ID: 1142235109

View in Genome Browser
Species Human (GRCh38)
Location 16:88918384-88918406
Sequence AGCCACAGCCCACACTGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142235109_1142235115 7 Left 1142235109 16:88918384-88918406 CCTTCGCAGTGTGGGCTGTGGCT 0: 1
1: 0
2: 1
3: 19
4: 165
Right 1142235115 16:88918414-88918436 GGACCAGCTGCATCACAACGAGG 0: 1
1: 0
2: 1
3: 11
4: 74
1142235109_1142235119 28 Left 1142235109 16:88918384-88918406 CCTTCGCAGTGTGGGCTGTGGCT 0: 1
1: 0
2: 1
3: 19
4: 165
Right 1142235119 16:88918435-88918457 GGTCCCAGCCCACAGCCGTGGGG 0: 1
1: 0
2: 0
3: 18
4: 216
1142235109_1142235117 26 Left 1142235109 16:88918384-88918406 CCTTCGCAGTGTGGGCTGTGGCT 0: 1
1: 0
2: 1
3: 19
4: 165
Right 1142235117 16:88918433-88918455 GAGGTCCCAGCCCACAGCCGTGG 0: 1
1: 0
2: 2
3: 17
4: 263
1142235109_1142235118 27 Left 1142235109 16:88918384-88918406 CCTTCGCAGTGTGGGCTGTGGCT 0: 1
1: 0
2: 1
3: 19
4: 165
Right 1142235118 16:88918434-88918456 AGGTCCCAGCCCACAGCCGTGGG 0: 1
1: 0
2: 0
3: 14
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142235109 Original CRISPR AGCCACAGCCCACACTGCGA AGG (reversed) Intronic
900687439 1:3957756-3957778 TCCCACACCCCACACTGTGAGGG - Intergenic
900933314 1:5750341-5750363 AGCCACACCCCAGACAGTGAAGG - Intergenic
901807434 1:11747493-11747515 AGCCACAGCCCACACGCCCAAGG - Exonic
904037250 1:27565415-27565437 GGCCACTGCCCAGACTGGGAGGG + Intronic
904274008 1:29368604-29368626 AGCCATAACCCTCAATGCGATGG - Intergenic
904467008 1:30714219-30714241 AGCCCCAGCCCCCTCTGGGAAGG + Intronic
905930644 1:41784611-41784633 AGCAACACCCCAAACTGTGAGGG + Intronic
908256790 1:62309750-62309772 TTCCACGGGCCACACTGCGATGG + Intronic
913231241 1:116742330-116742352 AGCCACAGCGCACAGTGAGAAGG - Intergenic
914505021 1:148281341-148281363 AGCCACAGGCTAAACCGCGATGG - Intergenic
915098913 1:153484578-153484600 AGCCACAGCCCTAATTGGGATGG + Intergenic
915296742 1:154926559-154926581 AGCCACACCCCACACTGCCCTGG - Intronic
915440407 1:155942194-155942216 AGCCGCCGCCCACACTGCCAGGG - Exonic
915523683 1:156463508-156463530 AGCCCCAGCCCACACTAAGGAGG - Intergenic
915597483 1:156903884-156903906 CGCCACTGCCCACTCTGCGCCGG + Intronic
919723603 1:200866738-200866760 GGCTTCAGCCCACACTGCTAAGG - Intergenic
919822611 1:201482462-201482484 AGCCAGAGCCCACCCTGGGCTGG + Intergenic
920340880 1:205274468-205274490 AACAACAGCCCACACTGAAAGGG + Intergenic
922881760 1:228986309-228986331 ATCCACAGATCACACTGTGATGG - Intergenic
1064402690 10:15034591-15034613 AGCCTCAGCTCACCCTGCAAAGG - Intronic
1076329284 10:129652950-129652972 ACCCTCAGCCCACACTGCTTGGG - Intronic
1076546232 10:131247159-131247181 ATCCACACCACACACAGCGACGG + Intronic
1077014025 11:392180-392202 ACCCACAGCCCTCTCTGCCAAGG + Intergenic
1077236919 11:1486312-1486334 AGCCGCCGGCCACACTGGGAGGG + Intronic
