1149891126 17:60391721-60391743 GTGTGGTGGAGGAGAGAGGTCGG - Intronic
1149978694 17:61291921-61291943 GTGAGGAGGAAGAGGGTGGGAGG + Intronic
1150347482 17:64415331-64415353 GTGGGGAGGAAGTGCATGGAAGG - Intergenic
1150829273 17:68504692-68504714 GTGTAGCGGTGGAGGGTGGAGGG + Intergenic
1151314152 17:73311632-73311654 GTGTGGAGGAGGAGGTGGCAGGG - Intronic
1151361708 17:73593096-73593118 GTGGGGAGGAGGAGGAGGGACGG - Intronic
1151520977 17:74629318-74629340 GTGGGGAGGGGGAGGGGGGAGGG + Intergenic
1151868801 17:76822585-76822607 GTGAGGAGGAGGAGTGTGTGGGG + Intergenic
1152288579 17:79426006-79426028 GTGTGGAGGGGGAGAGAGCAAGG + Intronic
1152535308 17:80947389-80947411 GTCTGGAGGAGTGGCGGGGAGGG + Intronic
1152720220 17:81919958-81919980 GTGTGGAAGAGGAGGGTGTAAGG - Exonic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1152993379 18:383663-383685 GTGTGGAGAAGGAGTGGGTAGGG - Intronic
1154141204 18:11826239-11826261 AGGAGGAGGAGGAGCGGGGAGGG + Intronic
1154141216 18:11826271-11826293 AGGAGGAGGAGGAGCGGGGAGGG + Intronic
1154141238 18:11826335-11826357 AGGAGGAGGAGGAGCGGGGAGGG + Intronic
1154163094 18:11994519-11994541 GTGTGGAGGAGGCGGGTGCTGGG - Intronic
1154336565 18:13470760-13470782 GTGTGGCTGAGGAGGGTGGCTGG - Intronic
1154496131 18:14962851-14962873 GGGTGGAGGAGCAGCAGGGAGGG + Intergenic
1155661379 18:28253087-28253109 TTTTGGAGGAGGAGCCTGGTGGG + Intergenic
1156111418 18:33731843-33731865 GTGAGGAGGAGGAAGGGGGAAGG - Intronic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1156401550 18:36744614-36744636 GTGGGGAGCAGGAGCCGGGAGGG - Intronic
1156677558 18:39548439-39548461 GGGTGGTGGAGGAGTTTGGATGG + Intergenic
1156897737 18:42265808-42265830 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1157505550 18:48223592-48223614 GTGTGTAGGAGGGGTGAGGATGG + Intronic
1157515312 18:48307002-48307024 GGGTGGAGTGGGAGAGTGGAGGG - Intronic
1157625205 18:49045173-49045195 GGGAGGAGGAGGACGGTGGAAGG + Intronic
1157723511 18:49944850-49944872 CTGAGGAGGAGCGGCGTGGAAGG - Intronic
1158662730 18:59403544-59403566 GTGTGGAGGAGGGGAGTGTTGGG - Intergenic
1159598535 18:70406572-70406594 GCCTGGAGGAAGAGAGTGGAGGG + Intergenic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1160227011 18:77019423-77019445 AGATGGAGGAGGAGCCTGGAGGG + Intronic
1160384744 18:78488295-78488317 GTGTTGAGGAGTAGCAGGGAAGG - Intergenic
1160474437 18:79169443-79169465 GTGTTGAGGAAGAGCCTGGCTGG + Intronic
1160582870 18:79897624-79897646 ATGTGGAGGAGGAGGAGGGAAGG - Intronic
1160815460 19:1033735-1033757 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815478 19:1033805-1033827 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815513 19:1033945-1033967 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815530 19:1034015-1034037 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815635 19:1034437-1034459 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815669 19:1034577-1034599 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815686 19:1034647-1034669 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815800 19:1035103-1035125 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815809 19:1035139-1035161 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160815818 19:1035173-1035195 GTGTAGACGGGGAGCGTGGGTGG + Intronic
1160932638 19:1577938-1577960 CTGTAGAGGACGAGCGTGGAGGG + Exonic
1160970709 19:1766595-1766617 GTGAGGAGGAGGAGAGGGGATGG + Intronic
1160996133 19:1882785-1882807 GTCTGAAGGAGAAGCGTGGTCGG - Intronic
1161004828 19:1929982-1930004 GGGTGGAGGGGGAGCCTGGAGGG - Intergenic
1161030742 19:2056736-2056758 GGGGGGAGGAGGAGAGGGGAGGG - Intergenic
1161226154 19:3146905-3146927 GTGAGGAGGGGGAGAGAGGAAGG - Intronic
1161309772 19:3587050-3587072 GGGTGGAGGAGGGTCGGGGATGG + Intronic
1161404075 19:4082046-4082068 GCATGGAGGAGGAGGGAGGAGGG - Intergenic
1161505776 19:4642723-4642745 GTGAGGAGGAGGAGAGAGGGAGG + Intronic
1161649873 19:5477923-5477945 GTGAGGAGGAGGAGAGGGCAGGG - Intergenic
1161756429 19:6137460-6137482 GTGAGGAGGGGGAGGGAGGAAGG + Intronic
