ID: 1142236951

View in Genome Browser
Species Human (GRCh38)
Location 16:88926916-88926938
Sequence CAGAGAAAGGAGATGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1434
Summary {0: 1, 1: 0, 2: 11, 3: 121, 4: 1301}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142236951_1142236961 11 Left 1142236951 16:88926916-88926938 CCTGCCCTCATCTCCTTTCTCTG 0: 1
1: 0
2: 11
3: 121
4: 1301
Right 1142236961 16:88926950-88926972 CTCACTGGTCCTGGAGGTGGCGG 0: 1
1: 0
2: 2
3: 30
4: 366
1142236951_1142236959 8 Left 1142236951 16:88926916-88926938 CCTGCCCTCATCTCCTTTCTCTG 0: 1
1: 0
2: 11
3: 121
4: 1301
Right 1142236959 16:88926947-88926969 CTCCTCACTGGTCCTGGAGGTGG 0: 1
1: 0
2: 0
3: 36
4: 283
1142236951_1142236956 -4 Left 1142236951 16:88926916-88926938 CCTGCCCTCATCTCCTTTCTCTG 0: 1
1: 0
2: 11
3: 121
4: 1301
Right 1142236956 16:88926935-88926957 TCTGAGACAAGGCTCCTCACTGG 0: 1
1: 0
2: 1
3: 16
4: 140
1142236951_1142236963 27 Left 1142236951 16:88926916-88926938 CCTGCCCTCATCTCCTTTCTCTG 0: 1
1: 0
2: 11
3: 121
4: 1301
Right 1142236963 16:88926966-88926988 GTGGCGGCACACTCCTGCCTCGG 0: 1
1: 0
2: 7
3: 47
4: 1105
1142236951_1142236958 5 Left 1142236951 16:88926916-88926938 CCTGCCCTCATCTCCTTTCTCTG 0: 1
1: 0
2: 11
3: 121
4: 1301
Right 1142236958 16:88926944-88926966 AGGCTCCTCACTGGTCCTGGAGG 0: 1
1: 0
2: 1
3: 27
4: 299
1142236951_1142236957 2 Left 1142236951 16:88926916-88926938 CCTGCCCTCATCTCCTTTCTCTG 0: 1
1: 0
2: 11
3: 121
4: 1301
Right 1142236957 16:88926941-88926963 ACAAGGCTCCTCACTGGTCCTGG No data
1142236951_1142236964 28 Left 1142236951 16:88926916-88926938 CCTGCCCTCATCTCCTTTCTCTG 0: 1
1: 0
2: 11
3: 121
4: 1301
Right 1142236964 16:88926967-88926989 TGGCGGCACACTCCTGCCTCGGG 0: 1
1: 0
2: 4
3: 38
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142236951 Original CRISPR CAGAGAAAGGAGATGAGGGC AGG (reversed) Intronic
900354812 1:2255521-2255543 CACAGACAGGAAATGAGGTCAGG - Intronic
900354864 1:2255949-2255971 CACAGACAGGAAATGAGGTCAGG - Intronic
900407597 1:2499344-2499366 AAGAGACAGGAGCTGAGGACGGG + Intronic
900420602 1:2554438-2554460 CAGAGAAGGGAGAAAAGGGACGG + Intergenic
900626156 1:3609600-3609622 CAGAGAAGGGAGAGGAGGGGAGG + Intronic
900841618 1:5052977-5052999 CAGGGAAGGGAGATAAGGGTGGG - Intergenic
900847968 1:5118765-5118787 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
901031924 1:6312061-6312083 CGGAGAAGTGAGAAGAGGGCAGG + Intronic
901232320 1:7648095-7648117 GAGAGAGAAGAGAAGAGGGCTGG + Intronic
901324113 1:8356810-8356832 GGGAGATAGGAGGTGAGGGCAGG - Intronic
902130531 1:14256499-14256521 CAGAGAGAGGAAAGGAGGGAGGG + Intergenic
902410611 1:16209745-16209767 CAGAGCAAGGACCTGTGGGCTGG - Intronic
902730958 1:18368640-18368662 CAGAGAGAGGAGTGAAGGGCTGG - Intronic
902762015 1:18587428-18587450 CTGAGAATGGGGATGAGGGCAGG + Intergenic
902883019 1:19385352-19385374 AGAAGAAAGGAGAGGAGGGCAGG + Intronic
903449788 1:23445133-23445155 CAGAGAGGGGAGGTGATGGCTGG + Intronic
903807026 1:26012882-26012904 CAGAGGTGGGAGCTGAGGGCAGG - Intergenic
903820969 1:26102290-26102312 CAGAGAAAGTCCATGAGGGCAGG + Intergenic
903896655 1:26610428-26610450 CAGAGAATGGAAATGAGTGTTGG - Intergenic
903926812 1:26836263-26836285 GAGACAAAGGAGATGGGGTCTGG - Intronic
903974134 1:27138184-27138206 GTGAGAATGGAGAAGAGGGCAGG - Intronic
903996384 1:27307618-27307640 CAGAGACAGGGGCTGAGGGAGGG - Exonic
904055115 1:27664949-27664971 GGGTGAAAGGAGATGGGGGCGGG + Intergenic
904409671 1:30317903-30317925 ACGGGAAAGGAGGTGAGGGCTGG + Intergenic
904711317 1:32432626-32432648 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
904712101 1:32437915-32437937 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
904863542 1:33558776-33558798 GAGATAAAGGGGGTGAGGGCTGG - Intronic
905118478 1:35663088-35663110 TGGAGAAAGGAGATGAGTGGGGG - Intergenic
905223315 1:36463894-36463916 CACAGAAAGGAACTGAGGGGTGG - Intronic
905249972 1:36642080-36642102 TAGAGAAAGGAGATGAGGCTGGG + Intergenic
905395115 1:37661728-37661750 CAGAGGGAGGGGCTGAGGGCCGG + Intergenic
905595408 1:39202259-39202281 CAGATAAAGAATATGAGGCCGGG - Intronic
905647007 1:39632080-39632102 CAGATAAGGAAAATGAGGGCTGG + Intronic
905734471 1:40316207-40316229 CAGAGAAAGGAGGTGTAGGGAGG + Intronic
905859197 1:41336444-41336466 CAGAGAAAGTAGATTAGTGGTGG + Intergenic
905895407 1:41542663-41542685 CAGTGCAAGGGGATGATGGCAGG + Intronic
905899752 1:41573739-41573761 CAGATAAAGAAACTGAGGGCGGG + Intronic
906067269 1:42990859-42990881 GAGAGACAGGAGATGAGGGAAGG - Intergenic
906112272 1:43331977-43331999 CAGAGAAAACGGAGGAGGGCCGG - Intergenic
906112873 1:43336241-43336263 CAGTGACAGGAGATGAGCACAGG + Intergenic
906190718 1:43898045-43898067 CTGAGAAAGGAGGTGATGGCAGG - Intronic
906466848 1:46089418-46089440 TAAAGAAAGGAAATGAGGCCAGG + Intronic
906668208 1:47636552-47636574 CAGAGAAAGGACAGGAGCCCAGG - Intergenic
906681174 1:47726358-47726380 CAGAGAGAAGACTTGAGGGCTGG + Intergenic
907295493 1:53449702-53449724 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
907373899 1:54020209-54020231 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
907503107 1:54898005-54898027 CAGTGAAAGGAGATAAGTGTGGG + Intergenic
907520950 1:55023035-55023057 CAGCGAAGGGAGATAAGGGTAGG - Intergenic
907521757 1:55028246-55028268 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
907800512 1:57760543-57760565 TAGAGAAGGGAGGAGAGGGCAGG - Intronic
907853613 1:58280270-58280292 AAGAGACAGGAGATCAGGGAAGG - Intronic
908230924 1:62104123-62104145 CAGAGATAGGAAGGGAGGGCGGG + Intronic
908403283 1:63790708-63790730 GAGAAAAAGGTGCTGAGGGCCGG - Intronic
908461221 1:64350044-64350066 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
908462041 1:64355419-64355441 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
908852011 1:68386314-68386336 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
908852891 1:68391869-68391891 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
909015332 1:70373900-70373922 CAGAGAAGGGAGATAGGGGTGGG - Intronic
909035939 1:70593869-70593891 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
909223175 1:72987900-72987922 CAGTGAATGGAGATAAGGGTGGG + Intergenic
909223992 1:72993253-72993275 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
909469303 1:76008840-76008862 GAGAAAAAGGAAATGAGGGTGGG - Intergenic
909551310 1:76900078-76900100 CAGCGAAGGGAGATAAGGGTGGG + Intronic
909787799 1:79638861-79638883 CAGGGAAGGGAGATAAGGGTGGG + Intergenic
909890244 1:80996229-80996251 CAGAGAATGTAGATGAAAGCTGG - Intergenic
909909608 1:81245610-81245632 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
909910440 1:81251084-81251106 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
910054011 1:83009844-83009866 CAGAGAAAGGAAAGGAAGGATGG - Intergenic
910272353 1:85410342-85410364 GAGAAAAAGGAAATGAGGCCGGG + Intronic
910330322 1:86066024-86066046 CAGAGAAAGTAGATAAGCACTGG + Intronic
910851152 1:91650972-91650994 AAGAGCAGGGAGATGAGGGGAGG + Intergenic
910922173 1:92359889-92359911 CAGAGAAAGCAGAAAAGGGGAGG + Intronic
911010816 1:93279164-93279186 CAGAGAAAGGAAAAGAGGCGAGG + Intergenic
911075048 1:93864997-93865019 TCGAGAAAGAAGATGAGGGCAGG + Intergenic
911254062 1:95614252-95614274 CAGTGCATGGAGCTGAGGGCCGG - Intergenic
912184667 1:107260907-107260929 CAGAGAAAGGAGATTCCAGCTGG + Intronic
912233088 1:107818105-107818127 CAGAGTGAGGAGAGCAGGGCAGG + Intronic
912591322 1:110824146-110824168 CAGAGAATGAAGTTGTGGGCTGG - Intergenic
912811875 1:112801181-112801203 CATAAAAAAGAGGTGAGGGCCGG + Intergenic
912812222 1:112803092-112803114 CAGGGAGTGGAGAGGAGGGCAGG - Intergenic
912939481 1:114032359-114032381 CAGTGAAAGGAGATAGGGGTGGG - Intergenic
912940129 1:114037402-114037424 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
913105012 1:115606076-115606098 GAGAGAAAAGAGATGAGGCAAGG - Intergenic
913537223 1:119784671-119784693 CAGCCAACAGAGATGAGGGCTGG - Intergenic
914703824 1:150155631-150155653 CACAGAAAGAAGATCAAGGCAGG - Intronic
914756198 1:150562738-150562760 CTGAGAATTGAGATGAGGGTGGG + Intergenic
914826913 1:151143562-151143584 CAGAGGCAGCAGATGAGGGAAGG - Intronic
914833672 1:151189918-151189940 CGGACAAAGAAGAAGAGGGCGGG - Intronic
915101816 1:153506523-153506545 CAGAGGAAGCAGATGAGAGGTGG - Intergenic
915141232 1:153769869-153769891 CTGGGAGAGGAGAGGAGGGCAGG + Intronic
915231125 1:154446055-154446077 AAGACAAAGAAGATGGGGGCAGG - Intronic
915591175 1:156871511-156871533 GATGGAAAGGAGAGGAGGGCTGG - Intronic
915594644 1:156889224-156889246 CAGGTAAAGGAGATGAAGGCAGG - Intergenic
915596504 1:156899464-156899486 GAGAGAAAGGAAGTGGGGGCAGG - Intronic
915601795 1:156927280-156927302 CAGAGAAAGGGGGTGAGGGCAGG - Intronic
915742232 1:158127693-158127715 CAGAGGAAGGAAATGAGGCCTGG + Intergenic
916187354 1:162146070-162146092 TTCAGAAAGGAGATGAGAGCTGG + Intronic
916406994 1:164507516-164507538 GAGAGAGAGGAAATGATGGCAGG - Intergenic
916412436 1:164559380-164559402 GGGAGAAAGGAGAGGAAGGCAGG - Intronic
916759509 1:167803824-167803846 AGGAGAAAGGAGAGGAGGGGAGG - Intergenic
917049492 1:170903675-170903697 AAGATGCAGGAGATGAGGGCTGG - Intergenic
917288637 1:173448516-173448538 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
917685795 1:177414501-177414523 CAGAGAAAGGAGCAGAGGAAGGG + Intergenic
917964835 1:180171934-180171956 CAGAGAGAGGCCAGGAGGGCGGG + Intronic
918270089 1:182889890-182889912 CTAAGAAAGGAAATGAAGGCGGG - Intergenic
918300502 1:183199496-183199518 GAGAGAAAGGAATTGAGGGAGGG - Intronic
918713918 1:187765609-187765631 CAGGGAAGGGAGATAAGGGTGGG + Intergenic
919046810 1:192463135-192463157 GATAGAACGGAGATGAAGGCCGG + Intergenic
919260501 1:195187625-195187647 CAGGGAAAGGAAAAGAGGGATGG - Intergenic
919751021 1:201038320-201038342 CAGAGAGAGGGGATAAGGGCTGG + Intergenic
920026875 1:203005541-203005563 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
920030974 1:203037214-203037236 CAGGGAAAAGAGAGAAGGGCCGG - Intronic
920199689 1:204251928-204251950 GTGAGAAATGAGATCAGGGCAGG - Intronic
920785042 1:209033252-209033274 CAGGGAAAGGGGCTGAGTGCAGG + Intergenic
920867893 1:209768541-209768563 CAGAGAGATGAGCTGTGGGCTGG + Intronic
921010176 1:211133693-211133715 CAGAGAAAGGTGGGCAGGGCGGG - Intronic
921211937 1:212908412-212908434 CAGCGAAAGGAGATAAGGGTGGG + Intergenic
921212181 1:212910335-212910357 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
921212825 1:212914558-212914580 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
921328664 1:214013766-214013788 CAGATAAAGGAGAGGTGGCCTGG - Intronic
921519826 1:216145928-216145950 CAGCGAAGGGAGATAAGGGTGGG - Intronic
921520841 1:216152565-216152587 CAGTGAAGGGAGATAAGGGTGGG - Intronic
922048881 1:221971510-221971532 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
922049052 1:221973179-221973201 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
922145753 1:222942543-222942565 CACTGAAAGGAGAGGTGGGCAGG + Intronic
922154396 1:223029803-223029825 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
922906063 1:229174588-229174610 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
922906884 1:229180053-229180075 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
923244418 1:232118442-232118464 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
923245249 1:232123822-232123844 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
923256848 1:232229730-232229752 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
923720758 1:236464774-236464796 CAGAGAAAGGAGGTCAGAGAGGG - Intronic
923905505 1:238379540-238379562 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
924194922 1:241596461-241596483 CAGTGAGAGGAGATTAAGGCAGG + Intronic
924206593 1:241718326-241718348 CAGAGGAAGGTGATTAGGGAAGG + Intronic
924548239 1:245050394-245050416 TAGAAAACGGGGATGAGGGCTGG - Intronic
1062931288 10:1354448-1354470 CAGCGAAGGGAGATGGGGGTGGG - Intronic
1062942054 10:1429884-1429906 CAAGGAAAGGAGATGAGGGGAGG - Intronic
1063174567 10:3539842-3539864 GAGAGAGAGGACATGAGAGCTGG + Intergenic
1063222043 10:3978049-3978071 GAGAGGAAGGAGAGGAGGTCTGG - Intergenic
1063303208 10:4872592-4872614 CAGAGAGTGGAGATGCAGGCAGG - Intergenic
1063338676 10:5242479-5242501 CAGAGACAGGAGATGAGACTTGG + Intergenic
1063432862 10:6006195-6006217 CAGTGAGAGGAGATGAAGGAGGG + Intergenic
1063509972 10:6635194-6635216 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1063527204 10:6797184-6797206 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1063690506 10:8282580-8282602 AAGAGAAAGTAGGTGAGGGTAGG - Intergenic
1064887334 10:20124635-20124657 CAGCGAAGGGAGATGGGGGTGGG + Intronic
1064908274 10:20370945-20370967 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1065011340 10:21423538-21423560 GAGAGAAAGGAAAGGAGGGAAGG + Intergenic
1065240320 10:23697073-23697095 TAGAGAACGGAGATGGGTGCTGG - Intronic
1065442670 10:25769057-25769079 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1065443505 10:25774537-25774559 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1065483744 10:26217399-26217421 CAGATAAAGGAAATGAGGGCTGG + Intronic
1065862971 10:29886846-29886868 GAGAGGAAGGAGATGGGGGTAGG + Intergenic
1065892287 10:30131687-30131709 CAGACAAAGTGGAAGAGGGCAGG - Intergenic
