ID: 1142239485

View in Genome Browser
Species Human (GRCh38)
Location 16:88938689-88938711
Sequence GCGGGTGTTCAGACCCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142239485_1142239492 -2 Left 1142239485 16:88938689-88938711 CCATGCTGGGTCTGAACACCCGC 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1142239492 16:88938710-88938732 GCGTGGCACACACGGCACTGGGG 0: 1
1: 0
2: 0
3: 6
4: 97
1142239485_1142239487 -10 Left 1142239485 16:88938689-88938711 CCATGCTGGGTCTGAACACCCGC 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1142239487 16:88938702-88938724 GAACACCCGCGTGGCACACACGG 0: 1
1: 0
2: 1
3: 0
4: 97
1142239485_1142239493 18 Left 1142239485 16:88938689-88938711 CCATGCTGGGTCTGAACACCCGC 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1142239493 16:88938730-88938752 GGGCACGCTGAAGTTGCTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1142239485_1142239490 -4 Left 1142239485 16:88938689-88938711 CCATGCTGGGTCTGAACACCCGC 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1142239490 16:88938708-88938730 CCGCGTGGCACACACGGCACTGG 0: 1
1: 0
2: 0
3: 5
4: 57
1142239485_1142239491 -3 Left 1142239485 16:88938689-88938711 CCATGCTGGGTCTGAACACCCGC 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1142239491 16:88938709-88938731 CGCGTGGCACACACGGCACTGGG 0: 1
1: 0
2: 0
3: 1
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142239485 Original CRISPR GCGGGTGTTCAGACCCAGCA TGG (reversed) Intronic
903669452 1:25026918-25026940 GTGAGTGTGCAGAGCCAGCAGGG + Intergenic
905104466 1:35556226-35556248 GCAGCTGTTCAGACAGAGCAGGG + Intronic
908640211 1:66214582-66214604 GTTGGTGTTCAGATCAAGCAAGG - Intronic
915031259 1:152882178-152882200 TCGGGGGTTCAGAACCAGCCTGG - Intronic
919859327 1:201728827-201728849 GTGTCTGTTCAAACCCAGCAGGG + Intronic
921812863 1:219534274-219534296 GCGGTTACTCAGACACAGCATGG + Intergenic
923233736 1:232012542-232012564 TAGGATGGTCAGACCCAGCACGG - Intronic
924514067 1:244751697-244751719 GCTGGTGCTCAGCCCCAGCAAGG + Intergenic
924766058 1:247032525-247032547 ATGGGGGTTCAGACCCAGCCCGG + Intergenic
1063138440 10:3236766-3236788 GCTGGTGTCCAGGCCCAGCAAGG + Intergenic
1066672678 10:37857313-37857335 GAGGGCGGTCAGAGCCAGCAGGG + Exonic
1070259525 10:74841184-74841206 GCTGGGGTTCAGACCCAGGTTGG + Intronic
1070773910 10:79099070-79099092 GCAGGTCCTGAGACCCAGCAAGG + Intronic
1072668636 10:97413028-97413050 GTGGCTGTTCAGGCCAAGCAAGG + Intronic
1073511365 10:104044727-104044749 GGGGGAGTTCAGACCCTGCCTGG - Intronic
1075541243 10:123316333-123316355 CCGGGTGTTTAGGCCCAGAATGG + Intergenic
1075545380 10:123351106-123351128 GCCAGTGTTCAGACCCAAGAGGG - Intergenic
1076146622 10:128126861-128126883 CCGGGAGTTCAGAACCAGCCTGG + Intergenic
1076150904 10:128161321-128161343 GCCGCTGCTCAGAGCCAGCAGGG - Intergenic
1077048670 11:556983-557005 GCTGGTGTTCAGACAGGGCAGGG + Exonic
1077434553 11:2532555-2532577 GCGGATGTACAGACACATCAGGG + Intronic