1078786420 11:14499245-14499267 AGCCACACCCCACAATGTTATGG + Intronic
1083311212 11:61784687-61784709 AGCCACAGCCCTCCCCGCCATGG - Intronic
1084675516 11:70631635-70631657 AGCCACATCCCCCACTGCGGGGG - Intronic
1089065536 11:115659508-115659530 TGCTACAGCCCACACGGCTAAGG - Intergenic
1089590992 11:119540602-119540624 ATCCCCAGCCCACACAGCCATGG + Intergenic
1090624195 11:128591720-128591742 AGCCACAGCTGAGACTGCAATGG + Intergenic
1090847523 11:130543351-130543373 AGCCTCTGCTCACACTGCGAGGG + Intergenic
1091241446 11:134055106-134055128 AGCCTCAGCCGACCCTGCGGGGG + Intergenic
1101319008 12:103656544-103656566 AGCCCCAGCCCACACTGTTTTGG + Intronic
1103342158 12:120226417-120226439 AGTCACATCCCACACTGCCAAGG + Intronic
1103852875 12:123944714-123944736 AGCCACAGACTCCACTCCGAGGG + Intronic
1104444867 12:128824552-128824574 AGCCAAAACTCACACTGAGACGG + Intergenic
1104606875 12:130196020-130196042 AGCCACAGTCCACACAGCAGGGG + Intergenic
1104714728 12:131008812-131008834 AGCCACAGCCCACAGAGGGAAGG + Intronic
1105738354 13:23295855-23295877 AGTCACAGCCCAGACTATGAAGG - Intronic
1105891369 13:24684856-24684878 TGCCAGAGCCCACACAGCGAAGG + Intronic
1112769713 13:102782051-102782073 GGGCACAGCCCTCACTGCTAGGG + Intergenic
1113467763 13:110524249-110524271 AGCCACCAGCCACACTGCAAGGG + Intronic
1113764514 13:112872824-112872846 AGCCACACCTCACACTGCTCAGG - Intronic
1113764516 13:112872854-112872876 AGCCACAGCTCACACTGCTCAGG - Intronic
1116956714 14:50931439-50931461 AGCCACTGCCCTCAGTGCAATGG + Intronic
1118887428 14:69878918-69878940 CGCCACAGCCCACCCTGTGCGGG + Intronic
1120133680 14:80837987-80838009 AGCCAGAGTCCCCACTGTGATGG - Intronic
1121087140 14:91155219-91155241 AGTCACAGCCCACACTCACAGGG - Intronic
1121468067 14:94128653-94128675 GGGCACAGCCCCCACTGCCAGGG + Exonic
1122029133 14:98899816-98899838 AGACACCAGCCACACTGCGAGGG - Intergenic
1122371948 14:101233897-101233919 AGCCACAGCCCACAGCCCCATGG + Intergenic
1122970981 14:105152105-105152127 CCCCACAACCCACACTTCGATGG + Intronic
1125525184 15:40369907-40369929 AGCCCCAGCCCACTCTCCTAAGG + Exonic
1125680087 15:41525023-41525045 AGCCACAGCCCACAGACGGAGGG + Exonic
1125764385 15:42123505-42123527 AGCCACAGCCCTCCCTGGGCTGG - Intergenic
1128389194 15:67171714-67171736 AGTCACATCCCACACTGCCCAGG - Intronic
1129058211 15:72837307-72837329 AGCCACAGCCTACTCTGGGCTGG + Intergenic
1131149797 15:90040143-90040165 AGCCACAGCCCAAGCTGGCATGG - Intronic
1132589678 16:721197-721219 AGCCCCAGGCCAGGCTGCGAGGG + Exonic
1134779572 16:16883588-16883610 AGAGACAGCCCACATTGAGATGG - Intergenic
1135724745 16:24845861-24845883 AGCCACAGCCCTCACCGCAGTGG - Exonic
1136060669 16:27724183-27724205 AGCCCCAGCCCACATAGCCATGG + Intronic
1136676466 16:31913108-31913130 ACACAAAGCCCAGACTGCGAAGG - Intronic
1137354240 16:47743989-47744011 AGGCACAGCCCACACTGAAGAGG + Intergenic