1065952375 10:30663922-30663944 CAGAGAAAAGAGATGAGGGAAGG - Intergenic
1065961136 10:30735203-30735225 GGGAGAATGGAGAAGAGGGCGGG - Intergenic
1066954973 10:42157561-42157583 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1067432835 10:46255171-46255193 CAAGGAAAGCAGATGGGGGCAGG + Intergenic
1067455662 10:46417953-46417975 CAGAGAAATGGGGTGAGGCCAGG - Intergenic
1067544036 10:47179079-47179101 CAGATAAAGCAGCTGAGGCCCGG - Intergenic
1067631541 10:47966686-47966708 CAGAGAAATGGGGTGAGGCCAGG + Intergenic
1067688002 10:48479331-48479353 CAGAGAATGGAGATGAGGGAAGG + Intronic
1067721754 10:48732552-48732574 GAGGGAAAGGAGCTAAGGGCTGG + Intronic
1068168234 10:53358912-53358934 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1068654899 10:59564436-59564458 CCAAGGAAGGAGAAGAGGGCAGG + Intergenic
1069937081 10:71925068-71925090 CAGAGGACAGAGATGTGGGCAGG + Intergenic
1070525497 10:77292634-77292656 AAGAGAAAGGAGCTGGGGCCTGG - Intronic
1070645856 10:78202022-78202044 CAGAGAAAAGAGCTGAAGGACGG + Intergenic
1070673808 10:78398146-78398168 TAGAGAAAGGAGATGGAGACAGG + Intergenic
1071162810 10:82770736-82770758 CTGAGATTGGAGATAAGGGCTGG + Intronic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1071590213 10:86865478-86865500 CAGCGAAGGGAGATGAGGGTGGG - Intronic
1071897258 10:90081119-90081141 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1071898052 10:90086440-90086462 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1071924045 10:90384840-90384862 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1072413970 10:95231520-95231542 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1072751034 10:97979004-97979026 CTGAGTGAGGAGATGGGGGCAGG + Intronic
1073048363 10:100653221-100653243 CAGAGAAAGAAGATAAAGACAGG - Intergenic
1073443653 10:103568166-103568188 CAGACAAAGGAGGTGGGGCCAGG - Intronic
1073708886 10:106016840-106016862 CAGTGAAGGGAGATAAGGGTAGG + Intergenic
1074751641 10:116592501-116592523 TAGACAAAGGAGATGAGAGCTGG + Exonic
1074981172 10:118621076-118621098 CAGAGGAAGGAAGTGAGGGATGG - Intergenic
1075334832 10:121601069-121601091 AAGAGAAAGGAGAAGGGGGTGGG + Intergenic
1075354965 10:121763585-121763607 CAGAGGATGGAGATGCGGGAGGG + Intronic
1075511110 10:123073660-123073682 CAGAGAATGCAGCTAAGGGCAGG - Intergenic
1075531403 10:123233192-123233214 GAGAGAAAGGAGGGGAGGGGAGG - Intergenic
1075664576 10:124221409-124221431 CAGATAAAGGAAATGAGGCCGGG + Intergenic
1075796932 10:125127301-125127323 CACAGACATGAGATCAGGGCAGG - Intronic
1076180353 10:128402257-128402279 CAGAGACAGAAGAAGAGAGCTGG + Intergenic
1076338496 10:129726843-129726865 GACAGAAAGGACATGAGGACAGG - Intronic
1076345539 10:129776411-129776433 CAGAGACAGGTGATGAGCTCTGG - Intergenic
1076564167 10:131386823-131386845 CAGAGAAAGGAGAGGAGCAGAGG + Intergenic
1076843314 10:133057121-133057143 CAGAGGCAGGTGAGGAGGGCGGG + Intergenic
1076988162 11:254153-254175 CAGGGAGAGCAGATGAGGGTAGG - Intergenic
1077066975 11:645675-645697 CAGAGAAAGGAGGTGGGGGATGG + Intronic
1077398510 11:2339648-2339670 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1077578033 11:3399072-3399094 CAGAGAAGGGAGATAGGGGTAGG - Intergenic
1077611850 11:3648185-3648207 CAGCGAAGGGAGATAAGGGTGGG - Intronic
1077612660 11:3653515-3653537 CAGCGAAGGGAGATAAGGGTGGG - Intronic
1077719277 11:4610480-4610502 CAGAGGAAGGAGGTCAGGGATGG + Intergenic
1077752903 11:4992143-4992165 AAGAGAAGGGAGATCTGGGCAGG + Intronic
1077831359 11:5874723-5874745 GTGAGAAAGGAGAAGAGAGCTGG - Intronic
1078452881 11:11453316-11453338 CAGAGATGGGAGGTGAGTGCTGG - Intronic
1078539561 11:12202158-12202180 GAGAGAAAAGAGATGAGAGTTGG - Intronic
1078764565 11:14282090-14282112 CAGAGTATGGAGTTGAGGGGTGG + Intronic
1078811030 11:14763449-14763471 CAGAGAAATGAGATAGTGGCCGG + Intronic
1078882637 11:15467070-15467092 CCAAGAAAGGAGCTGAGGTCAGG - Intergenic
1078968553 11:16376861-16376883 AAGAGAAGGGAGATAAGGGAAGG + Intronic
1079085654 11:17443027-17443049 CAGACAAAGAAGCTGAGGCCTGG + Intronic
1079297062 11:19242661-19242683 CTGCGAAACGCGATGAGGGCGGG + Intergenic
1079414230 11:20218139-20218161 CCCAGAAAGGAGATAAGGGGTGG - Intergenic
1079672088 11:23184033-23184055 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1079672907 11:23189392-23189414 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1080122882 11:28697583-28697605 GAGAGAAAGGTGATGGGGTCAGG - Intergenic
1080555593 11:33413921-33413943 CAGAAAAAGAAGATTAGAGCAGG + Intergenic
1080662887 11:34311842-34311864 CAGAGAAAGCCAATGGGGGCCGG + Intronic
1080775764 11:35385213-35385235 CATAAAAAGGAGGGGAGGGCAGG - Intronic
1080898320 11:36463975-36463997 GAGAGAGGGGAGATGTGGGCAGG + Exonic
1081220687 11:40456873-40456895 AAGAGCATGGAGATAAGGGCGGG + Intronic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1081967562 11:47178827-47178849 AGGAGAAAGGAAAGGAGGGCGGG + Intronic
1082082009 11:48019372-48019394 CAGAGAAAGGAGGTGGGGTTCGG - Intronic
1082912818 11:58395971-58395993 CACTGAAAGGAGATGGGGGTGGG + Intergenic
1083178912 11:60971923-60971945 CAGTGGCAGGAGATGAGGGAAGG - Intronic
1083187941 11:61028354-61028376 GAGAGAGAGGAGAGGAGGGAAGG - Intergenic
1083534071 11:63452966-63452988 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1083707684 11:64527454-64527476 CAGAGAGAGGACATGAGGCTCGG + Intergenic
1083920199 11:65778309-65778331 CAGAGGCAGGAGCAGAGGGCGGG + Exonic
1083990820 11:66244666-66244688 CAGAGAGAGGAGATGGGGGTGGG + Exonic
1084038558 11:66528518-66528540 AATAGAATGGAGATCAGGGCAGG + Intronic
1084046850 11:66573923-66573945 CAGAGAAGGGAGATAAGGGTGGG - Intergenic
1084047336 11:66576833-66576855 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1084155655 11:67311271-67311293 CAGAGAAAGCATAGGAGGGGAGG + Intronic
1084261500 11:67981751-67981773 AAGAGAATGGAGATCAGGCCCGG - Intergenic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084358136 11:68652841-68652863 CCTGGAAAGGAGAAGAGGGCGGG + Intergenic
1084369976 11:68734904-68734926 CAGAGCAGTGAGGTGAGGGCAGG - Intronic
1084421196 11:69061529-69061551 CAGAGAGAGGAGGTGGGGGCAGG + Intronic
1084613624 11:70219857-70219879 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1084796150 11:71505793-71505815 CAGCGAAAGGAGATAGGGGTGGG - Intronic
1084868703 11:72081004-72081026 CTGTGAAAGGTGATGAGGGTCGG - Intronic
1084951837 11:72670758-72670780 CGGAGAAAGGACATAAGGCCAGG + Intronic
1085324457 11:75595847-75595869 GAGAGAGAGGAGAGGAGGGGAGG - Intronic
1085413228 11:76303932-76303954 CACAGTAAGAAGATGTGGGCTGG + Intergenic
1085567147 11:77524550-77524572 CAGAGAACACAGAAGAGGGCAGG - Intronic
1085745605 11:79111815-79111837 CAGAGAAAGGAGGTGGGAGGGGG + Intronic
1085978641 11:81694020-81694042 CAGTGAAGGCAGCTGAGGGCGGG - Intergenic
1086073820 11:82828855-82828877 CAGAGATTGGAGAAGATGGCAGG - Intronic
1086120395 11:83299565-83299587 CATGGAAAGGAGGTGAGGGCAGG + Intergenic
1086879668 11:92138529-92138551 CAGAGAAAGGGAATCTGGGCTGG + Intergenic
1086914231 11:92510378-92510400 CAGAGAAAGGATTTGAGGCTGGG + Intronic
1087278139 11:96180839-96180861 CAGCGAAGGGAGATAAGGGTGGG + Intronic
1087314296 11:96587962-96587984 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1087315158 11:96593551-96593573 CAGCGAAGGGAGATAAGGGCGGG - Intergenic
1087839054 11:102904099-102904121 CAGCGAAAGGAGATAGGGGTGGG + Intergenic
1088510084 11:110565192-110565214 GAGAGGGAGGAGATGAGGGCAGG + Intergenic
1088680009 11:112231887-112231909 CAGAGACAGGAGAAGAGGAGGGG + Intronic
1088920260 11:114255468-114255490 CAGAGGGAGGAGGGGAGGGCGGG - Intergenic
1089012857 11:115144831-115144853 GAGAGAGAGAAGATGAGGGAGGG - Intergenic
1089151987 11:116371491-116371513 CAGAGGCAGGGGATGGGGGCAGG + Intergenic
1089372097 11:117968389-117968411 TAGAAAAAGGACATTAGGGCTGG - Intergenic
1089518678 11:119049473-119049495 CAGAGGAAGGGGGTGAGGGTAGG - Intronic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1089866488 11:121637452-121637474 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1089867356 11:121643211-121643233 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1089874632 11:121708150-121708172 CAGAGAGAGGAGATGGAGTCAGG - Intergenic
1089890083 11:121872134-121872156 CAGAAAAAGAAGAGGAGGCCGGG + Intergenic
1089952928 11:122546904-122546926 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1089987067 11:122824709-122824731 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1090057039 11:123432234-123432256 CTGAGAAGGAAGATGAGGGGAGG + Intronic
1090229072 11:125088830-125088852 CAGTGGAAGGTGATGGGGGCCGG + Exonic
1090237506 11:125160221-125160243 GGGAGCAAGGAAATGAGGGCAGG - Intergenic
1090387003 11:126363185-126363207 GACAGGAAGGAGATGGGGGCAGG - Intronic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090591475 11:128274862-128274884 CAGAGAATGGAGAAGCGGGAAGG - Intergenic
1090872266 11:130758789-130758811 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1091389985 12:120262-120284 CAGAGAAAGGAGTGGATGGAAGG + Intronic
1091491879 12:939769-939791 CAAAGAAGAGAGAAGAGGGCTGG + Intronic
1091853509 12:3720163-3720185 GAGAGAAAGGAAGGGAGGGCGGG + Intronic
1091886198 12:4018868-4018890 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1092195660 12:6548342-6548364 CAGAGCAAGGAGAGGAGCGGGGG + Intronic
1092344210 12:7702129-7702151 CAAAGAAAGGAAATGAGTACAGG + Intergenic
1092724056 12:11467672-11467694 CAGCGAAGGGAGATAAGGGTGGG + Intronic
1093070756 12:14705522-14705544 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1093321509 12:17720351-17720373 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1093578405 12:20763235-20763257 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1093579281 12:20768935-20768957 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1093584818 12:20822288-20822310 CAGTGAAGGGAGATAAGGGTGGG + Intronic
1093667493 12:21831821-21831843 GAGAGATTGGAGATGAGGCCAGG + Intronic
1094086600 12:26600209-26600231 CAGAGAAAGGAGATCAAAGATGG - Intronic
1094207790 12:27858989-27859011 TAGAAAATGGAGATGGGGGCCGG + Intergenic
1094397066 12:30019052-30019074 CAGAAAAAGGAGATGAAAGGAGG + Intergenic
1094478883 12:30864246-30864268 CAGAAAAAGAAGCTGAGGGCAGG - Intergenic
1094583236 12:31753910-31753932 TAAAGAAAGAAGATCAGGGCCGG + Intergenic
1095701686 12:45197009-45197031 GAGTGAAAAGAGATGAAGGCAGG + Intergenic
1095967980 12:47882400-47882422 GAGAAAGAGGAGATGGGGGCTGG + Intronic
1096239969 12:49954583-49954605 GAGAGAAGGGAGGTGAGGACAGG - Intronic
1096521496 12:52187101-52187123 CAGGGATAGGCCATGAGGGCAGG + Intronic
1096882366 12:54683441-54683463 CAGAGAAAGGAGACTAAGTCTGG - Intergenic
1097012716 12:55964910-55964932 AAAAGAAAGGGGATGAGGCCCGG - Intronic
1097079273 12:56417914-56417936 AACAGGAAGAAGATGAGGGCAGG - Exonic
1097191277 12:57220721-57220743 CAGAGACAGGGGCTGAGGACAGG - Intronic
1097214397 12:57398783-57398805 CTGAGAAAGGAAGAGAGGGCTGG - Intronic
1097245190 12:57604260-57604282 AAGAGGCAGGAGATGAGGGAGGG + Intergenic
1097283171 12:57858295-57858317 GAAAGAAAGGAAAAGAGGGCAGG - Intergenic
1097336068 12:58384429-58384451 CAGAAAAAGGAACTAAGGGCAGG - Intergenic
1097359304 12:58640866-58640888 AAGAAAAAGTAGATGAGGGGAGG - Intronic
1097544289 12:60979375-60979397 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1097637013 12:62134927-62134949 CAGGTAAAGGAGATGAGATCAGG - Intronic
1097681761 12:62655987-62656009 CAGAGAAAGGACAGCAGGGGAGG + Intronic
1097693243 12:62753805-62753827 CAGATAAGGGGGATCAGGGCGGG + Intronic
1098045538 12:66396813-66396835 AAGAGAAAGGAGATTTGGCCAGG + Intronic
1098055265 12:66498103-66498125 CAGCGAAGGGAGATAAGGGTGGG - Intronic
1098173181 12:67766907-67766929 CAGAGAAGGGAGATAAGGGTGGG + Intergenic
1098173946 12:67771997-67772019 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1098567218 12:71950339-71950361 CAGCGAAGGGAGATAAGGGTGGG + Intronic
1098591163 12:72215106-72215128 CAGCGAAGGGAGATAAGGGTGGG + Intronic
1098628726 12:72703549-72703571 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1098647844 12:72927331-72927353 CAGAGAAATGGGATGAAAGCTGG + Intergenic
1099131637 12:78840698-78840720 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1099188389 12:79540175-79540197 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1099189205 12:79545502-79545524 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1099262809 12:80405030-80405052 CATAGATAGCTGATGAGGGCAGG + Intergenic
1099470453 12:83041660-83041682 CAGAGAAAGGGGATAATTGCAGG + Intronic
1099763113 12:86944632-86944654 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1099836380 12:87912591-87912613 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1099952952 12:89324335-89324357 GAGAGAAAGCAGATGAGGAGTGG - Intergenic
1100206718 12:92357792-92357814 CAGAGAGAGGAGCAGAGGGAGGG - Intergenic
1100208622 12:92378224-92378246 AAGAGAAAGGAAAGGAGGTCTGG + Intergenic
1100368113 12:93940413-93940435 CAAAGAAATGAGATAAGGGAGGG + Intergenic
1100455609 12:94748768-94748790 CAGGCAAGGGAGATGAGGGTTGG - Intergenic
1100825695 12:98472349-98472371 CAGAGAATGGAGAGGTGGGTTGG - Intergenic
1101277868 12:103222217-103222239 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1101730624 12:107424310-107424332 TAGAGAAAGGAGAAAAAGGCAGG - Intronic
1101950123 12:109168079-109168101 CAGGGGAAGGAGGCGAGGGCAGG - Intronic