1162237708 19:9321729-9321751 GAGTGGGGGAGGAGGGTGGCAGG - Intergenic
1162328009 19:10010204-10010226 GGGGGGTGGAGGGGCGTGGAGGG - Intronic
1162811485 19:13166789-13166811 GTGGGGAGGAGGAGAGTGTGAGG + Intergenic
1163153031 19:15425836-15425858 GGGAGGAGGAGGAGGGAGGAGGG + Intronic
1163738449 19:18995963-18995985 CTCTGGAGGAGGAGCCTGCAGGG + Intronic
1163758699 19:19121407-19121429 GTGTGCAGGAGGAACCTGGGGGG + Exonic
1164441816 19:28284869-28284891 GTGGAGAGAAGGAGGGTGGAGGG + Intergenic
1164908169 19:31984587-31984609 GTTTGGAGGAGGAAAGTGGTAGG - Intergenic
1165707819 19:37988876-37988898 GTGTGGAGTGGGAGGGAGGACGG - Intronic
1165775367 19:38401258-38401280 GGGTGGACCAGGAGCCTGGAGGG - Intergenic
1166271394 19:41716438-41716460 GTGTGGAGAAGGAGCCCGGGTGG + Intronic
1166386256 19:42383225-42383247 GTGTTGAAGAGGAGAGTGGCTGG + Intergenic
1166735564 19:45082203-45082225 GTGTGGAGGAGGTGGGGGCAGGG - Intronic
1167134934 19:47610194-47610216 GGATGGAGGAGGAGGGAGGAGGG + Intronic
1167295507 19:48646717-48646739 GCGGGGAGGAGGAGCCGGGAGGG + Intergenic
1167421103 19:49403855-49403877 GTGTGGAGGGGGAAGGTAGAGGG - Intronic
1167573375 19:50304940-50304962 ATTTGGAGGAGGAGTGTGGTTGG + Intronic
1167756066 19:51414732-51414754 GGTTGGAGCAGGAGCTTGGAGGG - Intronic
1168405943 19:56110790-56110812 GTGGAGAGGAGGGGTGTGGAGGG - Intronic
1202707735 1_KI270713v1_random:35813-35835 GTGTGGAGGATGTGGGTGGGAGG - Intergenic
1202714268 1_KI270714v1_random:33696-33718 GTGGGGCGGAGGACCGTGGGCGG - Intergenic
925420311 2:3704722-3704744 GTGGGGGGGAGGGGCGTGGGGGG + Intronic
926337397 2:11875022-11875044 GTGGGGAGGAGGGGAGCGGACGG - Intergenic
927115817 2:19901375-19901397 GTGCGAATGAGGAACGTGGAAGG + Intronic
927438455 2:23090593-23090615 GAGGGGAGGAGGAGAGGGGAGGG + Intergenic
927466138 2:23338101-23338123 GTGTGGAGAGGGAGAGTGGATGG + Intergenic
927747994 2:25640379-25640401 GTATGGAGGCGGGGGGTGGAGGG + Intronic
928101429 2:28439787-28439809 GTGTGGCAGAGGAGTGTGGAGGG - Intergenic
928596218 2:32861748-32861770 GAGGGGAGGAAGATCGTGGATGG - Intergenic
929056842 2:37885684-37885706 GTAGGGAGGAGGAGGTTGGAGGG - Intergenic
929279358 2:40061257-40061279 GTGAGGAGGAGGATTGAGGACGG - Intergenic
929948585 2:46389094-46389116 GTGAGGAGCAGGAGGCTGGAAGG - Intergenic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
930619592 2:53630097-53630119 GTGTGGAATAGCAGCCTGGATGG - Intronic
930788251 2:55294799-55294821 ATGTGAAGGAGGAGCATGTATGG + Intronic
932586446 2:73032691-73032713 GTTTGGAGAAGCAGCTTGGAAGG - Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935123227 2:100199866-100199888 GTGTGGAGGTGGGGCCTGGTGGG + Intergenic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935632213 2:105221406-105221428 GTGTGGAGGAGCAGAGTGGGGGG + Intergenic
936153750 2:110035501-110035523 GTGGGGAGGAGGAGGGAGGGGGG - Intergenic
936190935 2:110335914-110335936 GTGGGGAGGAGGAGGGAGGGGGG + Intergenic
936971044 2:118176585-118176607 GTGGGGAGAAGGAGCAAGGAGGG - Intergenic
937485972 2:122315090-122315112 GTGTGGAGCAGATGAGTGGAAGG - Intergenic
937917440 2:127106096-127106118 GCCTGGAGGAGGCGCGTGGAAGG - Intronic
937981986 2:127621140-127621162 GTGGGGAGGAACAGCCTGGAAGG - Intronic
938189154 2:129258805-129258827 ATGTAGAGGAGGAGTGTGGAGGG + Intergenic
938218194 2:129541051-129541073 GTGGGGGGGAGGAGGGGGGAGGG + Intergenic
939085640 2:137715789-137715811 GTGTGGAGGAGAGGCATGGGTGG + Intergenic
939333918 2:140800248-140800270 TAGGGGAGGAGGAGCGGGGAGGG + Intronic
939553749 2:143648582-143648604 GTGAGGAGGAGGTGTGGGGAGGG - Intronic
939589456 2:144045776-144045798 GTGTGCAGGAAGAGAGAGGAAGG + Intronic
940954445 2:159712464-159712486 GGGGGGAGGAGGAGCAGGGAGGG + Intronic
941927224 2:170908294-170908316 GAGTGGGGGAAGAGCGGGGAGGG + Intergenic
942034011 2:171993121-171993143 GAGTGGAGGTGGAGAGTGGGAGG + Intronic
942277864 2:174335962-174335984 GTGGGGAGGAGGCGCGAGGCGGG + Intronic
942317811 2:174710790-174710812 TTGTGGAGGAGGAGGTTGCATGG + Intergenic
942507356 2:176657069-176657091 GGGAGGAGGAGGAGGGAGGAAGG + Intergenic
943682876 2:190786384-190786406 GTGGGGAGGAGGGGCGGGGGGGG - Intergenic
