ID: 1142235476

View in Genome Browser
Species Human (GRCh38)
Location 16:88920616-88920638
Sequence CAACGGCCACAGGTGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142235468_1142235476 17 Left 1142235468 16:88920576-88920598 CCCCTGGCCAGGAATATTTCATC 0: 1
1: 0
2: 0
3: 10
4: 155
Right 1142235476 16:88920616-88920638 CAACGGCCACAGGTGGTGCATGG No data
1142235470_1142235476 15 Left 1142235470 16:88920578-88920600 CCTGGCCAGGAATATTTCATCTT 0: 1
1: 1
2: 2
3: 43
4: 396
Right 1142235476 16:88920616-88920638 CAACGGCCACAGGTGGTGCATGG No data
1142235467_1142235476 20 Left 1142235467 16:88920573-88920595 CCACCCCTGGCCAGGAATATTTC 0: 1
1: 0
2: 4
3: 106
4: 725
Right 1142235476 16:88920616-88920638 CAACGGCCACAGGTGGTGCATGG No data
1142235466_1142235476 23 Left 1142235466 16:88920570-88920592 CCACCACCCCTGGCCAGGAATAT 0: 1
1: 4
2: 73
3: 653
4: 3603
Right 1142235476 16:88920616-88920638 CAACGGCCACAGGTGGTGCATGG No data
1142235469_1142235476 16 Left 1142235469 16:88920577-88920599 CCCTGGCCAGGAATATTTCATCT 0: 1
1: 0
2: 7
3: 20
4: 257
Right 1142235476 16:88920616-88920638 CAACGGCCACAGGTGGTGCATGG No data
1142235471_1142235476 10 Left 1142235471 16:88920583-88920605 CCAGGAATATTTCATCTTAATTA 0: 1
1: 0
2: 2
3: 37
4: 451
Right 1142235476 16:88920616-88920638 CAACGGCCACAGGTGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142235476 Original CRISPR CAACGGCCACAGGTGGTGCA TGG Intronic
No off target data available for this crispr