1101968379 12:109296039-109296061 CAGAGAAAGGGGAAGAGGAGAGG - Intronic
1101980859 12:109405879-109405901 CAGAGACAGGAGATCAGGACAGG - Intronic
1102045245 12:109825774-109825796 CAGAGGAGGGGGAAGAGGGCAGG + Intronic
1102518951 12:113467469-113467491 CAGGGAAGGGAGAAGAGGGGGGG - Intronic
1103011591 12:117462427-117462449 CACAGAGAGATGATGAGGGCAGG + Exonic
1103348281 12:120265489-120265511 CAGGGACAGGAGCTGAGGCCGGG + Intronic
1103611130 12:122124639-122124661 AAGAGAAAGGACTTCAGGGCGGG + Intronic
1103712650 12:122924247-122924269 CAGAGAAAAGAAATGACTGCAGG - Intronic
1104080851 12:125429500-125429522 CAGAAAGAGGACATTAGGGCCGG - Intronic
1104169301 12:126264697-126264719 CAGAGAAATGAGATGAGGACTGG - Intergenic
1104451875 12:128875876-128875898 CAGAGAAAGGAGAAGATGAGGGG - Intronic
1104503617 12:129310032-129310054 CAGAAAATCTAGATGAGGGCTGG + Intronic
1104510663 12:129374802-129374824 CAGAGAAAGAGGATGGAGGCTGG + Intronic
1104590993 12:130084579-130084601 CAGAGAAAGACGATCAGGCCAGG + Intergenic
1104661722 12:130616248-130616270 TACAGAAAGGAGAGGAGAGCGGG - Intronic
1104850877 12:131873118-131873140 CAGAGATAGGAAGTGAGGCCGGG - Intergenic
1104894975 12:132159579-132159601 CAGGGCATGGAGATGTGGGCGGG + Intergenic
1104923341 12:132302734-132302756 AAGAGAAAGGCCAGGAGGGCAGG + Intronic
1105395198 13:20025617-20025639 GAGATAAAGAATATGAGGGCAGG - Intronic
1105591501 13:21796830-21796852 CAGGGAGAGGAGAAGAAGGCAGG - Intergenic
1105764837 13:23548927-23548949 CATAGAAAGGGGAAAAGGGCTGG - Intergenic
1105816570 13:24041667-24041689 AAAAGAAGGGAGGTGAGGGCTGG + Intronic
1105831404 13:24165540-24165562 CTGAGAGAGGAGAAGAGGGCAGG - Intronic
1105859091 13:24393876-24393898 TGGAGGAAGGAGATGAGAGCAGG + Intergenic
1106356398 13:28987454-28987476 GAGAGGAAGGAGATGGGGGTTGG + Intronic
1106360754 13:29028486-29028508 GAGTGGAAGGAGAGGAGGGCAGG - Intronic
1106400450 13:29424829-29424851 CAGCAAAAGGAGAGGAGGGGTGG + Intronic
1106644984 13:31624053-31624075 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
1107076330 13:36324782-36324804 CAGCGAAGGGAGATAAGGGTGGG + Intronic
1107219785 13:37969108-37969130 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1107616725 13:42176475-42176497 CAAAGAAAGGAAGTGAGGCCAGG - Intronic
1108480667 13:50867050-50867072 CAGAGATAAGAGTTGAGGGGTGG + Intergenic
1108513391 13:51174883-51174905 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1108733544 13:53259068-53259090 GGGAGAAAGGAGATGGGGGAGGG + Intergenic
1108814030 13:54268467-54268489 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1108947111 13:56040578-56040600 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1108947949 13:56046152-56046174 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1108952463 13:56112511-56112533 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1108953277 13:56117910-56117932 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1109344098 13:61094316-61094338 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1109929537 13:69197168-69197190 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1110308738 13:74021994-74022016 CAAAGCAAGGAAATGAGTGCAGG + Intronic
1110319781 13:74148346-74148368 CAGAGAAATGGGATGGGAGCTGG - Intergenic
1111251606 13:85608633-85608655 AAGGGTAAGGAGAAGAGGGCGGG - Intergenic
1111301677 13:86358494-86358516 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1111302518 13:86364013-86364035 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1111362433 13:87191799-87191821 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1111807804 13:93059581-93059603 GAGAGAAAGGGGTTGAGGGGAGG - Intergenic
1113502870 13:110792274-110792296 GAGAGGAAGGAAATGAGGGACGG + Intergenic
1113600215 13:111563262-111563284 CGGAAAAAGGAGGTGAGGGGAGG - Intergenic
1113600239 13:111563337-111563359 CGGAAAAAGGAGGTGAGGGGAGG - Intergenic
1113604881 13:111598016-111598038 AACAGAAGGGAGAGGAGGGCGGG - Intronic
1114366465 14:22032465-22032487 GAGAGAAAAGAGATGAGAGAGGG - Intergenic
1114588802 14:23840207-23840229 TAGAGAAAGGAAATAAGGGCAGG + Intergenic
1114635129 14:24182962-24182984 CAGAGGAAGGTGAGCAGGGCAGG - Exonic
1114737774 14:25060173-25060195 CAGAAAAAGTAGATGAAGGGTGG + Intergenic
1114767444 14:25390119-25390141 GAGAGAAAGGAAATGAGGATGGG + Intergenic
1114824973 14:26066057-26066079 CCTAGAAAGGAGATGAGAGATGG + Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115267372 14:31514599-31514621 CAGAGAAAGGAGACCAGAGCTGG - Intronic
1115524115 14:34262372-34262394 CAGAGATGGGAGGTGAGGGGAGG - Intronic
1115770219 14:36659309-36659331 CAGAGAAAGAGGATGAAGGAAGG - Intronic
1115904453 14:38190964-38190986 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1115905300 14:38196406-38196428 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1116377939 14:44227580-44227602 CAGAGAAAGTAAATGACTGCTGG + Intergenic
1116460184 14:45163736-45163758 CACAGAAAGGGGAATAGGGCAGG - Intronic
1116544410 14:46145683-46145705 CAGAGAAGGTAGATGAGGAGAGG + Intergenic
1116613208 14:47104554-47104576 CAGCGAAGGGAGATAAGGGTGGG - Intronic
1116613849 14:47108642-47108664 CAGCGAAGGGAGATAAGGGTGGG - Intronic
1117489929 14:56236652-56236674 CTGAGACAGGAGTTAAGGGCAGG + Intronic
1117542241 14:56759498-56759520 CACAGCTTGGAGATGAGGGCTGG + Intergenic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1117988738 14:61413643-61413665 CAGAGAAAGAAAATGAGAGAAGG - Intronic
1117996021 14:61479099-61479121 CAGAGACAAGAGATCAGGGAGGG - Intronic
1118517990 14:66547800-66547822 CAGAGAAAGGATATGATGTATGG - Intronic
1118563736 14:67116388-67116410 CAAGGAAAGGAGGGGAGGGCAGG + Intronic
1118619230 14:67599897-67599919 CAGTGATAGGACAGGAGGGCGGG - Intronic
1118710732 14:68517266-68517288 CAGAGAGGGGAGAGGAGGGGAGG + Intronic
1118735269 14:68696599-68696621 CAGTGAGAGGAGCAGAGGGCTGG - Intronic
1118936473 14:70293588-70293610 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1118937640 14:70301634-70301656 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1119022072 14:71124493-71124515 CAGCAAAAGGAGATAAGGGTGGG - Intergenic
1119022883 14:71129885-71129907 CAGCGAAAGGAGATAAGGGTGGG - Intergenic
1119264312 14:73255015-73255037 CAGGGTAAGGACAGGAGGGCAGG + Exonic
1119788069 14:77327360-77327382 CAGGGAAGGGAGATGGGGGTGGG + Intronic
1119805957 14:77482546-77482568 CAGAGGAAGGACCAGAGGGCGGG + Exonic
1120333646 14:83125709-83125731 CAGAGAAAGAAGAGGAGGAAGGG - Intergenic
1120802220 14:88703316-88703338 CAGAGAGGGGAAATGATGGCTGG + Intronic
1120884396 14:89440680-89440702 CAGCGAAGGGAGATAAGGGTGGG - Intronic
1121129936 14:91436891-91436913 CAGAGAAAGGAGAAAAGGCTGGG - Intergenic
1121331959 14:93055397-93055419 GAGAGTAAGGGGCTGAGGGCTGG - Intronic
1121602700 14:95217905-95217927 CAGAGAACTGGGATGAGGGAAGG + Intronic
1122010695 14:98744382-98744404 GAGAAAAAGAAGATGAGGACTGG - Intergenic
1122040679 14:98985563-98985585 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1122041772 14:98992818-98992840 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1122100105 14:99401789-99401811 TTGAGGAAGGAGATGAGGGAAGG - Intronic
1122122221 14:99560714-99560736 TAGAGAAAGGTCTTGAGGGCAGG + Intronic
1122161844 14:99790819-99790841 CAGGGAAAGGAAATGGGGGGAGG - Intronic
1122212640 14:100182588-100182610 CAGACACAAGAGATGAGGGTTGG + Intergenic
1122280776 14:100621005-100621027 CAAATAAAGGATATGAGGACGGG - Intergenic
1122765870 14:104069471-104069493 CAGAGAAAACAGCTGAGGGAGGG - Intergenic
1122816243 14:104315571-104315593 CAAAGAAAAGACATGAGGCCAGG - Intergenic
1124186401 15:27533380-27533402 CAGAGAAAGGAGACTGGGGTTGG - Exonic
1124416907 15:29479824-29479846 GAGAGAAAGGATGTGAGGTCTGG + Intronic
1125444324 15:39737024-39737046 CAGGGAAAGGGGATATGGGCAGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125590465 15:40851568-40851590 CAGAGAAAGGAGGCCATGGCAGG - Intronic
1126466617 15:48966354-48966376 CAGATCAATGAGATCAGGGCTGG + Intergenic
1126567025 15:50111869-50111891 AAAAGAAAGGAGATAATGGCTGG + Intronic
1127428591 15:58880499-58880521 CAGAGAAAGAAACTGAGGGTGGG + Intronic
1127467452 15:59258051-59258073 CAGAAAATGGAAGTGAGGGCTGG + Intronic
1127723042 15:61721484-61721506 CAGGGAAAGGAGAAGACAGCTGG + Intergenic
1127929158 15:63579534-63579556 CAGGGAAAGGATATGAGGCAGGG - Intronic
1127968205 15:63939618-63939640 GACAGAATGGAGATGAAGGCTGG - Intronic
1128543700 15:68553812-68553834 AAGAGGAAGGAGGCGAGGGCAGG + Intergenic
1128576242 15:68777191-68777213 CAGACAAAGGAGAGGAGAGAGGG - Intergenic
1128590357 15:68890063-68890085 AAAAGAAAGGAAAAGAGGGCCGG - Intronic
1129016225 15:72471652-72471674 CAGAGAAAGCAGATCAAGGTAGG - Intergenic
1129177180 15:73848426-73848448 CAGAGCATGGAGATCAAGGCAGG - Intergenic
1129231827 15:74201343-74201365 CAGAGCAGGGAGATAAGGGATGG + Intronic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1129650582 15:77484751-77484773 CAGAAATAGCAGATGATGGCAGG - Exonic
1129867738 15:78922211-78922233 CAGAAAGAGGAGCTGAGGCCCGG + Intronic
1129880973 15:79005812-79005834 AAGAGAAAGGAAATGAGGAGGGG - Intronic
1130106507 15:80932497-80932519 CAGAGAAGGCAGAAGAGGGGCGG + Intronic
1130222254 15:82029510-82029532 CAAAGTAAGCAGATCAGGGCTGG - Intergenic
1130528667 15:84728628-84728650 TAGAAAAAGCAGAAGAGGGCCGG - Intergenic
1130643725 15:85704546-85704568 CAAAGAAAGAAGTTGAAGGCTGG + Intronic
1130851952 15:87803515-87803537 CACTGAAGGGAGATGAGGGCAGG - Intergenic
1130854755 15:87831434-87831456 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1130945436 15:88547369-88547391 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1130947800 15:88561913-88561935 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1130978022 15:88792176-88792198 GAGATGAAGGAGATGAGGGGAGG + Intergenic
1130979244 15:88801875-88801897 TAAAGAAATGAGATGAGGCCGGG - Intergenic
1131541414 15:93278472-93278494 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1131667277 15:94584060-94584082 AAGAGAAAAGAGCTGAGAGCTGG + Intergenic
1131683862 15:94751037-94751059 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1131882022 15:96871936-96871958 CAGGGAAGGGAGATAAGGGTGGG + Intergenic
1131882854 15:96877318-96877340 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1132162225 15:99553214-99553236 TGGGGAAAGGAGCTGAGGGCAGG - Intergenic
1132551575 16:555915-555937 CAGAGAAGGGAGGGGAGGGCTGG - Intergenic
1132890105 16:2199606-2199628 CAGAGGAAGGGGCTGCGGGCTGG - Intergenic
1133131244 16:3677240-3677262 CTGAGAAAGGAGCTCAGCGCGGG + Intronic
1133141232 16:3746224-3746246 CAGATTAAGGGGACGAGGGCAGG - Intronic
1133161752 16:3916447-3916469 CAGAGAAAGGACATGGGCTCTGG + Intergenic
1133209959 16:4258024-4258046 CCCAGAAGGGAGAGGAGGGCTGG + Exonic
1133371462 16:5248691-5248713 CAGAGTTAGGACAAGAGGGCCGG + Intergenic
1133388894 16:5393153-5393175 CAGAGAAAGGATGAGGGGGCAGG - Intergenic
1133413109 16:5584668-5584690 CACAGATGGGAGAGGAGGGCTGG + Intergenic
1133460573 16:5983429-5983451 GAAGGAAAGGAGATAAGGGCTGG + Intergenic
1133758663 16:8781121-8781143 GAGAGAAAGGAAATGAAGACTGG + Intronic
1133964350 16:10519678-10519700 AAGAGAAGGGAGAGGAGGGGAGG - Intergenic
1134341697 16:13352684-13352706 CAGCGAAGGGAGATAAGGGGGGG + Intergenic
1134376048 16:13674836-13674858 CAGAGAAAGGAGGTAAGTGGAGG - Intergenic
1134680684 16:16122892-16122914 CAAAAAAAGGAGATGGGGGTGGG + Intronic
1134741719 16:16553424-16553446 GAGAGAAAGGAGAGGAGGGGAGG - Intergenic
1134754028 16:16650632-16650654 AGGAGAAAGGGGAGGAGGGCAGG - Intergenic
1134754045 16:16650694-16650716 AGGAGAAAGGGGAGGAGGGCAGG - Intergenic
1134890762 16:17839773-17839795 CTGAGAAAGAAGAGGAGGGAGGG + Intergenic
1134925847 16:18159034-18159056 GAGAGAAAGGAGAGGAGGGGAGG + Intergenic
1134992014 16:18708350-18708372 AGGAGAAAGGGGAGGAGGGCAGG + Intergenic
1134992031 16:18708412-18708434 AGGAGAAAGGGGAGGAGGGCAGG + Intergenic
1135420244 16:22301032-22301054 CAGAGAAGGGAATTGAGGGGTGG + Intronic
1135910084 16:26552349-26552371 CAGACACAAGAGATGAGGGTTGG + Intergenic
1136219859 16:28822035-28822057 CAGATAAGGGACAGGAGGGCCGG - Intergenic
1136580918 16:31150232-31150254 CAGAGACATGAGATGTGCGCAGG - Intergenic
1136936684 16:34474214-34474236 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1136947988 16:34678867-34678889 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136959102 16:34825251-34825273 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136963135 16:34874356-34874378 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136967226 16:34928559-34928581 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1137085017 16:36109295-36109317 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1137087838 16:36150670-36150692 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1137221551 16:46456776-46456798 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1138065159 16:53933026-53933048 CAGACAAAGGGGATGAGGTATGG + Intronic
1138104484 16:54280403-54280425 GAGAGGAGGGAGATGAGGGGAGG + Intergenic
1138197204 16:55060465-55060487 AGGAGACAGGAGATGAGGCCAGG - Intergenic
1138415554 16:56869628-56869650 CAGAGAAGGGAGATGAACGTAGG + Intronic
1138701270 16:58866130-58866152 AAGGGAGAGGTGATGAGGGCTGG + Intergenic
1138790032 16:59892869-59892891 CAGAGAAAGAGGAACAGGGCTGG - Intergenic
1139126661 16:64086475-64086497 CAAAGAAAGCAAAGGAGGGCAGG + Intergenic