946139594 2:217678216-217678238 GTGGGGTGGGGGAGCGGGGAGGG + Intronic
946590545 2:221242574-221242596 GTGTGGTGGGGGAGAGGGGAGGG + Intergenic
946881901 2:224185012-224185034 GTGAGGCAGAGGAGGGTGGATGG - Intergenic
948028959 2:234800837-234800859 CTGTGGTGGAGGAGCTTGGCTGG + Intergenic
948091837 2:235301905-235301927 GAGAGGAGGAGGAGAGAGGAGGG - Intergenic
948091900 2:235302098-235302120 GTGGGGAGGAGGGGAATGGAAGG - Intergenic
948223203 2:236289658-236289680 GTGAGAAGGAGGAGGGTGGAGGG + Intergenic
948720801 2:239898932-239898954 GTGTGACGGAGGGGTGTGGAGGG + Intronic
948720833 2:239899069-239899091 GTGTGATGGAGGAGTGTGGAGGG + Intronic
948720870 2:239899196-239899218 GTGTGATGGAGGGGTGTGGAGGG + Intronic
948720918 2:239899362-239899384 GTGTGATGGAGGGGTGTGGAGGG + Intronic
948720932 2:239899424-239899446 GTGTGATGGAGGAATGTGGAGGG + Intronic
948929117 2:241119383-241119405 GTGTAGAGGAGGCCCTTGGAGGG - Intronic
948932108 2:241138531-241138553 GAGAGGATGAGGAGCCTGGAGGG - Intronic
1169023333 20:2347249-2347271 GAGTGGAAGAGGAGTGGGGAAGG - Intergenic
1169357187 20:4917225-4917247 GGGTGCAGCAGGAGAGTGGATGG + Intronic
1169673734 20:8132208-8132230 GGGGGGAGGAGGAGGGAGGAGGG + Intronic
1170756782 20:19212436-19212458 CAGAGGAGGAGGAGCGGGGAAGG - Intergenic
1170957199 20:20992014-20992036 GTGGGAAGGAGGAACGTGGAAGG - Intergenic
1170971682 20:21122802-21122824 ATGTGGAGGAGGTTCCTGGAGGG + Intergenic
1171249524 20:23637713-23637735 GCGTGGAGGAGGAGGGTGTGCGG - Exonic
1171399071 20:24860005-24860027 GTGAGGAAGAGGAACGGGGATGG - Intergenic
1171764894 20:29255176-29255198 GTGGGGTGGAGGGACGTGGAGGG + Intergenic
1171907150 20:30908435-30908457 GTGGGGAGGGGGTGCGTGGTGGG + Intergenic
1172113937 20:32562925-32562947 GAGTGGAGAAGGAGGGTGGAGGG + Intronic
1173183027 20:40818923-40818945 GGGTGGAAGAGGAGAGAGGATGG - Intergenic
1173438846 20:43057305-43057327 GAATGGAGGAGGAGGGGGGAAGG + Intronic
1173605297 20:44327106-44327128 GTGGGGAGGAGGTTCCTGGAAGG - Intergenic
1173643507 20:44619460-44619482 GTGGGCAGGATGAGCATGGAGGG - Intronic
1174209153 20:48863442-48863464 TTGTGGAGAAGGAGCGGGGAGGG - Intergenic
1174292565 20:49519486-49519508 GTGAGGAGGAGGGGCCAGGAAGG - Intronic
1175035172 20:55993364-55993386 GTGGGGTGGGGGAGCGGGGAGGG + Intergenic
1175838529 20:62011981-62012003 GGGTGGCGGAGGTGTGTGGAGGG - Intronic
1175934529 20:62508996-62509018 GGGTGGAGGAGTAGAGAGGATGG - Intergenic
1175934864 20:62509910-62509932 GGGTGGAGGGTGGGCGTGGAGGG - Intergenic
1176053828 20:63134523-63134545 GAGGGGAGGAGGGGCCTGGATGG + Intergenic
1176054078 20:63135088-63135110 GAGGGGAGGAGGGGCCTGGATGG + Intergenic
1176087643 20:63305321-63305343 GTGGGGAGGAGGAGCCAAGAGGG + Intronic
1176241676 20:64078477-64078499 GTGTGGGGGAGGACCCTGGGTGG - Intronic
1176963623 21:15187753-15187775 GTGTGGAGGTGGGGCCTGGTGGG - Intergenic
1177038105 21:16070603-16070625 GGGTGGAGGGAGAGCGGGGAAGG + Intergenic
1177078265 21:16605924-16605946 GTGTGCCAGAGGAGCTTGGAAGG - Intergenic
1177656210 21:24020403-24020425 GTGTGGAAGAGGAATGTGGGGGG + Intergenic
1178044976 21:28682896-28682918 CTGTGTAGGGGGAGCGGGGAGGG + Intergenic
1178361029 21:31948616-31948638 GTGGGAAGGAGGAGAGAGGAAGG + Intronic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178460268 21:32796261-32796283 GTGGGGAGGAGGCGAGAGGAGGG + Intronic
1178687717 21:34724271-34724293 GTGTGGAGAAGGGGTGGGGAAGG + Intergenic
1179084983 21:38207958-38207980 GAGTGGAGGAGGAGAGAGGAGGG - Intronic
1179534396 21:42042007-42042029 GTGTGGAGGATGAGAGTTGTTGG + Intergenic
1180228947 21:46414757-46414779 GTGTCCAGGAGGAGGGTGGGCGG - Intronic
1181065423 22:20303459-20303481 GTGGGGAGGAGGAGGTCGGAGGG + Intergenic
1181984367 22:26789387-26789409 GTCTGGAGGATGAGGGTGGATGG - Intergenic
1182415173 22:30216798-30216820 GTGTGAAGGAGGAGGGTGTGAGG + Intergenic
1183106862 22:35621196-35621218 GTGTGTAGCATGAGCGTGTAAGG - Intronic
1183509542 22:38226895-38226917 GTGTGGAGGAGGAGCACAGAAGG + Intronic
1183533635 22:38380823-38380845 GTGTTGAAGAGAAGTGTGGACGG + Intronic
1183533937 22:38383912-38383934 GTGGTGAAGAGAAGCGTGGATGG + Intronic