1078154917 11:8791108-8791130 GCAGGTATTAAGACCCAGAAAGG - Intronic
1078902091 11:15650933-15650955 TCCGGAGTTCAGACCCTGCAGGG - Intergenic
1083477807 11:62925446-62925468 GCAGGTGCTCAGCCCCAGGATGG - Intergenic
1084669758 11:70598105-70598127 GCTGGAGTCCAGAGCCAGCAGGG + Intronic
1086695726 11:89843313-89843335 CCGGGTGTTCAGGTCCAGCCTGG + Intergenic
1086710428 11:90001170-90001192 CCGGGTGTTCAGGTCCAGCCTGG - Intergenic
1088868124 11:113868709-113868731 GCGGGAGTTCAAAACCAGCCTGG + Intronic
1089208875 11:116787742-116787764 GCCGGGGGTCAGACCCAGCCAGG - Intronic
1091233023 11:134000602-134000624 GCAGGTGCTCAGCACCAGCACGG + Intergenic
1096717402 12:53499644-53499666 GCGGGAGTTCAAGCCGAGCAGGG - Intronic
1101237308 12:102802746-102802768 GTGGGTGTGGAGGCCCAGCATGG - Intergenic
1101418144 12:104526763-104526785 GTGGGTGATCAGGCCCAGCCAGG + Intronic
1102893919 12:116583086-116583108 GCTGGTGGCCAGACCCAGAAAGG + Intergenic
1103443761 12:120980856-120980878 GCGGGGGCTCAGACCCAGCTGGG + Intronic
1103521309 12:121538123-121538145 GCGGGTGTTCAGTTTCAGCGCGG - Intronic
1104943364 12:132405011-132405033 GGGGGCGTTCAGAGCCAGCAGGG + Intergenic
1113619133 13:111701201-111701223 GCGGGAGGTCAGCCCCAGAAGGG - Intergenic
1113624662 13:111786462-111786484 GCGGGAGGTCAGCCCCAGAAGGG - Intergenic
1113835503 13:113326054-113326076 GTCGGTCTTCAGGCCCAGCATGG + Exonic
1121549420 14:94787576-94787598 GCTGGGAATCAGACCCAGCAAGG + Intergenic
1122647706 14:103206279-103206301 GCTGGTGGTCAGGCCCAGTATGG + Intergenic
1122906301 14:104803076-104803098 GGGGGGGTGCAGCCCCAGCAGGG + Exonic
1122938749 14:104971899-104971921 GCGAGGGGTCAGACCCAGCCTGG + Intronic
1123132396 14:105999432-105999454 GGGGGTGCTCAGAACCACCAGGG - Intergenic
1123175831 14:106417824-106417846 GCAGGTGCTCAGAACCACCAAGG - Intergenic
1123200991 14:106663924-106663946 GCGGGCGCTCAGAACCACCAGGG - Intergenic
1123203661 14:106691940-106691962 GGGGGTGCTCAGAACCACCAGGG - Intergenic
1123582693 15:21730841-21730863 GCGGGCGGTCAGAACCACCAGGG - Intergenic
1123582904 15:21731722-21731744 GGGGGTGCTCAGAACCACCAGGG - Intergenic
1123619343 15:22173437-22173459 GCGGGCGGTCAGAACCACCAGGG - Intergenic
1123619554 15:22174318-22174340 GGGGGTGCTCAGAACCACCAGGG - Intergenic
1124707351 15:31977012-31977034 TCTGGTGTTGTGACCCAGCATGG + Intergenic
1126594011 15:50368084-50368106 CCGGGAGTTCAGAACCAGCCTGG + Intergenic
1127963633 15:63908139-63908161 GAGGGGGTTCAGAACCAGCCTGG - Exonic
1129699314 15:77758509-77758531 GGGGCAGTTCAGAGCCAGCAGGG + Intronic
1129726590 15:77904607-77904629 CCGGCTGTTCTCACCCAGCAGGG + Intergenic
1130917957 15:88320877-88320899 GCAGGAGTTCAGACACAGGATGG - Intergenic
1131003711 15:88958706-88958728 TAGGGTTTTCAGACCCAACAGGG - Intergenic
1131029985 15:89178489-89178511 GCGGGTCTCCAGACTCAGCTAGG - Intronic
1131244918 15:90782606-90782628 GCGGGTGGGGAGAGCCAGCAAGG + Intronic
1136365319 16:29806745-29806767 CCGGGAGTCCAGGCCCAGCACGG - Exonic