1139519483 16:67472384-67472406 AAGAGAGAGGAGCTGGGGGCTGG - Intronic
1139530764 16:67541671-67541693 CAGAAGAAGCAGCTGAGGGCTGG - Exonic
1139943334 16:70621712-70621734 CAGTGAAGGGAGATAAGGGTGGG + Intronic
1140462175 16:75148686-75148708 GAGGGGAAGGAGATGAGGGATGG + Intronic
1140707557 16:77644695-77644717 CAGAGAAATGAGTTGAGTGATGG - Intergenic
1141355331 16:83340016-83340038 CAGAGAATGGTGATGAGTGTTGG - Intronic
1141445968 16:84058531-84058553 CTGAGAAAGGGGATGAAGCCAGG - Intronic
1141466010 16:84206232-84206254 CAAAGTAAGGAGATGAGGTCAGG - Intergenic
1141637241 16:85320776-85320798 GGGAGAAAGGACATGGGGGCTGG - Intergenic
1141665712 16:85464123-85464145 CAGAGAGAGGAGGGGTGGGCGGG - Intergenic
1141738391 16:85871601-85871623 AAGAGAAAGGAGAGGAGAGGAGG - Intergenic
1141864711 16:86742117-86742139 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1141865514 16:86747306-86747328 CAGAGAAGGGAGATAAGGGTGGG + Intergenic
1142122942 16:88396278-88396300 CAGAGCCAGGAGATGAAGACAGG - Intergenic
1142199057 16:88752614-88752636 CTGAGGATGGAGATGAGGGAGGG + Intronic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1142296304 16:89224760-89224782 CAGGAAGAGGAGTTGAGGGCAGG + Intronic
1142781605 17:2185651-2185673 CAGAGACAGGGGGCGAGGGCAGG + Intronic
1143130822 17:4675943-4675965 AGGAGAAAGGAGATGAAGGTGGG - Intronic
1143155541 17:4833802-4833824 GAGAGAAGGGAGCAGAGGGCGGG - Intronic
1143216606 17:5229830-5229852 GGGAGAAAGGAGATGGGGGAAGG - Intronic
1143345645 17:6246888-6246910 CAGGGAAAGGAGCTGAGGCAAGG - Intergenic
1143396133 17:6598899-6598921 GAATGAAAGGAAATGAGGGCAGG + Intronic
1143462021 17:7109937-7109959 CAAAGAGAGGAGCTCAGGGCTGG - Intronic
1143690150 17:8555344-8555366 CTGAGAAAGAAGACCAGGGCTGG + Intronic
1143733500 17:8894518-8894540 GGGAGAAAGGGGATGCGGGCTGG - Intronic
1143953811 17:10653655-10653677 GAGAAAAAGGAGGTGAGGACAGG - Intronic
1144116647 17:12100008-12100030 GAGGGAAAGGAGAAGAGGGGTGG - Intronic
1144613529 17:16746854-16746876 GAGAGAAGGGAGAGGAGGGAGGG - Intronic
1144865131 17:18330756-18330778 CAGTCAAAGCAGATGAGGTCAGG + Intronic
1145262420 17:21362432-21362454 CAGATAAAGGAGAAGATGGATGG + Intergenic
1145689559 17:26724381-26724403 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1145901464 17:28493194-28493216 CAGAGAAGGCAGAGGAGGGAAGG + Intronic
1146587091 17:34091582-34091604 CAGGGAAGGGAGATGATGGATGG + Intronic
1146790339 17:35747284-35747306 CGGAGAAAGGAGAGGAGAGAAGG + Intronic
1146816472 17:35946563-35946585 GATAGAAAGCAGATCAGGGCAGG + Intergenic
1146945591 17:36870944-36870966 CAGAGAAAGAAGGTGAGGCCAGG - Intergenic
1147249720 17:39145624-39145646 AAGAGAAAGGAGGCGAGGGGAGG + Intronic
1147341725 17:39756401-39756423 GAGGGACAGGAGATGAGGGCAGG + Intergenic
1147371728 17:39997296-39997318 CAAAGAGAGGAGATGAGCGAGGG - Intronic
1147373755 17:40011781-40011803 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1147697938 17:42370558-42370580 CAAAGAAATGAGAAGATGGCTGG - Intronic
1148086145 17:44994993-44995015 CAGAGGAAGGAGGAGAGGGGAGG + Intergenic
1148130103 17:45257213-45257235 AGGGGAAAGGAGGTGAGGGCAGG + Intronic
1148140023 17:45321674-45321696 CAAAGAATGGAGGTGAGGGCTGG + Intergenic
1148210714 17:45806839-45806861 AGGAGAGAGGAGATGAGGGGCGG + Intronic
1148642832 17:49201136-49201158 GGGAGAAGGGAGAGGAGGGCAGG + Intergenic
1148746501 17:49921087-49921109 CAGGGAAAGGAGATCAAGGTGGG + Intergenic
1149018543 17:51936600-51936622 GAGCGAAATGAGATGGGGGCTGG + Intronic
1149142880 17:53455774-53455796 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1149279587 17:55088220-55088242 CAAAGAAAGAAAATGAGGGAGGG - Intronic
1149563735 17:57627566-57627588 CAGAAAAAGGAGGTGAGCACAGG - Intronic
1149686632 17:58539299-58539321 CAGAAAAAGGGGATGAAGGTGGG + Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150645774 17:66976616-66976638 GATAGAAAGAAGATGAAGGCAGG - Intronic
1151342845 17:73482751-73482773 CAGTGAGGTGAGATGAGGGCAGG + Intronic
1151591372 17:75047039-75047061 CAGCCAATAGAGATGAGGGCTGG + Intronic
1151839279 17:76606089-76606111 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1152484335 17:80580079-80580101 CTGAAAAAGGAGATGAGATCAGG - Intronic
1152524368 17:80879216-80879238 CAGAGGACGGAGATGATGCCAGG - Intronic
1152532546 17:80927829-80927851 CAAATGGAGGAGATGAGGGCAGG - Intronic
1152808716 17:82371361-82371383 CATAGAAAGGAGGTAAGGGAGGG - Intergenic
1152844576 17:82591817-82591839 CAGAGACAGGAGATGAGCTTTGG - Intronic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1203182830 17_KI270729v1_random:80349-80371 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153683196 18:7520612-7520634 CAGAGAGCAGAGATGAGGACAGG + Intergenic
1154516438 18:15171967-15171989 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1155838138 18:30613002-30613024 CAGCGAAAGGAGATGGGGTGGGG - Intergenic
1156544299 18:37948166-37948188 AAGAGAAAGCAGATGAGTACAGG - Intergenic
1157119404 18:44895141-44895163 GAAAGAAAGGAGAAGAGGGAAGG + Intronic
1157601643 18:48896801-48896823 CAGAGAAGGGAGGTGAGCGTGGG - Intergenic
1157687366 18:49653025-49653047 CAGGGACAGGAGCTGAGGCCTGG - Intergenic
1157728378 18:49982982-49983004 CAGAGAAAGGAGAAGATCTCTGG - Intronic
1158083753 18:53625926-53625948 CAGAGAAGGGAGGTGAAGGTCGG - Intergenic
1158497928 18:57973575-57973597 GACAGAGAGGAGATGAGGGAGGG - Intergenic
1158584495 18:58719403-58719425 AAGAGAAAGAAGTTGGGGGCGGG - Intronic
1158791145 18:60782001-60782023 CAGAGATATGAGATGAGTTCTGG + Intergenic
1158841219 18:61389871-61389893 AAGAGAAAGGAGATGCTTGCAGG - Intronic
1159086861 18:63802381-63802403 TAGAGAAGGGAGATGAGTCCAGG - Intronic
1159136915 18:64347512-64347534 TTCAGAAAGGAGCTGAGGGCAGG - Intergenic
1159550835 18:69894503-69894525 GAGAGAAAGGAGGGGAGGGGAGG + Intronic
1160095032 18:75863512-75863534 CAGAGAAAGGAGTGGAAGGAAGG + Intergenic
1160511884 18:79457468-79457490 CTGAGAAGGGAGAGGAGGGAGGG - Intronic
1160930074 19:1566417-1566439 CAGAGAAAGGTGTGGGGGGCTGG - Intronic
1161142893 19:2659280-2659302 TAAATAAAGGAGAGGAGGGCCGG + Intronic
1161300023 19:3538025-3538047 CAGAGTGAGGAGAGGAGGGCAGG + Intronic
1161328144 19:3673127-3673149 CAGAGGGAGGAGCAGAGGGCAGG - Intronic
1161345453 19:3766885-3766907 GAGAGGGAGGAGGTGAGGGCAGG + Intronic
1161422014 19:4181148-4181170 GAGAGGGAGGAGAAGAGGGCAGG - Intronic
1161490384 19:4557948-4557970 GAGAGAGAGGAGGCGAGGGCAGG - Intronic
1161525416 19:4751961-4751983 GAAAGAAAGGAAATGAGGCCGGG + Intergenic
1161632747 19:5367042-5367064 CAGAGAAAGGCTGTGTGGGCAGG + Intergenic
1161658852 19:5533538-5533560 GAGGGGAAGGAGATGAGGTCAGG + Intergenic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1161899874 19:7110403-7110425 GAGGGAAAAGAGATGAAGGCAGG - Intergenic
1161919556 19:7255872-7255894 CAAAGAAAGAAGATGAGGTTGGG - Intronic
1161946744 19:7442083-7442105 CAGAGAAGAGAGTGGAGGGCCGG - Intronic
1162324598 19:9991662-9991684 CAGAAAAAGAAGATGAGAGAAGG + Intronic
1162429924 19:10622241-10622263 GAGAGGGAGGAGGTGAGGGCAGG + Intronic
1162582819 19:11540818-11540840 CAGGGAATGTAGATGAGGGGTGG - Intronic
1162686168 19:12386427-12386449 AAGGGAAAGGAGAGGAGGGCAGG + Intronic
1162690495 19:12425983-12426005 AAGGGAAAGGAGAGGAGGGGAGG + Intronic
1162730734 19:12716909-12716931 GAGGGAAAGGAGGTAAGGGCAGG + Intronic
1162738624 19:12760871-12760893 AAAAGAAAGCAGATGAGGGTGGG - Intergenic
1162765801 19:12918656-12918678 AGGAGAAAAGAGATGAGGCCGGG + Intronic
1162871664 19:13591121-13591143 GAGAGGAGGGAGGTGAGGGCAGG + Intronic
1163110043 19:15154401-15154423 CAGAGAAAGTGGATGCGGGCAGG + Intergenic
1163673340 19:18642222-18642244 AAGAGGAAGGAGACGTGGGCAGG - Intronic
1163897111 19:20068908-20068930 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1163900617 19:20096435-20096457 CAGCGAAGGGAGATAAGGGTGGG + Intronic
1163907658 19:20161161-20161183 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1164148982 19:22532577-22532599 CAGAGAAAGGAGGCGAGGCCAGG + Intergenic
1164152665 19:22568628-22568650 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1164153620 19:22574897-22574919 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1165149985 19:33754487-33754509 GAGGGAAAGGGGATGAGAGCAGG - Intronic
1165419535 19:35716101-35716123 CAGAGAAGGCAAAGGAGGGCAGG - Intronic
1165492805 19:36134900-36134922 CAGGGCGAAGAGATGAGGGCAGG + Intergenic
1165650448 19:37483363-37483385 CAGAGAAAGAAAATCAGGGTAGG - Intronic
1165730801 19:38143418-38143440 CAGGGAAAGGAGGAGAGGGTGGG - Intronic
1165835824 19:38755174-38755196 CAGCGAAGGGAGATAAGGGCGGG - Intronic
1165922307 19:39307076-39307098 CAGAGAGACGACAAGAGGGCGGG + Exonic
1166108266 19:40608177-40608199 CAGAGAGAGGACAAGAGAGCGGG - Intronic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166357087 19:42233588-42233610 CAGAGAGAGGAACTGAGGGCTGG - Intronic
1166545458 19:43632264-43632286 CAGACAAAGGTGATGAGATCTGG - Intronic
1166640650 19:44492485-44492507 CAGAGAAAAGGGTTGTGGGCAGG + Intronic
1166690964 19:44821036-44821058 CAGAGGAAGGAAGGGAGGGCTGG - Exonic
1166713949 19:44954826-44954848 CACAGAAAGGATATGAGCTCAGG + Intronic
1166881155 19:45930891-45930913 AAAGGAAAGGAGATGAGGTCAGG - Intergenic
1166886768 19:45966156-45966178 CAGAGAATGGAGACAAGGTCTGG - Intronic
1167040274 19:47019729-47019751 CAGGGAAAGGCGAGCAGGGCGGG + Intergenic
1167099110 19:47393146-47393168 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1167099951 19:47398633-47398655 CAGTGAAGGGAGATAAGGGCGGG - Intergenic
1167212015 19:48139384-48139406 TAGAGAAGAGAGAAGAGGGCAGG - Intronic
1167475385 19:49697607-49697629 AAGAAAAAGGAGGTGAGGCCGGG + Intronic
1167646643 19:50709477-50709499 CTGAGAAAGGAGATCAAGGAGGG + Intronic
1167715530 19:51140685-51140707 CAGGGATTGGAGGTGAGGGCGGG + Intergenic
1167753480 19:51394989-51395011 AGGAGAAAGGACATGAGGGTAGG - Intergenic
1167820542 19:51923569-51923591 CAGAGAAAGGTGTGTAGGGCAGG - Intronic
1167847732 19:52178279-52178301 CAGAGAAGGGAGATGGGGTGGGG - Intergenic
1168032203 19:53689510-53689532 GAGTGAAAGGTGTTGAGGGCTGG - Intergenic
1168051297 19:53831731-53831753 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1168097991 19:54126345-54126367 CAGGAAGAGGGGATGAGGGCAGG - Intronic
1168115802 19:54220944-54220966 CAGAGACAGGGGATGGGGGGAGG - Intronic
1168185686 19:54698062-54698084 CAGAGACAGGGGATGGGGGGAGG + Intronic
925138153 2:1533892-1533914 CACAGAAAGGAGATCTGGGGAGG - Intronic
925138844 2:1536663-1536685 CACAGAAAGGAGATCTGGGGAGG - Intronic
925387629 2:3473170-3473192 CAGAGAGAGCAGGTGAGGGGGGG + Intronic
925668646 2:6289027-6289049 CAGAGAAAGGAGATGCAGGAAGG - Intergenic
925725451 2:6866261-6866283 CAGAGCTAGGAGTTGAGGTCGGG - Intronic
925828345 2:7872807-7872829 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
925916196 2:8608195-8608217 CAAAGAATCGAGATGAAGGCTGG - Intergenic
925980778 2:9175455-9175477 CAGAAAATGGATATGAAGGCAGG - Intergenic
926064677 2:9828672-9828694 AAGGGAAAGGAGAGGAGGGGAGG + Intergenic
926086378 2:10022812-10022834 CAGAGAAAGGAAGGGAGGGAGGG - Intergenic
926112685 2:10193010-10193032 CAGAGAAGGGAGCCCAGGGCAGG - Intronic
926413243 2:12626662-12626684 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
926701371 2:15806276-15806298 CAGAGAGCTGCGATGAGGGCAGG + Intergenic
927035431 2:19170287-19170309 GAGAGAAGGGAGAAAAGGGCAGG + Intergenic
927347537 2:22063711-22063733 GAGAGAAAGGAGGGGAGGGGAGG - Intergenic
927838526 2:26421533-26421555 GAGAGAAAGAAGAGGAGGGAGGG - Intronic
927935568 2:27074138-27074160 CAAGGAAAGGACATGAGGCCAGG + Intergenic
928133858 2:28673445-28673467 AAGAGAAAGAAGAGGAGGGCAGG + Intergenic
928220765 2:29401131-29401153 CTGAGACAGGAGCTGAGGGTGGG - Intronic
928778870 2:34795934-34795956 CAGTGAAGGGAGATAAGGGTAGG - Intergenic
928857012 2:35814285-35814307 CAGAGAAAAGAGAGGAGAGAAGG - Intergenic
928941394 2:36730778-36730800 CAGAGAGGGGACATGAGGGGTGG + Intronic
929388001 2:41434208-41434230 CATAGAAAGAAGATGTAGGCAGG + Intergenic
931067198 2:58600195-58600217 CTTAGAAAGGACATGAGGGTGGG - Intergenic
931088982 2:58865375-58865397 CAAAGAACTGGGATGAGGGCAGG - Intergenic
931269158 2:60686643-60686665 CAGAGCAAGGGGATGATTGCAGG + Intergenic
931367350 2:61630326-61630348 CAGAGAAGGAAGTTGCGGGCTGG - Intergenic
931587835 2:63847564-63847586 CAGTGAAGGGAGATAAGGGTGGG + Intronic
931608417 2:64074908-64074930 CAGAGAAGGGAGATAAGGGTGGG + Intergenic
931850089 2:66244213-66244235 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
931915580 2:66951431-66951453 TCAAGAAAGGAGATGAGGGAGGG + Intergenic
932086406 2:68766450-68766472 CAGAGACAGGCGGAGAGGGCTGG + Intronic
932358499 2:71086459-71086481 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
932412265 2:71554520-71554542 CAGTGCAAGGAGATGGGGGGTGG + Intronic
932439174 2:71721025-71721047 CAGAGAGAGGAGAAGAGGAGTGG - Intergenic
932447116 2:71787821-71787843 AGGGGAAAGGAGAGGAGGGCTGG - Intergenic
932716088 2:74101464-74101486 CCATGAAAGGAGAGGAGGGCAGG + Exonic
932769028 2:74490197-74490219 GAAAGAAAGGACATGAGAGCGGG - Intronic
932873912 2:75430972-75430994 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
932974297 2:76579355-76579377 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
933041586 2:77474201-77474223 CAAAGAAAAGAAATGAGGGAGGG + Intronic
933428795 2:82148076-82148098 CAGAGGAAGGAGGTGAGGCATGG - Intergenic