1183726498 22:39592859-39592881 GTGTGGGGTAGGAGGGTGGCGGG - Intronic
1184017016 22:41793968-41793990 GGCTGGAGCAGGAGGGTGGAAGG - Intronic
1184092507 22:42299902-42299924 GGGTGGAGGAGGAGGGGGAAAGG + Intronic
1184206792 22:43009664-43009686 CAGAGGGGGAGGAGCGTGGATGG - Intronic
1184251184 22:43261240-43261262 GTGTGGAGACGGGGCCTGGATGG + Intronic
1184438453 22:44494694-44494716 GTGTGGACAGGGAGCGTGGCCGG + Exonic
1184492016 22:44815242-44815264 GTGTGGGGGAGGAGGGAGCATGG + Intronic
1184512813 22:44943122-44943144 ATGTTGGGGAGCAGCGTGGAGGG - Intronic
1184561637 22:45267254-45267276 GTGGGGTGGAGGAGAGGGGAGGG + Intergenic
1184802415 22:46769630-46769652 CTGGGGAGGAGGGGCATGGAGGG + Intronic
1185416864 22:50715376-50715398 GGGTGGGGGAGGAGCCTAGAAGG - Intergenic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
950195506 3:11006537-11006559 GTGGGGAGGAGGAGAGGAGAGGG - Intronic
952140358 3:30472136-30472158 GTGTGAAGGAAGAGTGTGGCAGG + Intergenic
952603226 3:35109772-35109794 GTGGGGAAGAGGAGGGGGGAGGG + Intergenic
954029659 3:47809707-47809729 GTGGGGAGGTGGGGAGTGGAGGG - Intronic
954444479 3:50539491-50539513 GTGGGGAGGAGGAGAGGGAAAGG + Intergenic
954856645 3:53649517-53649539 GTGGGGGGGAGGTGTGTGGAGGG - Intronic
954999199 3:54911312-54911334 GGGAGGAGGAGAAGCGGGGAGGG - Intronic
955223708 3:57044080-57044102 GGGTGAAGGAGGAGTGTGGCAGG - Intronic
955727660 3:61950069-61950091 TTCTGGAGGAGGGGCCTGGAAGG - Intronic
958475071 3:94569752-94569774 AAGTGGAGGAGGAGCCTGGTGGG + Intergenic
959149326 3:102590056-102590078 ATGTGGAGGAGGGGCCTGGTAGG + Intergenic
959260859 3:104077722-104077744 GTGGGGAGGAGGGGAGGGGAGGG + Intergenic
959538624 3:107515256-107515278 GTGGGGAGGAGGTGCGGTGAGGG - Intergenic
960213699 3:115003359-115003381 GTGGGGAGGAGAAGGGTGAATGG + Intronic
960702214 3:120450422-120450444 GCGGGGAGGAGGAGAGGGGACGG - Intronic
960928755 3:122822954-122822976 GTGGGGAGGTGGAGGGCGGATGG - Intronic
960966754 3:123110862-123110884 GTATGCAGGAGGGGCGGGGAGGG + Intronic
961524413 3:127487495-127487517 GTGTGGAGGAGGTCAGTGGAGGG - Intergenic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961828538 3:129611626-129611648 GTGTGGAGGGGCAGCGGGGCAGG - Intergenic
962183455 3:133233181-133233203 GTGGGGTGGCGGAGCGGGGAGGG - Intronic
962645887 3:137439551-137439573 GTGTGGAGGAAAAGCAGGGAAGG - Intergenic
962816054 3:139001845-139001867 GGCTGGAGGAGGAGGGTGGATGG - Intergenic
962873505 3:139518454-139518476 GTGAGAAGGAGGGGCGTGGCTGG - Exonic
963068446 3:141282161-141282183 GTGAGCACGAGGAGAGTGGAGGG - Intronic
963194122 3:142507412-142507434 TTGTGGAGGAGGAGTTTGGAAGG - Intronic
963223649 3:142838309-142838331 ATGTTGAGGAGAAGCGTGGTGGG + Intronic
963255512 3:143140667-143140689 GTATGGAGGAGGGACCTGGAGGG + Intergenic
963808772 3:149753638-149753660 GTGTGGAGGAAGAGAGGGGAAGG + Intergenic
963993996 3:151685365-151685387 GTGCCAAGGAGGAGCATGGAAGG + Intergenic
966368940 3:179225399-179225421 GAGTGAAGGAGGATCATGGATGG + Intronic
966995246 3:185273717-185273739 GTGGGGTGGGGGAGCGGGGAGGG - Intronic
967272317 3:187741748-187741770 GTGTTGAGGAGGTTTGTGGATGG - Intronic
968082128 3:195853868-195853890 GTTTGGAGGACGTGGGTGGAGGG + Intergenic
968961393 4:3746022-3746044 GAGTGGGGGAGGGGCGGGGAGGG + Intergenic
968962240 4:3751537-3751559 GTGAGGAAGAGGAGCGAGGATGG - Intergenic
969016749 4:4108381-4108403 CTGTGGGGCTGGAGCGTGGAGGG + Intergenic
969327352 4:6451728-6451750 GCCGGGAGGAGGAGGGTGGAAGG - Intronic
969450217 4:7268723-7268745 GAGTGGAGGAGGAGCAGGGAGGG + Intronic
969738001 4:9003948-9003970 GTGGGGGGGTGGAGGGTGGAGGG + Intergenic
970038176 4:11763781-11763803 GTGTGGAGGTGGGGGGTGGGGGG + Intergenic
971969731 4:33605847-33605869 GTGTGGAGGAAGGGCCTGGTGGG - Intergenic
972242555 4:37208935-37208957 GTGTGGAGGTGGAGGGAGGGAGG - Intergenic
972446352 4:39148038-39148060 GTGTGGAGGGGGGGCGGGAAGGG - Intergenic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
976380048 4:84388880-84388902 GTGTGGACAAGGATCGTAGAGGG - Intergenic
978542931 4:109838195-109838217 GTGTGGAGGAGGAGTTGGGCAGG - Intronic