1138077423 16:54056475-54056497 AGCGTCAGCCCACACTGACAGGG - Intronic
1141445104 16:84052540-84052562 AGCACCAGCCCACACAGCAAAGG - Intergenic
1141614347 16:85202181-85202203 AGCCCCAGCCCTCACTGCCCAGG - Intergenic
1142135229 16:88448958-88448980 AGCCACAGCAGACACTGCGGAGG - Intergenic
1142235109 16:88918384-88918406 AGCCACAGCCCACACTGCGAAGG - Intronic
1143261994 17:5606411-5606433 AGCCACAGGGCACACTGTGTTGG + Intronic
1145011672 17:19371819-19371841 TCCCACAGCCCACACTCTGAAGG - Intronic
1146650553 17:34603636-34603658 TGCCACAGCCCACACAGGGAAGG - Intronic
1148877190 17:50696356-50696378 AGCATGAGCACACACTGCGAAGG + Intronic
1149598322 17:57876987-57877009 AGCCAAAGGCCACATTGCAAAGG + Intronic
1149790198 17:59470135-59470157 AGCTCCATCCCACACTCCGATGG - Intergenic
1149998435 17:61417013-61417035 AGCCACTGCCCGCACAGCGCAGG - Intergenic
1151952448 17:77362647-77362669 AGCATCAGCTCAGACTGCGAAGG - Intronic
1152574584 17:81134443-81134465 AGACACAGCCACCACGGCGAGGG + Exonic
1152927367 17:83093410-83093432 CGCCACCGCCCACACTTGGAGGG + Intronic
1160497793 18:79385341-79385363 AGCCAGAGGCCACACCGCCAGGG + Intergenic
1161746895 19:6065972-6065994 AGCCCCCGCCCCCACTGCCAGGG - Intronic
1162569535 19:11463224-11463246 ACCCACACCCCACCCTGGGATGG + Intronic
1164815694 19:31200780-31200802 ACCAACAGCCCACACTGTGGTGG - Intergenic
1164937134 19:32223735-32223757 AGGCACAGCTCACACCGGGAGGG + Intergenic
1167166715 19:47803761-47803783 CGCCCCAGCCCACACTGCCTGGG - Intronic
1167175122 19:47860003-47860025 CGCCCCAGCCCACACTGCCTGGG + Intergenic
925592638 2:5525709-5525731 AGGCACAGCCCAGTCTGCCATGG + Intergenic
925644294 2:6020466-6020488 ATCCACAGGCCTCACTGCAATGG - Intergenic
925781011 2:7381976-7381998 AGCCCTAGCCCGCAATGCGATGG - Intergenic
926118194 2:10226399-10226421 AGCCTCAGCTCACCCTGCAAAGG - Intergenic
926205215 2:10830798-10830820 AGCTCCAGCCCACTCTGCGCAGG - Intronic
927672306 2:25078989-25079011 AGCCAGAGTCCACAGTGAGAAGG - Intronic
928088260 2:28359018-28359040 AGCCACCACCCACACAGGGAAGG - Intergenic
932051731 2:68405054-68405076 GGCCACACCCCACACTGCTTCGG - Intergenic
934591558 2:95555664-95555686 ATGCACATCCCACACTGGGAAGG + Intergenic
937173286 2:119899414-119899436 AACCACAGCCCAAACTACGTAGG - Intronic
937213912 2:120298262-120298284 AGCCAGGGCCCCCACTGCAAAGG - Intergenic
937315674 2:120930768-120930790 AGGCAGAGCCCCCACTGAGAAGG + Intronic
941542505 2:166804256-166804278 AGCCAGAGCCCAGGCTGCCAGGG + Intergenic
947318397 2:228889938-228889960 AGACACAGCCCACACAGAGCTGG + Intronic
949022879 2:241751476-241751498 AGCCACATCCCACACTGTCTAGG - Intronic
949072135 2:242031727-242031749 AGGCTCAGCCCACACTGAGCCGG + Intergenic
1171188476 20:23141188-23141210 AGCCACACCCCACTCTGAGTCGG + Intergenic
1174446167 20:50592765-50592787 AACCACAGCCCACACTTCCAGGG + Intronic
1174845249 20:53937174-53937196 AGCCACAGCACCTACTGCCATGG + Intronic