933507418 2:83196005-83196027 TGGAGAAAGGAGAGGAGGGTAGG + Intergenic
933876056 2:86623174-86623196 CACAGAAAGGAGAGGGGCGCGGG + Exonic
934060295 2:88286173-88286195 TAGAGAAAGGAGAGGAGCCCTGG + Intergenic
934252286 2:90367622-90367644 AAGACAAATGAGAAGAGGGCAGG - Intergenic
934257156 2:91435323-91435345 AAGACAAATGAGAAGAGGGCAGG + Intergenic
934762791 2:96865607-96865629 CAGAGAAGGGTGAGGAGGGCGGG + Intronic
934851877 2:97706979-97707001 AAGATGAGGGAGATGAGGGCCGG + Intergenic
934906907 2:98213192-98213214 CAGAGAAAAAAGCTGAGGACAGG + Intronic
934983629 2:98868791-98868813 GAGGGAAAGGGGAGGAGGGCTGG - Intronic
935077726 2:99761977-99761999 AAGAGAAACAAGATGGGGGCAGG - Intronic
935187898 2:100750997-100751019 CAGAGTCAGGGGATGAGGGAGGG - Intergenic
935660612 2:105463772-105463794 TAAAGAAAGGAAATGTGGGCCGG + Intergenic
935718620 2:105960364-105960386 GAGAGACAGGAGATGAGGAAAGG - Intergenic
935785534 2:106545202-106545224 CAGTGAAAGGAGACGGTGGCAGG - Intergenic
935818137 2:106867057-106867079 AAGAGAAGGGAAAGGAGGGCAGG + Intronic
935960650 2:108422709-108422731 CTGAGAAAGAAGATGAGAGTAGG - Intergenic
936883021 2:117279080-117279102 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
936883810 2:117284386-117284408 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
937219979 2:120337174-120337196 CAGAGGAAGCAGCTCAGGGCTGG + Intergenic
937467453 2:122147121-122147143 CAGAGAAAAGAGGTCTGGGCTGG + Intergenic
937818517 2:126280802-126280824 CAGAGACAGGAAATGAGCACAGG - Intergenic
938305089 2:130247829-130247851 CACAGATTGGAGAGGAGGGCTGG + Intergenic
938448925 2:131399378-131399400 CACAGATTGGAGAGGAGGGCTGG - Intergenic
938516759 2:132016961-132016983 AAGACAAATGAGAAGAGGGCAGG - Intergenic
938647023 2:133342229-133342251 CAGGGAAAGGAAATGGGGGAGGG + Intronic
938845717 2:135206728-135206750 GAGAGAAAGGGGAAGAGGGAGGG + Intronic
939021646 2:136964674-136964696 AAGAGAAATGAGATGACAGCTGG - Intronic
939968381 2:148633436-148633458 CAGAGGGAAGAGATGAGAGCTGG + Intergenic
939990295 2:148872028-148872050 AAGAAAAAGGAGAACAGGGCCGG - Intergenic
940426211 2:153534601-153534623 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
940529854 2:154867602-154867624 CAGGGAAGGGAGATAAGGGTGGG - Intergenic
940724567 2:157321685-157321707 AAGAGGAAGAAGATGAGGACAGG - Exonic
940852484 2:158701699-158701721 GAGAGAAAGGAGAAGAGAGAGGG - Intergenic
940898917 2:159108486-159108508 CAGAGAAAATAGATGAGGGCAGG + Intronic
941013238 2:160325204-160325226 AAGAGTAAGGAGATGAGGGGTGG + Intronic
941353087 2:164459518-164459540 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
941652963 2:168113085-168113107 TAGACAATGGAGAAGAGGGCTGG - Intronic
941795794 2:169596996-169597018 CAGATAAAGAATATGTGGGCTGG - Intronic
941920829 2:170849254-170849276 CAGAGAAAGGAGAGGAAGAGGGG - Intronic
942134999 2:172916381-172916403 CAGAGAGAGCAGAGGAGGACTGG - Intronic
942729786 2:179051688-179051710 CAGCGAAAGGAGATAGGGGTGGG + Intergenic
943104758 2:183530233-183530255 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
943421103 2:187670582-187670604 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
943421911 2:187675920-187675942 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
943835865 2:192513059-192513081 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
944115433 2:196180872-196180894 CATAGAAAGGAGATCCAGGCTGG - Intergenic
944359880 2:198841367-198841389 CTGAGAAAGCAGAGTAGGGCAGG + Intergenic
944394625 2:199252561-199252583 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
944485608 2:200201966-200201988 CAGTGAAAGGAGATAGGGGTGGG + Intergenic
944648965 2:201809757-201809779 GAGGGGAAGGAGATGAGGACAGG - Intronic
944973498 2:205021053-205021075 CAGAGAAAGGTGATGGGAGATGG + Intronic
945152618 2:206806939-206806961 CAGAGAAGGGAGATAAGGGTGGG + Intergenic
945153440 2:206812278-206812300 CAGAGAAGGGAGATAAGGGTGGG + Intergenic
945375771 2:209078346-209078368 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
945376652 2:209084256-209084278 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
945394013 2:209299671-209299693 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
945554546 2:211262689-211262711 CAGAGAAAAGAGAGGAGAGAGGG - Intergenic
945938808 2:215928003-215928025 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
946144427 2:217718339-217718361 CAGAGAGAGGAGAAGAAGGGAGG - Intronic
946169828 2:217888288-217888310 CAGATGGAGGAGAGGAGGGCAGG - Intronic
946192574 2:218015334-218015356 GAGAGAAGGGAGAGGAGGGAGGG + Intergenic
946290936 2:218745164-218745186 AAGAGACTGTAGATGAGGGCTGG - Exonic
946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG + Intronic
946547607 2:220762002-220762024 GAGAGAAATGAAATGAGGGATGG - Intergenic
946781362 2:223195203-223195225 CAGCGAAAGGAGATAGGGGTGGG + Intronic
946885164 2:224215786-224215808 CAGCGAAGGGAGATAGGGGCAGG + Intergenic
947148004 2:227086283-227086305 CAGAGAGAGGAGATGTAGGGAGG + Intronic
947223976 2:227822508-227822530 AAAGGAAAGGAGATGGGGGCTGG - Intergenic
947370652 2:229442096-229442118 AAAAGGAAGGACATGAGGGCAGG + Intronic
947505958 2:230708677-230708699 CAGAGAAATGGGGTGATGGCTGG - Intergenic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
947553676 2:231067950-231067972 CAAAGAAAGGAATGGAGGGCAGG - Intronic
947981695 2:234415899-234415921 CAGAGAAGAGAGATGAGTCCAGG + Intergenic
948066775 2:235087094-235087116 CAGAGAATGGAGATAAAGGCAGG - Intergenic
948323973 2:237096344-237096366 CAGATAAAGACAATGAGGGCAGG - Intronic
948372705 2:237500226-237500248 CAGAGAAGAGAGTTGAGGCCAGG - Intronic
948609943 2:239160504-239160526 GAGAGAAAGCAGACCAGGGCTGG - Intronic
948663561 2:239521093-239521115 CTGAGAAAAGAAAAGAGGGCAGG - Intergenic
1168750247 20:276971-276993 CAGAGGATGGGGAAGAGGGCGGG + Intronic
1168965872 20:1897540-1897562 GAGAGACAGGATATGAGGGTAGG + Intronic
1169087573 20:2836861-2836883 AAACAAAAGGAGATGAGGGCAGG - Intronic
1169168824 20:3447501-3447523 CAGAGAAAGGAGCTGGGCCCAGG + Intergenic
1169650321 20:7859533-7859555 CAGAGAAAGAATATGGGGGTGGG + Intergenic
1170105892 20:12754151-12754173 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1170106727 20:12759511-12759533 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1170165549 20:13358207-13358229 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1170323183 20:15124747-15124769 CAAAGAAATGAGATGGGGGAAGG - Intronic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170790966 20:19509170-19509192 CAGATGAAGGAAATGAGGCCCGG + Intronic
1170940679 20:20845625-20845647 CAGGGAAAGGAGATGGGGAGAGG + Intergenic
1171009161 20:21498631-21498653 CACAGAAAGGAGATGGGAGTGGG + Intergenic
1171325219 20:24285150-24285172 GAGAGAGTGGAGCTGAGGGCTGG - Intergenic
1171958771 20:31478486-31478508 GAGAAAAAGGAAATCAGGGCAGG + Intronic
1171990942 20:31695888-31695910 CAGAGAAAAGGGATTAGGGATGG - Intronic
1172094750 20:32455167-32455189 CAGGGAAGTGAGATGAGAGCAGG - Intronic
1172223769 20:33290856-33290878 CTGAGGAAGGAGGTGAGGGCTGG + Intronic
1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG + Intronic
1172919816 20:38472103-38472125 CTGAGAAAGAAGAGGAGGGAGGG - Intergenic
1173118546 20:40269380-40269402 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1173119347 20:40274638-40274660 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1173201634 20:40959413-40959435 GAGAGAAAGGAGGAGAGGGAAGG + Intergenic
1173370159 20:42427976-42427998 CAGAGAAGGGAGATAGGGGTGGG - Intronic
1173492314 20:43493019-43493041 CAGAGGCAGCAGAAGAGGGCAGG + Intergenic
1173763310 20:45584345-45584367 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1173781314 20:45759628-45759650 CAGTGAAGGGAGATAAGGGTGGG - Intronic
1173782176 20:45765122-45765144 CAGCGAAGGGAGATCAGGGTGGG - Intronic
1173823334 20:46032083-46032105 CCGGGCCAGGAGATGAGGGCAGG - Intronic
1173947029 20:46959780-46959802 CAGAGAAAAGAGATGAGCCCTGG - Intronic
1174058345 20:47815103-47815125 CAGAGACAGGAGCTGAGAGGGGG + Intergenic
1174120043 20:48258180-48258202 CAGAGAGAGAAGATGGGGCCAGG - Intergenic
1174231014 20:49045771-49045793 AAGCGGAAGGTGATGAGGGCAGG + Intergenic
1174279079 20:49425398-49425420 GAGTGAAAGGGGATGAGGACGGG - Intronic
1174792688 20:53495378-53495400 AAGAGAGGGGGGATGAGGGCGGG + Intergenic
1175689620 20:61056206-61056228 GAGTGAAAGCAGATGATGGCCGG + Intergenic
1175877396 20:62236907-62236929 GAGAGAACGGGGAGGAGGGCGGG - Intronic
1176968155 21:15235143-15235165 CAGGCAAAAGAGAAGAGGGCAGG - Intergenic
1177735083 21:25079145-25079167 CCAGGAAAGGAGATGAGTGCAGG + Intergenic
1177760436 21:25396647-25396669 CTGAGAGATGAGATGAGGCCTGG - Intergenic
1178376393 21:32071021-32071043 CAGAGGCAGGAGGTGAGGGCAGG - Intergenic
1178407602 21:32337320-32337342 CAGAGATAGGGAATGAGAGCTGG - Intronic
1178712858 21:34934798-34934820 CAGGGAAAGAGGATGAAGGCAGG + Intronic
1178936342 21:36865362-36865384 CCGAGAAAGGAGATGCAAGCAGG + Intronic
1179267385 21:39816421-39816443 GAGAGAGAGGAGAGGAGGGGAGG + Intergenic
1179606253 21:42517391-42517413 CAGATAGAAGAGATGAGGGGCGG + Intronic
1179892216 21:44341638-44341660 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1180834383 22:18922613-18922635 CAGAGAGGGGAGATGCTGGCAGG - Intronic
1180840644 22:18957412-18957434 CAAGGAAAGGAAATGGGGGCTGG + Intergenic
1181060844 22:20281362-20281384 CAAGGAAAGGAAATGGGGGCTGG - Intronic
1181065428 22:20303490-20303512 CAGAGAGGGGAGATGCTGGCAGG + Intergenic
1181879731 22:25968604-25968626 CAAAGAAAGGAAATGGAGGCCGG + Intronic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182114099 22:27745041-27745063 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1182150152 22:28021991-28022013 CAGTGAATGGGGCTGAGGGCTGG - Intronic
1182655213 22:31884627-31884649 TAGGGTATGGAGATGAGGGCAGG - Intronic
1183023489 22:35046134-35046156 CAGAGTAAGGAGATGAGAATGGG - Intergenic
1183160593 22:36110514-36110536 CAGAGAAAAGAGATTTGGACAGG + Intergenic
1183485704 22:38086639-38086661 CAGAGAGAGGGGCTCAGGGCCGG + Intronic
1183583468 22:38738989-38739011 CTGAGACAGGAGAGGAAGGCAGG + Intronic
1184137885 22:42560109-42560131 GATAAAAAGGAGAGGAGGGCCGG - Intronic
1184191816 22:42900027-42900049 CAGAGAGCTGAGATGGGGGCAGG - Intronic
1185344348 22:50304832-50304854 CAGAGAAGGGAGGTCAAGGCTGG + Intronic
1185352995 22:50347758-50347780 CAGAGAGAGGCCATGAGGGAAGG - Intronic
1185418828 22:50723878-50723900 CAGAGAGGGAAGATGGGGGCTGG - Intergenic
1203284472 22_KI270734v1_random:147912-147934 CAGAGAGGGGAGATGCTGGCAGG - Intergenic
1203325638 22_KI270738v1_random:13100-13122 AAGACAAATGAGAAGAGGGCAGG - Intergenic
949507060 3:4738300-4738322 CAAATAAAAGAAATGAGGGCAGG + Intronic
949818758 3:8092240-8092262 CAGAGAAAGGTCATGTGGACTGG + Intergenic
949978328 3:9481278-9481300 CAGAGAAAGGAGTTGACCGAGGG + Intergenic
950032113 3:9860154-9860176 CAGGCAAATAAGATGAGGGCAGG - Intergenic
950101314 3:10358645-10358667 CAGGGAAAGGGGATGAGGCTGGG - Intronic
950157224 3:10730765-10730787 CAGCGAAGGGAGATAGGGGCGGG - Intergenic
950218654 3:11177994-11178016 CAGATAACAGAGATGATGGCAGG - Intronic
950457182 3:13099778-13099800 CAGAGAGAGGAGCTGGGGGTAGG - Intergenic
950727147 3:14923827-14923849 CAGACAAAGGCTATGGGGGCTGG - Intronic
950926976 3:16749943-16749965 CAGGGAAGGGAGATAAGGGTGGG - Intergenic
951331760 3:21378003-21378025 CAGCGAAGGGAGATAAGGGTAGG + Intergenic
951332419 3:21382648-21382670 CAGGGAAGGGAGATAAGGGTAGG + Intergenic
951817272 3:26768209-26768231 CAGAGTGAGGAGATGTTGGCTGG + Intergenic
952018062 3:28983258-28983280 AAGAGAAATAAGATGAGGACAGG - Intergenic
952238603 3:31506696-31506718 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
952256005 3:31696247-31696269 GAGAGGAAGCAGATGAGTGCAGG - Intronic
952508304 3:34028115-34028137 CAGAGAAAGAACAAGAGGGTCGG - Intergenic
952564626 3:34640557-34640579 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
952663001 3:35874505-35874527 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
952663781 3:35879768-35879790 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
952684407 3:36132180-36132202 CAAAGAAAGGAGGGGAGGCCTGG - Intergenic
953407703 3:42667662-42667684 CAGAGTCAGGAGATGAGGCAAGG + Intergenic
953418420 3:42736113-42736135 CAGAGAAGGAAGTTGAGGACAGG - Intronic
953666956 3:44932257-44932279 TAGAGATAGGAGAGGAGGGTAGG - Intronic
953825017 3:46244470-46244492 CAGCGAAGGGAGATAAGGGTGGG + Intronic
953825225 3:46246376-46246398 CAGCGAAGGGAGATAAGGGTGGG + Intronic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
953996269 3:47522432-47522454 CAGAGAGATGAGCTAAGGGCAGG - Intergenic
954933269 3:54302852-54302874 CAGAAAGAGGAGATGAGAGCAGG - Intronic
954968790 3:54634585-54634607 CAGCGAAGGGAGATAAGGGTGGG + Intronic
954969587 3:54639854-54639876 CAGCGAAGGGAGATAAGGGTGGG + Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955901319 3:63758898-63758920 CAGATAAATAATATGAGGGCTGG - Intergenic
956009634 3:64817047-64817069 AAGAGAAAGGAGCTGGGGGAGGG - Intergenic
956180296 3:66511273-66511295 CAGAGAAATGGGATGATCGCTGG + Intergenic
956696862 3:71925849-71925871 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
956708915 3:72023411-72023433 CAGCGAAGGGAGATGGGGGTGGG - Intergenic
957294873 3:78323981-78324003 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