981127379 4:141122065-141122087 GTGAGCAGGAGGCGCCTGGAGGG - Intronic
981626683 4:146764390-146764412 GTGGGGAGGAGGAGAGAGGAGGG + Intronic
981813398 4:148801324-148801346 GTGTGGTGGAGGCGGGTGGTGGG + Intergenic
982551653 4:156808649-156808671 GGGTGGAGGGGGTGCATGGAGGG + Intronic
982623251 4:157732254-157732276 GTGGGGAAGAGGTGTGTGGATGG - Intergenic
982718300 4:158832057-158832079 TTGTGGAGGAGAACTGTGGAGGG - Exonic
983613098 4:169671748-169671770 GTGTGGGGAAGGTGTGTGGAGGG + Intronic
983925674 4:173399246-173399268 GTGGGGAGGAGGGGAGTGGAAGG + Exonic
984760317 4:183357531-183357553 GTCTGGAGGAGCAAGGTGGACGG + Intergenic
984800256 4:183709449-183709471 GTGTGGAATAGGAGCTTGGGAGG - Intronic
985117277 4:186604817-186604839 GTGAGGAGGAAGAGGGAGGAGGG + Intronic
985211864 4:187604074-187604096 GAGGGGAGGAGGAGAGGGGAGGG - Intergenic
985564940 5:610985-611007 GTGTGCAGGAGGTGTGTGCAGGG - Intergenic
985783164 5:1881334-1881356 GGGTGGGGGAGGAGCAAGGAGGG + Intronic
986279992 5:6314954-6314976 GGGGTGAGCAGGAGCGTGGATGG + Intergenic
986765730 5:10924317-10924339 ATGTGGAGCAGGAGTGAGGAGGG - Intergenic
988528251 5:32005043-32005065 ATGTGGATGAGGACCTTGGATGG - Intronic
989499624 5:42150253-42150275 ATGTGGAGGAGGGGCCTGGTGGG + Intergenic
989690354 5:44136168-44136190 GTGGGGTGGAGGAGGGGGGAGGG - Intergenic
991036408 5:62131959-62131981 GTGTGGTGGAGAAGGGTGTAGGG - Intergenic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
991298119 5:65102784-65102806 TTGGGGAGGAGGCGTGTGGAGGG - Intergenic
991483001 5:67103509-67103531 GAGGGGAGGAGGAGGGAGGAAGG + Intronic
991657759 5:68920868-68920890 GTGCGGAGGAGAGGCGCGGAAGG + Intergenic
992093365 5:73339064-73339086 GTGTGGTGGAGGAGAGATGATGG + Intergenic
992652412 5:78872665-78872687 GTGGGGAGGGGGAGGGGGGAGGG + Intronic
992947106 5:81821932-81821954 GTCTGGAGGAGGGCCATGGATGG - Intergenic
994414624 5:99454079-99454101 GTGGGGTGGAGGAGGGGGGAGGG - Intergenic
994626796 5:102230190-102230212 GGGTGGAGCAGGAGGGTGGAAGG + Intergenic
995062930 5:107831107-107831129 GGGGAGAGGAGGAGTGTGGAAGG - Intergenic
995388307 5:111612243-111612265 GGGTGGAGGAGGGGCGGGGGCGG + Intergenic
995551413 5:113285495-113285517 GTGAGCAGGGGGAGAGTGGAAGG - Intronic
997075083 5:130664586-130664608 GTGGGGTGGGGGAGCGGGGAGGG + Intergenic
997774239 5:136585242-136585264 GTGTTGAGGAGGATCAGGGATGG + Intergenic
997856347 5:137376285-137376307 GTCTGCAGGAGGAGGGTGGTAGG - Intronic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
998837753 5:146219827-146219849 GTTGGAAGGAGGAGAGTGGATGG - Intronic
999322252 5:150622779-150622801 CTGTGGAGCAGGGGAGTGGAGGG - Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999943201 5:156567276-156567298 GTGTGGAGGGGGTGAATGGATGG + Intronic
1000792964 5:165629658-165629680 GTATAGAGGAGAAGCGGGGAAGG + Intergenic
1000990151 5:167903529-167903551 GGGTGGGGGTGGAGGGTGGAAGG + Intronic
1001152948 5:169248003-169248025 GGGTGGAGGAAGAGTGTGGTTGG + Intronic
1001210173 5:169803681-169803703 GTGTGGAGTAGGATGGTGGTAGG + Intronic
1001293890 5:170485426-170485448 GTGTGGACGGGGAGGGTGGCTGG + Intronic
1001364397 5:171122410-171122432 TTGTGGAGGAGGCGAGTGTAGGG - Intronic
1001398553 5:171433378-171433400 GTGAGCAGGAGGAGAGTAGAAGG + Intronic
1001595819 5:172898121-172898143 GTGTTGAGCAGGAGAGTGGGTGG - Intronic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1003010646 6:2423785-2423807 TTGTGGAGGAGGAGCCAAGATGG - Intergenic
1003558119 6:7158547-7158569 GTATGGAGGTGGAGGCTGGAGGG - Intronic
1004292856 6:14384163-14384185 GTGGGGAGGTGTAGCTTGGAAGG + Intergenic
1004420917 6:15469156-15469178 GTGTGGAGGAGGAGGATAAAAGG + Intronic
1005773542 6:29103146-29103168 GTGTGTAGGGGGAGCGGGGAGGG + Intergenic
1005822227 6:29607416-29607438 GTGTGGAAGTAGAGGGTGGATGG - Intronic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006007359 6:31013102-31013124 GGGGTGAGGAGGAGAGTGGAGGG - Intronic
1006319006 6:33308475-33308497 GGGTGCAGGAGAAGCCTGGAAGG - Intronic
1006940411 6:37748351-37748373 TCTTGGTGGAGGAGCGTGGAGGG - Intergenic
1006984156 6:38166548-38166570 GTGCGGAGGGGGAAGGTGGAGGG - Intergenic