1136680208 16:31956356-31956378 GGGGGTGTTCAGGACCACCAGGG + Intergenic
1136691930 16:32039065-32039087 GAGGGTGCTCAGAACCACCATGG + Intergenic
1136691949 16:32039149-32039171 GCGGGTGCTCAGAACCACCAGGG + Intergenic
1136692144 16:32039821-32039843 GGGGGTGCTCAGAACCACCAGGG + Intergenic
1136780549 16:32897900-32897922 GGGGGTGTTCAGGACCACCAGGG + Intergenic
1136792515 16:32982627-32982649 GAGGGTGCTCAGAACCACCATGG + Intergenic
1136792533 16:32982711-32982733 GCGGGTGCTCAGAACCACCAGGG + Intergenic
1136792687 16:32983259-32983281 GGGGGTGCTCAGAACCACCAGGG + Intergenic
1136877169 16:33870795-33870817 GGGGGTGCTCAGAACCACCAGGG - Intergenic
1136877292 16:33871235-33871257 GCGGGTGCTCAGAACCACCAGGG - Intergenic
1136877310 16:33871319-33871341 GAGGGTGCTCAGAACCACCATGG - Intergenic
1136889855 16:33961748-33961770 GGGGGTGTTCAGGACCACCAGGG - Intergenic
1137251035 16:46741067-46741089 GGTGGGGTTCAAACCCAGCATGG - Intronic
1139782919 16:69366620-69366642 GCGGGGCTTCAGAACCGGCAGGG + Intronic
1140892719 16:79298773-79298795 GCTGGTGTGGACACCCAGCAGGG + Intergenic
1141645754 16:85366598-85366620 GAGGGTCTCTAGACCCAGCATGG - Intergenic
1142239485 16:88938689-88938711 GCGGGTGTTCAGACCCAGCATGG - Intronic
1203083179 16_KI270728v1_random:1161866-1161888 GGGGGTGTTCAGGACCACCAGGG + Intergenic
1203094721 16_KI270728v1_random:1244092-1244114 GAGGGTGCTCAGAACCACCATGG + Intergenic
1203094739 16_KI270728v1_random:1244176-1244198 GCGGGTGCTCAGAACCACCAGGG + Intergenic
1203094897 16_KI270728v1_random:1244738-1244760 GCGGGTGCTCAGAACCACCAGGG + Intergenic
1144180678 17:12749316-12749338 TCAGGTGTTCAAAACCAGCATGG + Intronic
1147217987 17:38912082-38912104 GCGGGTGGTGAGGCCGAGCACGG - Intronic
1152439384 17:80296308-80296330 CAGGGTATTCAGACCCAGCACGG - Intronic
1155073995 18:22339373-22339395 GGGGTTGGTCAGACTCAGCATGG - Intergenic
1157747764 18:50151396-50151418 GAGGGTGCTGAGACCCAGAATGG - Intronic
1160508542 18:79440730-79440752 GGAGCTGTTCAGACACAGCAGGG - Intronic
1160919831 19:1514098-1514120 GGGGGTGCTCAGACCGAGCCTGG - Intergenic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1167148178 19:47694829-47694851 AGGGGTGTCCAGACGCAGCAGGG - Intronic
1167616385 19:50536593-50536615 GGGGCTGTTCAGACACAGGAGGG + Intronic
929559337 2:42945971-42945993 GCTGGTGCTCAGCCCCAGCAGGG + Intergenic
932381400 2:71287133-71287155 GAGGCTGTTAAGACCCAGCTAGG + Intronic
937378157 2:121352072-121352094 GAGGGTGTGGAGACCCAGGAAGG + Intronic
938008780 2:127811521-127811543 ACGGGTGAACAGACTCAGCAAGG - Intergenic
946739458 2:222787692-222787714 GCAGGTTTTCAGCCCCAGCCAGG - Intergenic
947951177 2:234148659-234148681 GCTGGAGCTCAGACTCAGCAGGG - Intergenic
948477215 2:238227784-238227806 GGAGGTGCTCAGACCCTGCAGGG + Exonic
948616460 2:239202438-239202460 GTGTGAGTTCAGACCCAGCGGGG + Intronic
1169839747 20:9921977-9921999 CCAGGTGTTCAGAACCAGCCTGG - Intergenic
1170802703 20:19603534-19603556 ACAGGTGTTCAGACTCAGGAGGG - Intronic
1170969683 20:21105254-21105276 GGGGTTGTTCAGACCCAGAGCGG - Intergenic