957554380 3:81747861-81747883 CAGCGAAGGGAGATAAGGGTGGG - Intronic
957734387 3:84187912-84187934 CAGTGAAGGGAGATAGGGGCGGG + Intergenic
958936719 3:100263105-100263127 CAGCGAAGGGAGATAAGGGCGGG + Intronic
958952993 3:100436491-100436513 CAGAGGGAGGAGATGAGGGAGGG - Intronic
959971881 3:112418513-112418535 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
960282386 3:115793584-115793606 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
961007149 3:123412705-123412727 CAGAGATAGGAAATGAGGGATGG - Intronic
961271877 3:125695630-125695652 AAGAGAAGGGAGGTCAGGGCCGG + Intergenic
961326322 3:126111514-126111536 CAGAAACATGAGCTGAGGGCAGG + Intronic
961450489 3:127000218-127000240 CAGAGCAAGGAGGTGACAGCTGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
961976082 3:131026773-131026795 CGGAGAAAGCAGAGGAGGACCGG - Exonic
962395272 3:135010284-135010306 CAGAGTAGGGGGATGAGGGAAGG - Intronic
962653377 3:137518149-137518171 GGGAGAAAGGAGAAGAGGGAAGG - Intergenic
963121167 3:141778240-141778262 CAGGGAAAGCACAAGAGGGCTGG - Exonic
963246407 3:143067703-143067725 AAGGGAAAGGAGAGGAGGGAGGG - Intergenic
963246930 3:143072420-143072442 CAGCGAAGGGAGATTAGGGGTGG + Intergenic
963295948 3:143546844-143546866 CAGAGAAATGAGGTGATCGCTGG - Intronic
963424912 3:145113349-145113371 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
963521302 3:146362372-146362394 CAGAGAAGGGAGATACGGGTGGG - Intergenic
963755500 3:149231347-149231369 AAGAGAAAGGAGGGGAGGGGAGG + Intergenic
964381380 3:156101362-156101384 CAGAGAAGGGAGATGTGTGTAGG + Intronic
964432249 3:156619618-156619640 GACAGAAAGTAGATTAGGGCCGG - Intergenic
964698173 3:159533627-159533649 CAGAGAACAGAGATGTGGGGGGG - Intronic
964906070 3:161722014-161722036 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
964906886 3:161727469-161727491 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
965070008 3:163907814-163907836 CAGTGAAAGGAGATAGGGGTGGG - Intergenic
965389561 3:168088707-168088729 GAGAGAAACCAGAAGAGGGCAGG - Intronic
965465123 3:169019998-169020020 TAGAGATAGGAGATGTGGGTTGG - Intergenic
965616554 3:170599414-170599436 CAGAAAAAGAAGTTGAAGGCAGG - Intronic
965640384 3:170823455-170823477 CAGAGAAGGGAGATAGGGGTGGG + Intronic
965670832 3:171146205-171146227 CGGAGAAAGAAGATGCAGGCAGG - Intronic
965692441 3:171372010-171372032 CAGGGATGTGAGATGAGGGCAGG + Intronic
965878101 3:173353181-173353203 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
966105405 3:176327014-176327036 CAGTGAAGGGAGATAAGGGTAGG + Intergenic
966234755 3:177688169-177688191 CACAGAAAGGAAAAGAGGGAAGG - Intergenic
966305861 3:178533922-178533944 AAGAGAAGGGAGAAGAGGGGAGG - Intronic
966362758 3:179148284-179148306 CGGAGAAAGGAGTCGGGGGCGGG + Intronic
966775869 3:183542139-183542161 CAGTGAGAGGAGATGAGGGTTGG - Intronic
966898895 3:184466266-184466288 CAGAGGTGGGAGCTGAGGGCAGG + Intronic
967152598 3:186663569-186663591 CAGAGAAGGGAGATGGGGTGGGG - Intronic
967212494 3:187180914-187180936 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
967624137 3:191666361-191666383 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
967625006 3:191672029-191672051 CAGCGAAAGGAGATAAGGATGGG + Intergenic
967644153 3:191900801-191900823 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
967653052 3:192010038-192010060 CACAGAAAGCAGATCAGGGCTGG + Intergenic
967676481 3:192305058-192305080 CAGAGAAGGGAGAGGAAGGAGGG + Intronic
967694899 3:192519175-192519197 CAGAAAAAGGACATGAGGGTGGG - Intronic
967740938 3:193001269-193001291 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
968080089 3:195839903-195839925 CAGGGAGGGCAGATGAGGGCAGG - Intergenic
968432750 4:568366-568388 CTGAGAAGGGGGATGAGGGATGG - Intergenic
968616134 4:1578733-1578755 CAGGGAAGGGAGGGGAGGGCAGG + Intergenic
968651260 4:1761152-1761174 CAGTGACAGGAGATGGGGGCGGG - Intergenic
968945008 4:3658964-3658986 GAGACAAAGGAGAGGAGGGAAGG - Intergenic
969057368 4:4410133-4410155 CAGGGAAAGGGGAGCAGGGCTGG + Intronic
969481370 4:7448751-7448773 GAGAGAAAGGAAAAGAGGGAGGG - Intronic
969798051 4:9541222-9541244 CAGAGTTAGGACAAGAGGGCTGG + Intergenic
969932552 4:10645126-10645148 GAGAGGAAGGAGATCAGGGAAGG - Intronic
970005878 4:11410306-11410328 CAGAGGAAAGAGATGGGAGCTGG + Intronic
970238962 4:13988270-13988292 AAGAGAAATGGGATGAGGGAGGG + Intergenic
970323106 4:14894995-14895017 CAGAGAAAGGGGGTAGGGGCAGG - Intergenic
970530362 4:16975196-16975218 CAGGGAAGGGAGATAAGGGTGGG - Intergenic
970532429 4:16998075-16998097 CAGTGAAAGGAGATAAGGGTGGG - Intergenic
970964316 4:21910178-21910200 CAAAAGAAGGAGATGAGGTCAGG + Intronic
971122805 4:23722972-23722994 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
971130065 4:23798125-23798147 CAGAGAAGGGAGATGGGGTGGGG - Intronic
971200615 4:24506627-24506649 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
971380008 4:26087959-26087981 CAGAGACAGGGGATGTGGGATGG + Intergenic
971424332 4:26501377-26501399 CACAGAAAGGAGATGGGGTGAGG - Intergenic
971541730 4:27826557-27826579 CCTTGAAAGGAGATGAGGGTGGG - Intergenic
971632070 4:29006054-29006076 CAGAGAGGAGAGCTGAGGGCAGG + Intergenic
972346810 4:38199277-38199299 AAGAGAAAGGAAATGATGCCAGG + Intergenic
972557206 4:40193500-40193522 GAGAGAGAGGAGAGGAGGGGCGG + Intronic
973639384 4:52887821-52887843 CTGAGAAAGGAGTTGGGGGATGG - Intronic
973881803 4:55280449-55280471 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
973944862 4:55945902-55945924 CAGCGAAAGGAGATAGGGGTGGG - Intergenic
974095870 4:57363270-57363292 CGGAAAATGAAGATGAGGGCAGG - Intergenic
974427905 4:61764319-61764341 CAGCGAAGGGAGATAAGGGTGGG + Intronic
974904414 4:68037452-68037474 CAGAGAAGGGAGATGGGGTGGGG - Intergenic
974935584 4:68406172-68406194 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
975335827 4:73174032-73174054 CCAAGAAAGGAGAGGAGGGGAGG + Intronic
975839068 4:78455095-78455117 CAGAGCAAAGAGAAGAGGACTGG - Intronic
975864611 4:78713943-78713965 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
975865440 4:78719373-78719395 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
975933403 4:79554067-79554089 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
976167204 4:82268664-82268686 CAGAGGAAGGAAATGAGAGCTGG - Intergenic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
976332629 4:83850121-83850143 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
976789516 4:88862306-88862328 CAGAGAGAGGTGAGGAGGGAAGG + Intronic
976803417 4:89019017-89019039 CAGAGAAGTGAGAAGAGGCCAGG + Intronic
977009898 4:91623966-91623988 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
977010769 4:91629576-91629598 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
977012445 4:91654703-91654725 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
977074719 4:92439055-92439077 CAGCGAAGGGAGATAAGGGTGGG + Intronic
977075512 4:92444305-92444327 CAGTGAAGGGAGATAAGGGTGGG + Intronic
977094477 4:92722369-92722391 CAGAGAAAGAACATGAGGTAAGG - Intronic
977784812 4:101020460-101020482 CAGAAAAAGGAGATAAGTGGTGG - Intergenic
978244094 4:106551518-106551540 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
979096230 4:116554031-116554053 CAGAGGGAGGATATAAGGGCTGG - Intergenic
979380422 4:119999543-119999565 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
979625127 4:122835958-122835980 CAGAGAAAGGTGAGGATGGGAGG - Intronic
980003667 4:127516853-127516875 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
980888961 4:138793777-138793799 GAAAGAAAGGAGAAGAGGGGAGG + Intergenic
980928013 4:139158075-139158097 CAGAGAAGGGAGATAGGGGTGGG + Intronic
980996534 4:139784777-139784799 GAGTGATCGGAGATGAGGGCAGG - Intronic
981046623 4:140270676-140270698 CAGAGAAAGGAGGTAATGGGTGG + Intronic
981524810 4:145699151-145699173 CAGCGAAGGGAGATAAGGGTGGG - Intronic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
982172236 4:152673081-152673103 AAGAGAAATGAGATCAGGGAGGG - Intronic
982180825 4:152746810-152746832 CAGCGAAGGGAGATGGGGGTGGG + Intronic
983056023 4:163100040-163100062 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
983056581 4:163103990-163104012 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
983195406 4:164800703-164800725 CAGAGAAAGCTGTAGAGGGCTGG - Intergenic
983448532 4:167881900-167881922 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
983595140 4:169457733-169457755 AGGAGAAAGGAGAGGAGGGGAGG + Intronic
983805323 4:171986207-171986229 CAGAGAAAGGAGATAAGGGTGGG + Intronic
984217059 4:176926579-176926601 CAGTGAGAGGAAAAGAGGGCCGG + Intergenic
984229319 4:177075244-177075266 CAGAGAGAGGAGCTAAGAGCAGG + Intergenic
984370366 4:178856412-178856434 CAGAGACAGGAGGTGAGGGAAGG - Intergenic
984781910 4:183533796-183533818 CAGAGATAAGAGATGAGGCAGGG - Intergenic
984881985 4:184417961-184417983 CAGAGAAACGGGATGAGGCAGGG + Intronic
985085381 4:186307871-186307893 CATAGAAATGAGAGGAAGGCAGG + Intergenic
985108582 4:186523622-186523644 GAGAGAATGGAGGTGAGGGGTGG - Intronic
985269114 4:188177423-188177445 AAAAAAAAGGAGATGGGGGCAGG + Intergenic
985378572 4:189368320-189368342 AAAAGAAAGAAAATGAGGGCAGG + Intergenic
985389401 4:189479636-189479658 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
985883104 5:2655727-2655749 AGGTGAAAGGAGATGAGAGCAGG + Intergenic
986193206 5:5515849-5515871 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
986248461 5:6032357-6032379 CAGAGTGAGGAGATGAGATCAGG + Intergenic
986388554 5:7263907-7263929 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
986713890 5:10508464-10508486 TAGAAAAAGGATATTAGGGCCGG - Intronic
986825769 5:11520615-11520637 AAAAGAAATGAGATGAGGGCTGG - Intronic
986871428 5:12051510-12051532 CAGGGAAAGGTGATGTGGTCTGG - Intergenic
987356283 5:17065983-17066005 CAGCGAAGGGAGATAAGGGTGGG + Intronic
987497646 5:18668944-18668966 CAGCGAAGGGAGATAGGGGCAGG + Intergenic
987855997 5:23421676-23421698 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
987940126 5:24523077-24523099 CAGAAAACGGGGATGGGGGCAGG + Intronic
988665110 5:33318334-33318356 CAGAGAGAGGAGATGGGGATTGG + Intergenic
988727653 5:33940023-33940045 CACAGAAAGCAGATCAGGGAAGG - Intergenic
989157746 5:38360398-38360420 CAGAGAAAGAAACTGAGGACTGG - Intronic
989180911 5:38575992-38576014 CAGAGGAAGGTGATGGGGGAAGG + Intronic
989186678 5:38632730-38632752 AAGAGAAAGGATAAAAGGGCAGG + Intergenic
990140277 5:52695249-52695271 CTGAGAAAGGAGATGAAGGAAGG - Intergenic
990830504 5:59951928-59951950 CAGAGAAAGGAGAAGTGAGGAGG - Intronic
991001989 5:61792128-61792150 CAGAAAAAAGAGATGAGTGCTGG + Intergenic
991423149 5:66462232-66462254 CAGAAAAAGGAGAATAGAGCTGG - Intergenic
992394321 5:76357582-76357604 CAGCGAAAGGAGATAAGGGTGGG - Intergenic
992395149 5:76362950-76362972 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
992997494 5:82347480-82347502 CAGTGGAAGGAGCTGAGGTCTGG + Intronic
993527766 5:88987702-88987724 GGGAGAAAGGAAAGGAGGGCGGG - Intergenic
993757091 5:91744829-91744851 CAGCGAAGGGAGATAAGGGTAGG - Intergenic
995122986 5:108554895-108554917 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
995352339 5:111193845-111193867 CAGAGTATGTAGAAGAGGGCAGG + Intergenic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
995856811 5:116601164-116601186 CAGAGGAGGGAGAGGAGGGAGGG - Intergenic
996202783 5:120697647-120697669 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
996203602 5:120703062-120703084 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
996344424 5:122474291-122474313 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
996383121 5:122882534-122882556 CAGAACAAAGAGATGAGGGCAGG - Intronic
996744910 5:126839438-126839460 CAGCGAAGGGAGATAAGGGAGGG + Intergenic
996745858 5:126845356-126845378 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
997506539 5:134422019-134422041 AAGAGAAAGGAGAAGAAGGAAGG - Intergenic
997770865 5:136551673-136551695 CAGGGAAGGGAGATAAGGGTGGG + Intergenic
997772173 5:136565441-136565463 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
997932504 5:138084022-138084044 CAGAGAAGTGAGGAGAGGGCAGG - Intronic
998592386 5:143490944-143490966 CAGAGAAGGTAGATAAGGACAGG - Intergenic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
998947482 5:147355322-147355344 CAGACAAAGGAGAAGAGAGAAGG - Intronic
998996016 5:147869937-147869959 CAGAGAAGGGAGATAAGGGTGGG + Intergenic
998996695 5:147874179-147874201 CAGCGAAGGGAGATAAGGGTGGG + Intronic
999054283 5:148557161-148557183 CAGAGTAATGACATGGGGGCAGG + Intronic
999319338 5:150603724-150603746 CAGAGGAAGGAGCACAGGGCTGG + Intronic
999618391 5:153449788-153449810 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1000092863 5:157945581-157945603 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1000370145 5:160527447-160527469 CAGAGCTAGGTGATGAGGGTAGG + Intergenic
1000519754 5:162280852-162280874 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1001141542 5:169148025-169148047 CAGGGAAAGAAGATGAGGTGTGG + Intronic
1001415507 5:171542527-171542549 AAAAGAAAGGGGATGAGGGGAGG + Intergenic
1001520046 5:172385050-172385072 CAGAAACAGGAGGTGAGGGAGGG - Intronic
1001806512 5:174591361-174591383 GGGAGAAAGGAGAGGAAGGCAGG - Intergenic