1180641184 22:17300761-17300783 AGCCACAGCCCATACTGGTCTGG - Intergenic
1181013645 22:20056310-20056332 AGGCACAGGGCACACTGGGACGG - Intronic
1181361568 22:22341817-22341839 AGTCACAGGACACACTGCCATGG + Intergenic
1184989411 22:48156886-48156908 AGCCTTAGCCCCCACTGTGATGG + Intergenic
1185128221 22:49023431-49023453 GGCCACAGCCCCCTCTGCCATGG + Intergenic
1185165315 22:49258306-49258328 GGCCACAGCCCCCAGTGGGAGGG + Intergenic
949897933 3:8784024-8784046 AGCCACTGCCCACACAACCATGG + Intronic
949920125 3:8993698-8993720 ATCAACAGCCCACATTGTGATGG - Intronic
953907436 3:46875366-46875388 AGCCCATGCCCACACTGCCAGGG + Intronic
954869884 3:53759671-53759693 TGCCACAGACCACACTTGGAGGG - Intronic
961655000 3:128436286-128436308 AGCCACAGTCCCCACTGTGGTGG + Intergenic
962193173 3:133332520-133332542 AGCCAGGGTCCACACTGAGATGG - Intronic
962235092 3:133700621-133700643 AGCCTCAGCCCACAGTGGAAAGG + Intergenic
963260071 3:143183546-143183568 ATCCACAGCACACACCGTGAGGG - Intergenic
964727149 3:159825383-159825405 AGCCACAGCTCACAGTGAGGAGG + Intronic
966504281 3:180681504-180681526 AGCTACAGCTGACACTGAGAGGG - Intronic
967154435 3:186679655-186679677 ATGCACACCCGACACTGCGAGGG + Intergenic
967734241 3:192935447-192935469 AGCCACAACCTACACTACGAAGG - Intergenic
968845418 4:3038688-3038710 AGCAACAAACCTCACTGCGAGGG - Intronic
969079791 4:4609579-4609601 AGCCTCAGCCCCCAGTGTGATGG + Intergenic
969192790 4:5535750-5535772 AGCCCCAGCCCCTAATGCGATGG - Intergenic
970481555 4:16480755-16480777 AGCAACAGCCCACTCGGCTAAGG - Intergenic
973598845 4:52520991-52521013 AGCCACAGTCCACACTGAGTAGG + Intergenic
975140487 4:70913480-70913502 AGAGACAGCCCACATTGCCAGGG + Intronic
975725870 4:77291170-77291192 AGCCATGGCCAACACTGTGAGGG + Intronic
985187973 4:187337920-187337942 AGCCACAGCCCTCATTTTGAGGG - Intergenic
985508239 5:297059-297081 AGGCTCAGCCCACACTGTGCCGG + Intronic
985739799 5:1608612-1608634 AGGCTCAGCCCACACTGTGCCGG - Intergenic
986179871 5:5383656-5383678 AGCCACCGCCCACACGACTATGG + Intergenic
988558662 5:32260696-32260718 CACCACAGCTCACACTGTGAAGG + Intronic
988857853 5:35246796-35246818 AGCCCCAGCCCACCTTGAGATGG - Intergenic
992749774 5:79851135-79851157 AGCCCCAGCCCACACCTGGAAGG - Intergenic
995290364 5:110444297-110444319 AGCCAGCGCCCACACAGGGAAGG - Intronic
995555667 5:113325794-113325816 ATCCACAGCCAACACTGACATGG + Intronic
997441909 5:133914468-133914490 AGCCAAAGCCCAGCCTGAGAGGG - Intergenic
998793004 5:145786297-145786319 AGTCACAGCCCACACTAAAAAGG - Intronic
1001158724 5:169295656-169295678 TGCCATAGCCCACATTGCCAAGG + Intronic
1002494765 5:179604157-179604179 ACCCACAGCACTCACTGGGAGGG - Intronic
1002694131 5:181072798-181072820 AGCCACAGCCGCCACTGCGTGGG - Intergenic
1002861131 6:1080501-1080523 AGCCACGGACCACACTGCCGAGG + Intergenic
1005742048 6:28801142-28801164 AGCCACAGCGGACACTGCACAGG - Intergenic