1007138620 6:39548317-39548339 GTGTGGGAGAGGAGCCTTGATGG - Intronic
1007732322 6:43954699-43954721 GTGGGGTGGGGGAGGGTGGAGGG - Intergenic
1007780109 6:44247748-44247770 CGGTGGAGGAGGGGCGGGGAGGG + Intronic
1007896708 6:45369554-45369576 CTTTGGTGGAGGAGAGTGGAGGG - Intronic
1008649055 6:53544922-53544944 GGGAGGAGGAGCAGCGGGGAGGG - Exonic
1010347022 6:74824148-74824170 GTGGGGTGGTGGAGGGTGGAGGG - Intergenic
1010398564 6:75421567-75421589 GTGAGGAGGAGTAGTGAGGAAGG - Intronic
1011625739 6:89282184-89282206 GTGTGGTGGAGGAGGGGGGCTGG - Intronic
1012218351 6:96616901-96616923 GTGTGGGGGAAGAGTGGGGAGGG - Intergenic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1013272924 6:108559835-108559857 GGGAGGAGGAGGAATGTGGAAGG + Intronic
1013298600 6:108781762-108781784 GTGAGGAGGAGTGGGGTGGAAGG + Intergenic
1013639628 6:112060507-112060529 GTGTGGAAGAGCAGAGTGGAAGG + Intronic
1013869784 6:114743156-114743178 GTGTGGAGGGGGAGTGGGGAGGG - Intergenic
1014139157 6:117920329-117920351 GTGTGGAGTAAGAGCTGGGACGG + Intronic
1014214388 6:118738726-118738748 GAGTGGAGGAGGAGGGGGAAAGG - Intergenic
1015189998 6:130461876-130461898 GTGGGGAGGAGGAGGGTGCTGGG - Intergenic
1015539683 6:134301247-134301269 GTGTGGAGGAGGAGGGAGAGTGG + Intronic
1015824342 6:137295810-137295832 GTGTGGAGGAGGAGTGGTGCAGG - Intergenic
1016073083 6:139764043-139764065 CTGTGGAGGAGTAGGCTGGAAGG - Intergenic
1016841859 6:148533245-148533267 GTGTGGAGCAGGAGCCAGGTGGG - Intronic
1017083411 6:150690636-150690658 GTGTGGAGGATGTGAGAGGAAGG + Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017637303 6:156456075-156456097 GAGTGGAGGAGGGGGGAGGAGGG - Intergenic
1018063182 6:160106227-160106249 GCGTGGAGGAGGAGGGAGGCCGG + Exonic
1019057873 6:169236060-169236082 GTGTGGATGGTGAGTGTGGATGG - Intronic
1019057935 6:169236346-169236368 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057942 6:169236375-169236397 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057987 6:169236604-169236626 GTGTGGATGGCGAGTGTGGATGG - Intronic
1019057992 6:169236633-169236655 GTGTGGATGGCGAGTGTGGATGG - Intronic
1019224569 6:170499645-170499667 GCGTGGAGAGGGAGCGAGGAAGG + Intergenic
1019257593 7:61962-61984 GTGGGGAGGAGGAGAGTGTGGGG - Intergenic
1019502242 7:1370069-1370091 ATGTGGAGGGGCAGTGTGGATGG + Intergenic
1019625486 7:2013786-2013808 GTGTAGATGAGAAGTGTGGATGG + Intronic
1019644561 7:2122014-2122036 GTGGGGAGGGGGAGACTGGAGGG + Intronic
1019907126 7:4073227-4073249 TTTTGGGGGAGGTGCGTGGAGGG - Intronic
1019924203 7:4181607-4181629 GTGTTGAGGAGGAGTGGGGCAGG - Intronic
1019930504 7:4219822-4219844 ATATGAAGGAGGAGCGGGGAGGG - Intronic
1020080039 7:5282243-5282265 GGATGGAGGAGGAGTGGGGATGG + Intronic
1020143033 7:5622803-5622825 GTTTGGGGTAGGAGTGTGGATGG - Exonic
1020261030 7:6530964-6530986 GGGTGGGGCTGGAGCGTGGAGGG - Intronic
1021433556 7:20588803-20588825 GAGTGGCGGAGGAGCTTGGGCGG - Intergenic
1021763951 7:23928372-23928394 TTGTGAAGGAGGAGTGCGGAGGG + Intergenic
1021884531 7:25125569-25125591 GTGTGCTGGAGGAGCGGGGAGGG + Intergenic
1024019183 7:45349481-45349503 CTGTGGAGGAGGAGGTTTGAAGG + Intergenic
1024175849 7:46840398-46840420 GTGGAGAGGTGGAGTGTGGAGGG - Intergenic
1026776035 7:73231638-73231660 GGATGGAGCAGGAGGGTGGAGGG + Intergenic
1026800650 7:73397871-73397893 GTGAGGAGGAGGCGGGGGGAGGG + Intergenic
1027016892 7:74785009-74785031 GGATGGAGCAGGAGGGTGGAGGG + Intronic
1027071135 7:75160927-75160949 GGATGGAGCAGGAGGGTGGAGGG - Intergenic
1029459344 7:100686321-100686343 GTGAAGAGGAGGGGCGGGGAGGG - Exonic
1029595953 7:101537788-101537810 GGGTGGAGGAGGAGGGAGCAGGG - Intronic
1029730696 7:102436019-102436041 GTGTGATGGAGGAGGGAGGACGG + Intronic
1029746099 7:102516612-102516634 GCCTGGAGGAGGAGGGTGGGAGG - Intronic
1029764037 7:102615591-102615613 GCCTGGAGGAGGAGGGTGGGAGG - Intronic
1030161980 7:106518495-106518517 GAGTAGAGGAGGGGAGTGGAGGG - Intergenic
1030402542 7:109070255-109070277 GGTTGGAGGAGGAGCCTGGTGGG - Intergenic
1031359531 7:120831646-120831668 GTGAAGAGGAGGAGGGTGAAAGG + Intronic
1031426827 7:121615489-121615511 GGGTGATGGAGGAGCATGGAAGG - Intergenic