1001947962 5:175796515-175796537 CCGAGAAAGGAGGCGGGGGCTGG - Exonic
1002212058 5:177605019-177605041 GAGGGAAAGGAGGTGGGGGCTGG - Intronic
1002468846 5:179422632-179422654 TAGAGAAAGGAGATGAGCCCAGG - Intergenic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1002890372 6:1326698-1326720 CAGAGAGAGGAAGTGAGGGGAGG - Intergenic
1002968132 6:1988418-1988440 CAAAGGGAGGAGATGAGGGTGGG - Intronic
1003147269 6:3518861-3518883 CAGGGAAAGGAGCTGAGCCCAGG + Intergenic
1003430859 6:6036200-6036222 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1003727906 6:8786874-8786896 CAGAGAGAAGAGATGAGGGTAGG + Intergenic
1004012454 6:11702687-11702709 CAGAGAAAGGAGGTGAGGCCAGG + Intergenic
1004106730 6:12672891-12672913 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1004121069 6:12822575-12822597 CAGGGAAGGGAGAGGAGGCCTGG - Intronic
1004181803 6:13386970-13386992 CTGAGAAATGAGATGGAGGCTGG - Intronic
1004285408 6:14316588-14316610 CAGTGAAAGGAGAGCAGGCCGGG + Intergenic
1004574899 6:16886263-16886285 CAGTGAAGGGAGATGGGGGTGGG - Intergenic
1005014168 6:21361593-21361615 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1005014998 6:21366918-21366940 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1005220277 6:23578798-23578820 GAGAGATAGGAGATGGGGTCAGG + Intergenic
1005346088 6:24892159-24892181 CAGAGCAAGAAAATGAGGGTTGG + Intronic
1005496858 6:26395358-26395380 CAGAGAAAATAGATGAGGAGGGG - Intergenic
1005886826 6:30103370-30103392 CTGAGAGTGGAGATGGGGGCGGG - Exonic
1006137303 6:31902752-31902774 CTGAGAATGGAGGGGAGGGCGGG - Intronic
1006303684 6:33207166-33207188 CAGAGAAAGGAGAGGGGTGGGGG - Intergenic
1006368473 6:33630178-33630200 GTGGAAAAGGAGATGAGGGCGGG - Intronic
1006392933 6:33769491-33769513 CAGAGGCAAGGGATGAGGGCAGG - Intergenic
1006440179 6:34049068-34049090 CAGAGAAAGGGGATGCTAGCTGG - Intronic
1006456005 6:34132320-34132342 CAGAGAATGCAGATGAGGACGGG - Intronic
1006512357 6:34528567-34528589 CAGAGAAGGGAGATGTGAGGGGG + Intronic
1006972429 6:38060448-38060470 CAGAGAGAGGAGAAAAGGGAGGG - Intronic
1007091962 6:39190294-39190316 GGGAGTGAGGAGATGAGGGCAGG - Exonic
1007269604 6:40626523-40626545 GAGGGAAAGGAGATGAAAGCAGG - Intergenic
1007717439 6:43865355-43865377 GAGTGAATGGAGATGAGGACAGG + Intergenic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007788325 6:44294830-44294852 CACAGAAAGGAGAGGAGGTGGGG + Intronic
1007837193 6:44682683-44682705 CAGAGAGAGGAAAGGAGGGAAGG - Intergenic
1007950272 6:45866023-45866045 CAGAAAAAGGAGAGAAGGGAAGG - Intergenic
1007962660 6:45974588-45974610 CATAGAGAGGAGTTGAGGGCAGG + Intronic
1008666798 6:53724656-53724678 GAGAGAAGGGAGAGGAGGGGAGG + Intergenic
1008698312 6:54068133-54068155 AAAAGAAAGGAGAGGAGGGGAGG - Intronic
1008762928 6:54875770-54875792 AAGAGACAGGAGAGGAGGGAAGG + Intronic
1008850614 6:56016488-56016510 CAGCGAAGGGAGATAAGGGTAGG + Intergenic
1009359827 6:62797329-62797351 CAGAGAAGGGAGATGGGGTGGGG - Intergenic
1009464087 6:63950469-63950491 CAGAGAAGGGAGATAGGGGTGGG - Intronic
1010023555 6:71189660-71189682 AAGAAAAAAGAGATAAGGGCTGG + Intergenic
1010071204 6:71748460-71748482 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1011770461 6:90670302-90670324 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1011771185 6:90675093-90675115 CAGGGAAGGGAGATAAGGGTGGG + Intergenic
1012014697 6:93835400-93835422 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1012211822 6:96528825-96528847 GAGAGGAAGGAGATGCGGACTGG - Intronic
1012315477 6:97779824-97779846 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1012316298 6:97785202-97785224 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1012675632 6:102108088-102108110 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1013348236 6:109282957-109282979 AAGAGAAAAGAGAAGAGGGGAGG - Intergenic
1013402728 6:109814805-109814827 CAGAGAAATGATTTCAGGGCTGG - Intronic
1013892191 6:115037496-115037518 CAGAGAAGGGAGATAAGGGTGGG - Intergenic
1013960540 6:115893921-115893943 CAGAGGAAGGAAATGAGGCCAGG + Intergenic
1014066026 6:117126591-117126613 CAGTGAAAGGATATGGAGGCTGG + Intergenic
1014086022 6:117345132-117345154 CAGAGACTGGATATGCGGGCAGG - Intronic
1014795506 6:125719833-125719855 CTGAGAAAGGAGTTGGGGGTAGG + Intergenic
1014837476 6:126175963-126175985 CTGAGAAAGGGGATAAGGGGTGG - Intergenic
1015212305 6:130712171-130712193 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1015229160 6:130894052-130894074 CAGACAAAGGAGATGAGGCAAGG + Intronic
1015269320 6:131323623-131323645 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1015271026 6:131339127-131339149 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1015323476 6:131901878-131901900 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1015324309 6:131907296-131907318 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1015589611 6:134810437-134810459 CAGAGAAAGAAGAGGAGGGAGGG - Intergenic
1015800764 6:137060386-137060408 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1015889513 6:137955486-137955508 CAGGGCAAGAAGAAGAGGGCGGG + Intergenic
1015974704 6:138778150-138778172 CAGGGAAAGTAGGTGAGGGGGGG - Intronic
1016074073 6:139775566-139775588 CAGAGACAGGAGATCAGAGGCGG + Intergenic
1016248498 6:142015994-142016016 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1016249382 6:142021659-142021681 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1016806402 6:148216712-148216734 AAGAAAAAAGAGATGAGGTCAGG - Intergenic
1017875564 6:158521520-158521542 CAGAAAAAGAAGAGGAGGGGAGG + Intergenic
1017903488 6:158738477-158738499 CAGAGAAGGCAGGGGAGGGCAGG - Intronic
1018343282 6:162874696-162874718 CAGAGAGAGGAAATGAGGCATGG + Intronic
1018623015 6:165750184-165750206 CAGAGAAAGGAGTGAAGGGTGGG + Intronic
1018708995 6:166484379-166484401 TGGAGGAAGGAAATGAGGGCTGG - Intronic
1018931594 6:168243641-168243663 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1018931602 6:168243681-168243703 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1019026267 6:168966125-168966147 CAGAGAAAAGAGGAGAGGGGAGG - Intergenic
1019269346 7:138230-138252 CTGAGAAAGGACCTGAGGTCGGG + Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019980711 7:4619941-4619963 CAGAGAATGCAGAGGATGGCGGG + Intergenic
1020000658 7:4753858-4753880 GAGGGAGAGGGGATGAGGGCAGG + Intronic
1020532236 7:9353506-9353528 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1020820477 7:12960794-12960816 TAGAGAAAGGAGATGAGATGTGG + Intergenic
1020853338 7:13385257-13385279 CAGAGCAAGGAAATGAGGGAAGG + Intergenic
1020913636 7:14165043-14165065 CAGAAAATAGAAATGAGGGCTGG - Intronic
1021196482 7:17679829-17679851 AGGAGAAAGGAGAGGAGGGGAGG + Intergenic
1021261786 7:18467389-18467411 CAGAGAAAGCAGCAGAGGCCTGG - Intronic
1022009116 7:26293087-26293109 GAGAGAATGGAGGTGAGGTCAGG + Intronic
1022440502 7:30429095-30429117 CAATGAAGGTAGATGAGGGCGGG + Intronic
1022573031 7:31472078-31472100 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1022630057 7:32076342-32076364 CAGAAAAATGACATCAGGGCTGG + Intronic
1022648779 7:32256070-32256092 CAGGGCAAGGAGATCAGGGAAGG + Intronic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023288770 7:38647031-38647053 GAGAGAAAGGAGGGGAGGGAGGG - Intergenic
1023427687 7:40056419-40056441 CAGAGAAAGGGGATAAAGCCAGG - Intronic
1023698399 7:42870675-42870697 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1024205483 7:47156020-47156042 CACAGGAAAGAGATGAAGGCTGG + Intergenic
1024263671 7:47590299-47590321 GAGAGAAAGAAGAAGAGGGAAGG - Intergenic
1024785070 7:52898158-52898180 GAGAGAAAGGAGGAGAGGGAGGG + Intergenic
1024807171 7:53156397-53156419 AAGACAAATGAGAAGAGGGCGGG - Intergenic
1024992903 7:55250432-55250454 CGGAGAAAGGAGGCAAGGGCTGG + Intronic
1025227483 7:57177892-57177914 CAGACAAAGGAGATATGGGGAGG + Intergenic
1025319516 7:58079792-58079814 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1025489153 7:61090255-61090277 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1025554199 7:62283679-62283701 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1025560582 7:62369595-62369617 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1026226806 7:68449256-68449278 CAGAGAAAGAAGAGGAGAGAGGG - Intergenic
1026227780 7:68457812-68457834 CAGAGAAATGGGGTGATGGCCGG + Intergenic
1026355296 7:69552141-69552163 CAGGAAAAGCAGATGAGGGTTGG - Intergenic
1026614412 7:71888795-71888817 AGGAGAAAGGGGAGGAGGGCAGG + Intronic
1026623384 7:71971151-71971173 CAAAGAAAGGAGATGAGGCCAGG + Intronic
1026736532 7:72952511-72952533 AAGAGAAAGGAGTGGAGGCCGGG + Intergenic
1027107202 7:75412551-75412573 AAGAGAAAGGAGTGGAGGCCGGG - Intergenic
1027851621 7:83459995-83460017 CAGCGAAGGGAGATAAGGGTGGG - Intronic
1027852433 7:83465260-83465282 CAGCGAAGGGAGATAAGGGTGGG - Intronic
1028235851 7:88360938-88360960 TCCAGAAAGGAGATGGGGGCTGG + Intergenic
1028605972 7:92656156-92656178 AAGAGAAAGAAGATGAAGGGAGG + Intronic
1028809460 7:95067968-95067990 CAGTGAAGGGAGATAAGGGTGGG - Intronic
1028815717 7:95141521-95141543 CAGAGAAGGGAGAGGAGAGCTGG - Intronic
1029538057 7:101167263-101167285 AAGAGAGAAGAGATGGGGGCAGG + Intergenic
1029564124 7:101323736-101323758 CATAGAAAGGAGAACCGGGCTGG - Intergenic
1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG + Intronic
1030152350 7:106420154-106420176 CAGAGAATGGAGAGGTGGGGAGG - Intergenic
1030203258 7:106927290-106927312 TAGAGAAAGGAGTTGAGGGAGGG + Intergenic
1030238346 7:107292007-107292029 CAAAGAAAGGAGAGGAGGAAGGG - Intronic
1030290813 7:107870998-107871020 CAGAGACAGAAGATGCGGGAGGG + Intergenic
1030334699 7:108312435-108312457 CTATGAAAGGACATGAGGGCTGG + Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030384292 7:108848730-108848752 GAGAGAAAGGAGGAGAGGGGAGG - Intergenic
1030441978 7:109597290-109597312 CAGTGAAGGGAGATAGGGGCGGG + Intergenic
1030633435 7:111920572-111920594 CAGAGATAGCAGGTGAGGCCAGG - Intronic
1030924720 7:115437749-115437771 GAGAGAGAGAAGATGTGGGCCGG - Intergenic
1031543367 7:123023322-123023344 CAGATAGAGGAGATGGGGGTTGG + Intergenic
1031727516 7:125259205-125259227 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1031903390 7:127434590-127434612 GAGAGAAAAGAGACGAGGGAAGG + Intergenic
1032339419 7:131057109-131057131 TAAAGAAAGGAGTTGAGGCCTGG - Intergenic
1032398263 7:131606274-131606296 CAGAGAAGGGAGAAGAGGTTAGG - Intergenic
1032463854 7:132131257-132131279 CAGACTCAGGAGATGAGGGATGG + Intronic
1032836561 7:135680670-135680692 AAGAGAAAGGAGCTGATGGCCGG + Intronic
1032866890 7:135934828-135934850 CAGAGAAAGTAAAGGAAGGCAGG - Intronic
1033172142 7:139093694-139093716 CAGCGAAGGGAGATGAGGGTGGG - Intronic
1033197997 7:139343637-139343659 TAGAGAAAGGGGATTAGGCCAGG + Intronic
1033211233 7:139461740-139461762 CAGCGAAGGGAGATAAGGGTGGG - Intronic
1033212241 7:139468530-139468552 CAGCGAAGGGAGATAAGGGTGGG - Intronic
1033465352 7:141584143-141584165 CAGCGAAGGGAGATAAGGGTGGG + Intronic
1033597874 7:142869340-142869362 GAGACAAAGGGGATGAGGGAGGG + Intronic
1033734408 7:144207919-144207941 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1033748644 7:144343050-144343072 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1034227818 7:149497177-149497199 CAGAGAAAGGAGCCGCGGGTGGG + Intronic
1034390014 7:150778927-150778949 AAGAGAAAGGAGATGGGAGTGGG - Intergenic
1034859872 7:154585940-154585962 GGGAGAAAGGAGAGGAAGGCAGG + Intronic
1035229824 7:157458292-157458314 CAGAGAAAGGAGGAGAGCGGTGG + Intergenic
1035707470 8:1688223-1688245 CAGAGAAGGGAGGGGAGGACTGG - Intronic
1035722340 8:1801624-1801646 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1036071244 8:5442000-5442022 CAGCAAACGGAGATGAGGGTGGG + Intergenic
1036283932 8:7426804-7426826 CAAAGAGAGGAGAAAAGGGCTGG - Intergenic
1036337543 8:7884726-7884748 CAAAGAGAGGAGAAAAGGGCTGG + Intergenic
1036585231 8:10117428-10117450 CATAGAAAGGGGAGCAGGGCTGG + Intronic
1036589706 8:10157770-10157792 GAGAGAAAGAAGAAGAGGGCGGG - Intronic
1036762255 8:11517573-11517595 CGGGGAAAGCAGATGAGGCCGGG - Intronic
1037391242 8:18394045-18394067 CAGTGAAGGGAGATAAGGGTGGG + Intronic
1037733278 8:21547230-21547252 CACAGGAAGGAGATGAGAGAAGG - Intergenic
1037835218 8:22211567-22211589 CAGAGAAAAGAGATGGGGTAAGG - Intronic
1037916991 8:22778788-22778810 CAGAGCAAGGAGAGAAGGCCAGG - Intronic
1038010479 8:23471889-23471911 CAGAGAGAGGGGATGAGAGTAGG + Intergenic
1038021882 8:23557898-23557920 CAGAGAAAGGAAATAAGGCTCGG - Intronic
1038539997 8:28384421-28384443 CAGAGAAGGGAGTTGTGGGCAGG - Intronic
1038765557 8:30424428-30424450 CTGAGACATGAAATGAGGGCAGG + Intronic
1039180413 8:34860290-34860312 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1039768580 8:40659255-40659277 AACGGAAACGAGATGAGGGCAGG + Intronic
1039897457 8:41726129-41726151 CAGAGAAAGGAAGTGGAGGCAGG - Intronic
1040399065 8:47029953-47029975 GAGAGAAAGGAGAGGTGGGGTGG + Intergenic
1040414562 8:47184572-47184594 CAGAGAGAGCACATGAGTGCTGG - Intergenic
1040530397 8:48261821-48261843 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1040575500 8:48647920-48647942 CAGGGAAAGGAGATGATGGATGG + Intergenic
1040638416 8:49302867-49302889 CAGAGAAAGGAGACATGGCCTGG + Intergenic
1041309733 8:56503162-56503184 CAGGGAAAGGAGATGGGGTCTGG + Intergenic
1041441232 8:57899142-57899164 CAGAGAGCTGGGATGAGGGCAGG - Intergenic