1006386197 6:33732360-33732382 AGGAACAGCCCCCACTGAGAGGG - Intronic
1006865614 6:37206892-37206914 AGACACAGCCCACATTCCAAGGG - Intergenic
1007589183 6:43011308-43011330 GGCCACAGCCCACACAGCCCTGG + Exonic
1010560410 6:77341758-77341780 AGCCAGTGCCCACACAGGGAGGG - Intergenic
1011028824 6:82898925-82898947 AGCCACAGCGCACACTGAGAAGG + Intronic
1018206428 6:161441266-161441288 AACCACATCCCAAACTGCCATGG - Intronic
1018788229 6:167125488-167125510 AGCCACAGCACACACTCTCAGGG - Intronic
1018872943 6:167796857-167796879 CGCCCCAGCCCACACTGAGCAGG + Exonic
1019387824 7:768374-768396 AGCCGCAGCTCACACTGGGAGGG + Intronic
1021906915 7:25343542-25343564 ACCCACAGCCCACACTTCCAGGG + Intergenic
1022104031 7:27185676-27185698 GACCACAGGCCACACAGCGACGG - Intergenic
1023141664 7:37108450-37108472 GGCCAAAGCCCACACTTCAAAGG - Intronic
1023141764 7:37109228-37109250 GGCCAAAGCCCACACTTCAAAGG + Intronic
1024030606 7:45456700-45456722 AGCCCCAACCCCCGCTGCGAGGG - Intergenic
1034207412 7:149329996-149330018 AGCCAGTGGCCTCACTGCGAGGG + Intergenic
1034415663 7:150963157-150963179 AGGCACAGCCCACACTCCCGAGG + Intronic
1034957367 7:155343492-155343514 GGCCAATGCCCACACTGCCAGGG + Intergenic
1036773982 8:11597493-11597515 AGAAACAGCCCACTCTGGGAAGG - Intergenic
1037773121 8:21814675-21814697 AGCGACAGCCCTCCCTGCGTGGG + Intergenic
1047510365 8:125511220-125511242 AGCCCCAGACCACACAGCTAAGG - Intergenic
1049697749 8:143991821-143991843 AGCCACAGCCCCCACCGCCTTGG - Intronic
1051350238 9:16192083-16192105 AGCCACTGCCTACACTGACAGGG + Intergenic
1056968561 9:91184251-91184273 AGCCACAGCCCACACCAAGTAGG + Intergenic
1058483957 9:105424414-105424436 CGCCCCAGCCCACACTAGGAGGG - Intronic
1059872745 9:118596111-118596133 AGCTAAAGCCCACACTGACATGG - Intergenic
1060995105 9:127871437-127871459 AGCCAAGGCCCACACTGGAAGGG + Intronic
1061053927 9:128211791-128211813 AGCCCCACCCCACACAGGGAGGG - Intronic
1061971523 9:134047923-134047945 AGCCACAGCCGGCGCTGCGGGGG + Intronic
1062070036 9:134550398-134550420 AGGCACAGCCACCACTGCCAGGG - Intergenic
1062192463 9:135255029-135255051 GGCCACACCCCACACTGCAGGGG + Intergenic
1062306615 9:135910865-135910887 AGCCACAGCCCAAACTCCGCCGG - Intergenic
1186522781 X:10220794-10220816 AGTGACAGACCACACTCCGATGG + Exonic
1186666477 X:11722136-11722158 AGCCCCAACCCCCAATGCGATGG + Intergenic
1189687594 X:43581638-43581660 AGCCATATCCCACACTAAGAGGG + Intergenic
1190445475 X:50519695-50519717 TGCCACAGCCCCCACTGAGGTGG - Intergenic
1196887011 X:120256107-120256129 CCCCAGAGACCACACTGCGAAGG - Exonic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1197910222 X:131474707-131474729 AACCACAGACCACACTTAGAAGG - Intergenic
1199716223 X:150508888-150508910 AGCCTCACCCCACACAGTGAGGG - Intronic
1200235323 X:154465241-154465263 CGCCACAGCCCAGACCCCGAAGG - Intronic