1032448111 7:132002049-132002071 GTGTGGAGCAGGTGAGGGGATGG + Intergenic
1032660634 7:133979912-133979934 ATGTTGAGGAGCAGCGTGGGAGG - Intronic
1033023827 7:137753964-137753986 AGGAGGAGGAGGAGCGTGGAGGG + Intronic
1033808397 7:144980628-144980650 GGGTGGAGGTGGAGCCTGGTGGG + Intergenic
1034213772 7:149387370-149387392 CTGTGGAGGTGGGGCGTGGCAGG - Intergenic
1034324912 7:150221043-150221065 GGGCGGAGGAGGAGCTGGGACGG + Intergenic
1034642106 7:152612428-152612450 GTGTGGGGGTGGAGTGAGGATGG - Intergenic
1034768283 7:153748190-153748212 GGGCGGAGGAGGAGCTGGGACGG - Intergenic
1034900813 7:154906917-154906939 GTGTGGAGGGAGAGCGCGGGCGG + Intergenic
1034939393 7:155220570-155220592 GTGTGGAGGAGGGGCCAGGCTGG - Intergenic
1034945652 7:155260206-155260228 GGCTGGAGGGGGAGAGTGGAAGG - Intergenic
1035056268 7:156038832-156038854 GGGTGGAGGTGGAGGCTGGAGGG + Intergenic
1035249175 7:157585748-157585770 GAGGGGAGGAGGAGTGGGGATGG + Intronic
1035722463 8:1802386-1802408 GGGTGCAGGAGGAGCCTCGAGGG + Intergenic
1035732058 8:1860318-1860340 GAGAGGAGGAGGAGGGGGGAAGG - Intronic
1035732080 8:1860385-1860407 GAGAGGAGGAGGAGGGGGGAAGG - Intronic
1037567289 8:20128544-20128566 GTGTGGAGGATGAGAGATGAGGG + Intergenic
1037568863 8:20141622-20141644 GGGAGGAGGAGGAGGGGGGAGGG + Intergenic
1038150948 8:24942114-24942136 GGGAGGAGGAGGAGGGAGGAGGG - Intergenic
1038311502 8:26449330-26449352 GTGCGGAGGAGGGGGGAGGACGG + Intronic
1038485161 8:27929927-27929949 GTGTGAGGGAGGAGAGTGGTAGG - Intronic
1041205904 8:55497945-55497967 GTGTGGAACAGCAGCGGGGATGG - Intronic
1041421476 8:57671717-57671739 GGGTGGAGAAGCAGCTTGGAGGG + Intergenic
1041846154 8:62331126-62331148 GGGTGGAAGAGGAGGGAGGAAGG - Intronic
1042052426 8:64725687-64725709 GTTAGGAGGAGGAGCAGGGAGGG + Intronic
1042199601 8:66268729-66268751 GTGAAGATGAGGAGCCTGGAGGG - Intergenic
1042606054 8:70547906-70547928 GTGTTGAGGAGGGGCCTGGAGGG + Intergenic
1042877656 8:73454619-73454641 GTGTTGAAGAAGAGAGTGGATGG - Intronic
1043383092 8:79723484-79723506 GTGAGGAGGAAGAGAGAGGAAGG - Intergenic
1043427072 8:80158238-80158260 GTGGGGAGGAGGAGAATGGGAGG - Intronic
1043502759 8:80873703-80873725 GTGTGGAGGAGAAGCCCCGAGGG - Intronic
1044088448 8:87971141-87971163 GTGTGGAGGAGAGGCGTGGGCGG + Intergenic
1044714738 8:95089994-95090016 ATTTGGAGGAGGGGCTTGGAAGG - Intronic
1045031719 8:98143432-98143454 GTGTGGTGGCGGTGCATGGAAGG - Intronic
1045495027 8:102700845-102700867 CTGGGGAGGAGGAGCCTGGCTGG - Intergenic
1045575324 8:103414684-103414706 AGGGGGAGGAGGAGCGTTGAAGG - Intronic
1045855049 8:106755381-106755403 GTGTACAGGAGGAGAGAGGATGG - Intergenic
1047309909 8:123683241-123683263 TTGTGGAGGAGGAGAAAGGAGGG + Intronic
1047329013 8:123868107-123868129 GAGGGGAGAAGGAGCGGGGAAGG - Intronic
1047634733 8:126748505-126748527 AAGTGGAGGAGGGGCTTGGAGGG + Intergenic
1048167619 8:132077338-132077360 GTCTAGAGGAGGAAGGTGGAGGG + Intronic
1048332336 8:133479316-133479338 GTGTGGAGGAGAGGAGTGGGTGG + Intronic
1048498586 8:134956050-134956072 GTGTGGGGGCGGCGCCTGGATGG + Intergenic
1049083134 8:140457917-140457939 GGGAGGAGGAGGAGGGAGGAGGG + Intronic
1049127827 8:140808325-140808347 ATGAGGAGGAGGAGTGTGGCAGG + Intronic
1049306578 8:141907211-141907233 GCGTGGAGGAGGAGAGGGGAGGG + Intergenic
1050610437 9:7346867-7346889 GGATGGAGGAGGAGGATGGAAGG - Intergenic
1052074749 9:24127396-24127418 AAGTGGAGGAGGAACGTGGAGGG + Intergenic
1054770488 9:69078794-69078816 GAGTGGAGGAGGAGTTTGCAAGG - Intronic
1054916332 9:70498228-70498250 GTGGGGAGGAGGAAACTGGAGGG + Intergenic
1055139868 9:72864379-72864401 GGGTGGAGGAGGGGCGTGGAGGG - Intergenic
1055849944 9:80614840-80614862 GTGTGGAGGGGGAGACAGGAAGG - Intergenic
1055903851 9:81270563-81270585 GTGAGGAGGAGGTATGTGGATGG - Intergenic
1056817429 9:89811821-89811843 GTGGGGAGGAGGGCCGGGGATGG + Intergenic
1057152757 9:92809103-92809125 CTTTGGAGGAGGAGCGGGGCGGG + Intergenic
1057172562 9:92971948-92971970 GTGTGGGGGAGGGGGGTGGATGG - Intronic
1057185250 9:93053824-93053846 GTGTGCAGGATGAGCATGGGGGG + Intergenic
