ID: 1142238655

View in Genome Browser
Species Human (GRCh38)
Location 16:88935186-88935208
Sequence AACCCAGGACTGCCCCTGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142238655_1142238656 -10 Left 1142238655 16:88935186-88935208 CCGGTCAGGGGCAGTCCTGGGTT No data
Right 1142238656 16:88935199-88935221 GTCCTGGGTTCTGATGTCTCTGG No data
1142238655_1142238662 14 Left 1142238655 16:88935186-88935208 CCGGTCAGGGGCAGTCCTGGGTT No data
Right 1142238662 16:88935223-88935245 GCAGGAGAGGCTGCATGGAAGGG 0: 1
1: 0
2: 4
3: 55
4: 472
1142238655_1142238659 1 Left 1142238655 16:88935186-88935208 CCGGTCAGGGGCAGTCCTGGGTT No data
Right 1142238659 16:88935210-88935232 TGATGTCTCTGGCGCAGGAGAGG 0: 1
1: 0
2: 0
3: 22
4: 154
1142238655_1142238661 13 Left 1142238655 16:88935186-88935208 CCGGTCAGGGGCAGTCCTGGGTT No data
Right 1142238661 16:88935222-88935244 CGCAGGAGAGGCTGCATGGAAGG 0: 1
1: 0
2: 4
3: 28
4: 313
1142238655_1142238658 -4 Left 1142238655 16:88935186-88935208 CCGGTCAGGGGCAGTCCTGGGTT No data
Right 1142238658 16:88935205-88935227 GGTTCTGATGTCTCTGGCGCAGG 0: 1
1: 1
2: 0
3: 10
4: 98
1142238655_1142238660 9 Left 1142238655 16:88935186-88935208 CCGGTCAGGGGCAGTCCTGGGTT No data
Right 1142238660 16:88935218-88935240 CTGGCGCAGGAGAGGCTGCATGG 0: 1
1: 0
2: 5
3: 45
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142238655 Original CRISPR AACCCAGGACTGCCCCTGAC CGG (reversed) Intronic
No off target data available for this crispr