1041983249 8:63888488-63888510 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1042345226 8:67720066-67720088 CAGCGAAGGGAGATAAGGGTGGG + Intronic
1042453193 8:68973306-68973328 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1042454026 8:68978646-68978668 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1042777455 8:72449224-72449246 AAGAATAAGGAGATGAGAGCAGG - Intergenic
1042877431 8:73452032-73452054 CAGAGCAAGGAGCTGGGTGCAGG + Intronic
1043068566 8:75608907-75608929 CACAGAAATGATATGAGGGAAGG + Intergenic
1043353186 8:79386208-79386230 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1043353967 8:79391355-79391377 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1043865019 8:85364900-85364922 GAGAGAAAGGTGCTGAGGGTGGG + Intronic
1044461182 8:92446228-92446250 CAGAGATAGGAGGTGAGCGCCGG - Intergenic
1044922470 8:97180614-97180636 CAGCGAAGGGAGATGGGGGTGGG - Intergenic
1044924795 8:97201097-97201119 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1044925645 8:97206533-97206555 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1045083793 8:98657445-98657467 TAATGAAAGGAAATGAGGGCAGG + Intronic
1045198010 8:99949484-99949506 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1045504785 8:102770701-102770723 CATAGAAAGGAGATGCAGGTGGG + Intergenic
1045769298 8:105716034-105716056 CAGAGAAAAGAGATGCTGGCAGG + Intronic
1045991143 8:108309856-108309878 CAGCGAAGGGAGATAAGGGTGGG + Intronic
1046511766 8:115212580-115212602 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1046512567 8:115217855-115217877 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1046588476 8:116176543-116176565 GAGAGAAAGGAAAGGAGGGAGGG + Intergenic
1046691673 8:117292747-117292769 GACAGAAAGGAGATGAGTGTAGG + Intergenic
1046971085 8:120224009-120224031 AAAAAAAAGGAGATGAGGGCAGG - Intronic
1047139529 8:122121937-122121959 GAGAGAAAGGAAAAGAGGGATGG - Intergenic
1047270384 8:123352158-123352180 CAGAGCAAGGAGGTGAGGGGAGG - Intronic
1047285441 8:123483766-123483788 CAGAGTTAGGAGCTGTGGGCCGG + Intergenic
1047329615 8:123874870-123874892 CAGAGAAATGAGATGGTAGCTGG - Intronic
1047699016 8:127432024-127432046 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1048135956 8:131746503-131746525 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1048167961 8:132080339-132080361 CAGTGAAGGGAGATAAGGGTGGG + Intronic
1048168772 8:132085653-132085675 CAGTGAAGGGAGATAAGGGTGGG + Exonic
1048325269 8:133434304-133434326 CTGAGAGAAGAGATGAGGGCAGG - Intergenic
1048442347 8:134469300-134469322 CAGAGAAAGGGGATAAGGGAGGG - Intergenic
1048711357 8:137214968-137214990 GAGAGAATGGAGGTGGGGGCGGG + Intergenic
1048764568 8:137830268-137830290 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1048891684 8:138954008-138954030 TAGATAAAGGAAATGAGGCCTGG + Intergenic
1049519732 8:143082002-143082024 CAGAGAAACGAGCCCAGGGCTGG + Intronic
1050363196 9:4850735-4850757 CTTGGAGAGGAGATGAGGGCTGG + Intronic
1051012975 9:12441012-12441034 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1051207184 9:14700453-14700475 CAGAGGAAGGAGTTGAGAGATGG - Intergenic
1051640905 9:19223774-19223796 CAGAGAAAGGAGTAATGGGCAGG - Intergenic
1051849005 9:21487386-21487408 CAGGGAAGGGAGATAAGGGTGGG + Intergenic
1051931458 9:22391374-22391396 AAGAGAAAGGAGATTTGAGCTGG - Intergenic
1052654173 9:31334576-31334598 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1053522519 9:38794657-38794679 CAGAGACAGGAGGAGAGGACAGG - Intergenic
1053541398 9:38977513-38977535 GAGAGAAAGGAGAGGAGGGAAGG + Intergenic
1053805819 9:41800556-41800578 GAGAGAAAGGAGAGGAGGGAAGG + Intergenic
1054194747 9:62019079-62019101 CAGAGACAGGAGGAGAGGACAGG - Intergenic
1054624740 9:67386395-67386417 GAGAGAAAGGAGAGGAGGGAAGG - Intergenic
1054643661 9:67569611-67569633 CAGAGACAGGAGGAGAGGACAGG + Intergenic
1054716874 9:68565270-68565292 CAAAGAAAGGAAATGAGGTAAGG + Intergenic
1054729079 9:68682480-68682502 CTGAGAAGGGAGTTGAGAGCAGG + Intergenic
1054807776 9:69410007-69410029 CAGCGAAAGGAGATGGGGTGGGG + Intergenic
1054848708 9:69823722-69823744 CAGTGAAGGGAGATAAGGGTGGG + Intronic
1055232712 9:74085909-74085931 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1055233546 9:74091288-74091310 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1055347159 9:75351246-75351268 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1055517555 9:77048467-77048489 AATAGAAAGGATATGAGGCCAGG - Intergenic
1055626366 9:78180982-78181004 CAGAGAAGGGAGATAGGGGTAGG - Intergenic
1055627259 9:78186697-78186719 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
1056261985 9:84858126-84858148 GAAAGAAAGGAGATGACTGCAGG - Intronic
1056324735 9:85466823-85466845 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1056532441 9:87498663-87498685 CAGAGAAAGGGGAGGCGGGGAGG + Intronic
1056698323 9:88879393-88879415 CAGAGAAGAGAGATGAGTCCAGG - Intergenic
1057053247 9:91941763-91941785 AAGAGAAAGGAGGGCAGGGCGGG - Intronic
1057129611 9:92644408-92644430 CAGAGGACGCAGATGAGGGCAGG + Intronic
1057195842 9:93115405-93115427 GTGAGGAAGGAGATGAGGGAGGG + Intergenic
1057448757 9:95137897-95137919 CAGAGAGAGGAGAGGAGTGGAGG + Intronic
1057466913 9:95322528-95322550 AGGAGAAAGGAGAGGAGGGAAGG + Intergenic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058569610 9:106326495-106326517 AAGAGAAAAGAAAAGAGGGCGGG - Intergenic
1058954495 9:109932732-109932754 CACAGAAATGTGCTGAGGGCTGG + Intronic
1059170023 9:112116081-112116103 CTCAGAGAGAAGATGAGGGCTGG - Intronic
1059202828 9:112433992-112434014 CAGAGAAAGGATCAGAGGGCCGG + Intronic
1059269521 9:113063116-113063138 CAGGGAAAGGAAAGGAGAGCCGG + Intergenic
1059270653 9:113068563-113068585 CAGGGAAAGGAAAGGAGAGCCGG + Intergenic
1059271788 9:113074010-113074032 CAGGGAAAGGAAAGGAGAGCCGG + Intergenic
1059272922 9:113079457-113079479 CAGGGAAAGGAAAGGAGAGCCGG + Intergenic
1059274057 9:113084899-113084921 CAGGGAAAGGAAAGGAGAGCCGG + Intergenic
1059363963 9:113770885-113770907 TAGAGTAAGGAGGTGATGGCAGG + Intergenic
1059574254 9:115473509-115473531 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1059575074 9:115478797-115478819 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1059606222 9:115839279-115839301 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1059607027 9:115844580-115844602 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1059697654 9:116744097-116744119 CAGAAAAAGGAGGTGAGGGTGGG + Intronic
1059862992 9:118485734-118485756 CAGAGGAGGGAGATAAGGGTGGG + Intergenic
1059863801 9:118491049-118491071 CAGAGAAGGGAGATAAGGGTGGG + Intergenic
1060225830 9:121790327-121790349 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1060226803 9:121796646-121796668 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1060317366 9:122525044-122525066 TAGACTAAGGAGATGAGGGCAGG + Intergenic
1060338598 9:122751717-122751739 GAGAGAAAGGAGAATACGGCTGG + Intergenic
1060353486 9:122881189-122881211 CAAAGAAAGGTGAGGAGGCCAGG + Intronic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1061200377 9:129134897-129134919 GAGAGAAAGGACAGGAGGGTTGG + Intronic
1061223598 9:129267136-129267158 CAGAGAAATGGGGTGATGGCCGG + Intergenic
1061374466 9:130215797-130215819 CAGGGAAAGGTGCAGAGGGCTGG + Intronic
1061504770 9:131025565-131025587 CAGGCAAAGGAGAGGAGAGCAGG + Intronic
1061652859 9:132065365-132065387 CAGGGAAAGGAGAAGAGCGGCGG + Intronic
1061850718 9:133413395-133413417 AAAAGAAAAGAGATGAGGCCAGG - Intronic
1062000588 9:134213926-134213948 CAGACCTAGGAGATGAGGGTGGG - Intergenic
1062021745 9:134322828-134322850 AAGAGAAAGGATAGGAGGGAGGG - Intronic
1062228272 9:135465990-135466012 GGGAGAAAGGAGATGGAGGCAGG + Intergenic
1062283248 9:135761362-135761384 CAGAGAAAGGAGCAGAATGCAGG - Intronic
1062287719 9:135780532-135780554 CAGAGAAGCGAGAGGAGGCCGGG + Intronic
1062646945 9:137552515-137552537 AATAGAAATGAGATGAGGGCAGG - Exonic
1185450598 X:279010-279032 CAGCGAAGGGAGATGGGGGAGGG + Intronic
1185545720 X:942296-942318 GAGAGAAAGAAGAAGAGGGGGGG + Intergenic
1185755768 X:2651916-2651938 GAGAGAAAGAAGATGAGGGAGGG - Intergenic
1185857931 X:3553245-3553267 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1186112375 X:6272319-6272341 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1186113224 X:6277634-6277656 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1186158276 X:6748952-6748974 AAGAGAAAGGAGATGAATGATGG + Intergenic
1186699468 X:12074341-12074363 CAACACAAGGAGATGAGGGCTGG - Intergenic
1186783743 X:12940153-12940175 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1187062090 X:15796188-15796210 CAGAGAAAAGTCATGATGGCCGG - Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187086050 X:16044813-16044835 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1187099505 X:16179301-16179323 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1187100218 X:16184128-16184150 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1187522071 X:20022534-20022556 CTGAGGAAGGAGAGGAGGGACGG + Intronic
1188420023 X:29981124-29981146 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1188462892 X:30449033-30449055 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1188463700 X:30454502-30454524 CAGCGAAGGGAGATGAGGGTGGG + Intergenic
1188948502 X:36338285-36338307 CAGAGAAATGGGATGACAGCTGG - Intronic
1189140703 X:38602682-38602704 AAGAGAATGGAGAGGTGGGCGGG + Intronic
1189344904 X:40233441-40233463 CGGAGAAGGGAGGTGAGAGCGGG - Intergenic
1189368804 X:40411560-40411582 CAGAGTATAGAGATGAGCGCTGG - Intergenic
1189386105 X:40538219-40538241 GAGAGAAAGGAGCTGACTGCTGG - Intergenic
1189492864 X:41483319-41483341 AAGAGAGAGGAGAGGAGGGGAGG - Intergenic
1189757882 X:44290127-44290149 CAGAGCAATGAGATGATGGCAGG - Intronic
1190598070 X:52066215-52066237 GAGAGGAAGGAGATGGGGGAGGG + Intronic
1190610754 X:52187858-52187880 GAGAGGAAGGAGATGGGGGAGGG - Intronic
1190937221 X:55007875-55007897 CAGAGAAAGGGGAGGAGGGAGGG + Exonic
1191836655 X:65470386-65470408 AAGGGAGAGGAGATGGGGGCTGG + Intronic
1191846213 X:65549977-65549999 CAGACACAGGAGGAGAGGGCAGG + Intergenic
1192184339 X:68936504-68936526 CAGAGAAGGGAGGAGAGAGCTGG + Intergenic
1192261490 X:69508443-69508465 AAGACAAAGGAGAGGAGGGAGGG - Intronic
1192467326 X:71366540-71366562 CAGAGGAAGGAGGTGCGGGGAGG + Intronic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192538731 X:71950264-71950286 AAGAGAAAGCCCATGAGGGCAGG + Intergenic
1192895690 X:75440782-75440804 TAGAGAAAGGCCATCAGGGCAGG + Intronic
1193358514 X:80551821-80551843 CAGAGACAGAAGCTCAGGGCTGG - Intergenic
1193531613 X:82661023-82661045 CAGTGAATGAGGATGAGGGCGGG + Intergenic
1193941129 X:87682006-87682028 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1193941979 X:87687521-87687543 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1193994042 X:88343514-88343536 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1194060584 X:89191848-89191870 CAGGGAAGGGAGATAAGGGTGGG - Intergenic
1194293140 X:92100341-92100363 CAGTGAAGGGAGATAAGGGTGGG + Intronic
1194502498 X:94698921-94698943 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1194503321 X:94704278-94704300 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1194503395 X:94704740-94704762 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1194534781 X:95093004-95093026 CAGCGAAGGGAGATAAGGGTGGG - Intergenic
1195049043 X:101080161-101080183 GAGAGAAAGGAGCTTAGGGGAGG + Intronic
1195144443 X:101999514-101999536 CATAGAAAAGTGATAAGGGCAGG + Intergenic
1195323866 X:103742555-103742577 GAGAGAAAGAAGAGGAGGCCTGG - Intergenic
1195907267 X:109856768-109856790 CAGAGAGAGAGGATGGGGGCAGG + Intergenic
1196058936 X:111386689-111386711 CAGAGAAAAGAGGGTAGGGCTGG - Intronic
1196072731 X:111544135-111544157 CAGGGAAGGGAGATAAGGGTGGG - Intergenic
1196165178 X:112530708-112530730 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1196166027 X:112536234-112536256 CAGTGAAGGGAGATAAGGGTGGG - Intergenic
1196220486 X:113108823-113108845 CAGTGAAGGGAGATAAGGGTGGG + Intergenic
1196330479 X:114466998-114467020 CAGCGAAGGGAGATAAGGGTAGG - Intergenic
1196341230 X:114601373-114601395 CAGTGAAGGGAGATGAGGGTGGG + Intronic
1196342083 X:114606894-114606916 CAGTGAAGGGAGATGAGGGTGGG + Intronic
1196525819 X:116726400-116726422 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1196533067 X:116812547-116812569 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1196533864 X:116817873-116817895 CAGCGAAGGGAGATAAGGGTGGG + Intergenic
1196566571 X:117212394-117212416 CAAAGAAAAGAGAGCAGGGCGGG + Intergenic
1199234788 X:145479020-145479042 CAGCGACAGGAGATCATGGCAGG - Intergenic
1200194752 X:154240186-154240208 CAGGGAAAGAAGAGGAAGGCAGG + Intergenic
1200773290 Y:7147177-7147199 CAGAGAAAGAAAATGAGGCCTGG - Intergenic
1200942641 Y:8801665-8801687 CAGTGAAAGGAGATAGGGGTGGG - Intergenic
1201225989 Y:11819845-11819867 CCAAGAAAGGAGATGAGAGGAGG + Intergenic
1201365862 Y:13205512-13205534 CAGAAAAGGGAGATGGGGGTGGG + Intergenic
1201511362 Y:14768155-14768177 CAGAAAAAGGAGATGAGTGATGG - Intronic
1201610788 Y:15840658-15840680 TAGAGGAAGGAGTTGAGGTCAGG + Intergenic
1202076874 Y:21044846-21044868 CAGTGAAGGGAGATAAGGGTGGG + Intergenic