1058227454 9:102383094-102383116 GGGTGGGGGAGGAGGGGGGAGGG - Intergenic
1058840516 9:108903218-108903240 GTGGGGTGGGGGAGGGTGGAGGG - Intronic
1059418630 9:114177416-114177438 GTGTGGAGGAGGACTGCAGAGGG + Intronic
1059991114 9:119867594-119867616 GTGTGCAGGAGGAGTGTGGGGGG + Intergenic
1060225303 9:121786661-121786683 ATGTGGAGGATGAGCAGGGAAGG - Intergenic
1060227630 9:121804086-121804108 GTGTTGAGGGTGAGGGTGGACGG - Intergenic
1060227804 9:121806080-121806102 GTGTTGAGGGTGAGGGTGGACGG + Intergenic
1060389443 9:123267010-123267032 TTGGGGAGGAGGAAGGTGGAGGG - Intronic
1060847187 9:126846926-126846948 GTGTGGAACAGGTGCCTGGAGGG + Intergenic
1061624731 9:131835036-131835058 TTGTGCAGGAGGAGCGAGGTGGG - Intergenic
1061947165 9:133914785-133914807 GAGAGGAGGAGGAGAGGGGAAGG + Intronic
1062187041 9:135223725-135223747 GGGTGGGGGAGCAGCCTGGAGGG + Intergenic
1062302016 9:135879087-135879109 ATGAGGAGGAGGGGAGTGGAGGG + Intronic
1062303109 9:135886945-135886967 GTGTGGAGGAGGAGGGCAGTCGG + Intronic
1062424510 9:136499854-136499876 GTGAGCAGAAAGAGCGTGGAAGG - Intronic
1062467508 9:136687647-136687669 CTGTGGGGAGGGAGCGTGGAGGG - Intergenic
1062556997 9:137117552-137117574 GTGTGGAGGAGCTGCCTAGATGG - Intergenic
1062683689 9:137799041-137799063 GTGTGGAAGAGGACGCTGGAGGG - Intronic
1062683708 9:137799121-137799143 GTGTGGAAGAGGACGCTGGAGGG - Intronic
1203350035 Un_KI270442v1:72015-72037 GTGGAGAGGAGTGGCGTGGAGGG + Intergenic
1185449521 X:275096-275118 GGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1185915483 X:4029775-4029797 CTTTGCAGGAGGAGAGTGGAAGG + Intergenic
1186363746 X:8870391-8870413 ATGTGGAGGAGGAGCAGGAAAGG + Intergenic
1186606889 X:11101713-11101735 GTGTGGGGGTGGAGCATGGCAGG - Intergenic
1186609314 X:11123510-11123532 GTGGGGAGGAGGCTAGTGGAGGG + Intergenic
1186641781 X:11463247-11463269 GTGTGGAGAGGGAGGATGGAGGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187365432 X:18662443-18662465 GTGGGGTGGGGGAGCGGGGAGGG - Intronic
1187654880 X:21460668-21460690 GGGTGGAGGAGAAGTGGGGATGG - Intronic
1188204954 X:27344564-27344586 GTTTGGAGGCGGAGCCTGGTGGG + Intergenic
1188296331 X:28454159-28454181 GTGGGGTGGGGGAGCGGGGAGGG + Intergenic
1189171213 X:38911489-38911511 GTGGGGTGGGGGAGCGGGGAGGG + Intergenic
1189197654 X:39165746-39165768 GTGGGGAGGAGCAGTGAGGAGGG - Intergenic
1190066632 X:47245866-47245888 GTGTGGAGGAGGGAGGAGGAAGG - Intronic
1190246076 X:48691235-48691257 GCCTGGAAGAGGAGAGTGGAGGG - Exonic
1190641043 X:52482873-52482895 GTGTGGGGGAGGGGCTTGGAGGG - Intergenic
1190646629 X:52529992-52530014 GTGTGGGGGAGGGGCTTGGAGGG + Intergenic
1191977168 X:66885809-66885831 GTGTGGAGGAGGCGGGAGCAGGG + Intergenic
1192142390 X:68656857-68656879 GTGGGGTGGAGGAGGGGGGAGGG + Intronic
1192172988 X:68868239-68868261 GTGTGGAGGAAGAGTGAGGCTGG + Intergenic
1194501017 X:94680823-94680845 ATGTGGAGGTGGAGCCTGGTGGG + Intergenic
1194517112 X:94868237-94868259 GTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1195047055 X:101063731-101063753 GTCTGGTGGTGGAGGGTGGAGGG - Intergenic
1195339373 X:103891259-103891281 GTGTGGTGGGGGAGGGTGGAGGG - Intergenic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1197647633 X:129035238-129035260 GAGTGCAGGAGGAGCCTGAAAGG + Intergenic
1198265566 X:135005618-135005640 GTGACGATGAGGAGCCTGGATGG - Intergenic
1198638688 X:138730185-138730207 GTGGGGTGGAGGAGGGGGGAAGG + Intronic
1199736718 X:150692935-150692957 GTATGGAGGGGGAGAGTGGAGGG + Intergenic
1199747682 X:150784256-150784278 GAGGGGAGGAGAAGCGGGGAGGG - Intronic
1199940936 X:152627225-152627247 GGGTTGAGGTGGAGCGTGAAGGG - Intergenic
1200762125 Y:7049022-7049044 GTGGGGTGGGGGAGCGGGGAGGG - Intronic
1200897146 Y:8387918-8387940 GTGGGGTGGGGGAGCGGGGAAGG - Intergenic
1201130886 Y:10951101-10951123 GTGTAGTGGAGTAGAGTGGAAGG - Intergenic
1201137977 Y:11005215-11005237 GTGTAGTGGAGTAGAGTGGATGG - Intergenic
1201721065 Y:17097926-17097948 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1202593508 Y:26512108-26512130 GTGGTGAAGAGAAGCGTGGATGG - Intergenic
1202593818 Y:26515239-26515261 GTGTTGAAGAGAAGTGTGGATGG - Intergenic