1172505877 20:35462304-35462326 GAGGGTGTTCACGCCCAGCAGGG - Exonic
1173025137 20:39300528-39300550 GAGGGTGTGCAAACCCACCAGGG - Intergenic
1173484028 20:43427273-43427295 ACAGGTCATCAGACCCAGCATGG + Intergenic
1182796027 22:32992293-32992315 GCAGGTGTTCAGACACAGCTGGG - Intronic
1185059619 22:48599495-48599517 GCCGCTGATCAGACTCAGCATGG + Intronic
1185330996 22:50251950-50251972 GCGGGAGTTCACATCCAGCTGGG + Intronic
954625429 3:52019696-52019718 GGTGGAGTTCAGAGCCAGCAAGG + Intergenic
957428577 3:80071851-80071873 TTGGGTGTTCACACCCAGAATGG - Intergenic
963531453 3:146477045-146477067 GCGGGGGTTCTCACCCAGCTGGG - Intronic
965272667 3:166638619-166638641 GGGGGTGTGCACACCCAGCCAGG - Intergenic
968966273 4:3770529-3770551 GCTGGTGATAAGACCCAACAGGG + Intergenic
969499604 4:7544720-7544742 GTGGGTGCTCAGAGCCTGCAAGG - Intronic
975743149 4:77450202-77450224 GCGGGGCTTGAGACACAGCATGG - Intergenic
984416432 4:179465551-179465573 GGGAGTGATCAGACCCAGGAAGG + Intergenic
985921896 5:2984046-2984068 GCAGGTGGTGACACCCAGCAAGG + Intergenic
990432408 5:55749209-55749231 CTGGGAGTTCAGAACCAGCATGG + Intronic
997026788 5:130073495-130073517 GCGGGTGTTCAAGACCAGCCTGG - Intronic
997716899 5:136049247-136049269 GCTGGAGCTCAGGCCCAGCAAGG + Intronic
998044195 5:138972979-138973001 GCCCTTGTTCAGTCCCAGCATGG + Intronic
1004227867 6:13803920-13803942 CCAGGAGTTCAGAACCAGCATGG + Intronic
1004398188 6:15264934-15264956 GCTTCTGTTCAGACCCAGCTGGG + Intronic
1013061667 6:106640035-106640057 GGGGGAGTTGAGGCCCAGCATGG - Intronic
1015360495 6:132333729-132333751 TGGGGTGTACAGACCCAGAATGG + Intronic
1018765807 6:166932057-166932079 GAGGATGATCAGACCCTGCATGG - Intronic
1019657110 7:2201782-2201804 GTGGGTGTTGGGACCCCGCAGGG - Intronic
1026140927 7:67705947-67705969 GCTGTGGTTCACACCCAGCAGGG + Intergenic
1031909970 7:127505731-127505753 GTGGGTGCTGAGAGCCAGCATGG - Intergenic
1033338575 7:140474150-140474172 TCAGGTGTTCAAAACCAGCATGG + Intronic
1033760936 7:144436032-144436054 TCGGGAGTTCAAAACCAGCATGG - Intergenic
1034218131 7:149423125-149423147 GCTGGTGTTCATACCCAGCCAGG + Intergenic
1034958821 7:155351674-155351696 GGGGCTGTGCAGACCCAGGAGGG - Intergenic
1041426390 8:57725421-57725443 GGGGATGCTCAGACCCAGTAAGG + Intergenic
1048395938 8:134014077-134014099 GCTGCTGTTCAGACTCAGGAGGG + Intergenic
1048898934 8:139019834-139019856 GCAGGTGGTCAGCCCCAGCAGGG - Intergenic
1049591985 8:143466792-143466814 GAGGGTGGTCTGACCCAGGAGGG - Intronic
1051191093 9:14514358-14514380 GCGGGTGTGCATGCCCAGAAAGG - Intergenic
1054901255 9:70371682-70371704 TCAGGTGTTCGAACCCAGCATGG + Intergenic
1055037105 9:71829428-71829450 GAGGGTGGTCAGACACACCAAGG + Intergenic
1055454065 9:76456761-76456783 GTGGGAGTTCAAACCCAGCCTGG + Intronic
1057258169 9:93567632-93567654 GCGGGTGGACAGACCCAACTTGG - Intergenic
1061194774 9:129101846-129101868 CTGGGTGTGCAGCCCCAGCACGG + Intronic
1061381931 9:130264078-130264100 CCAGGTGCCCAGACCCAGCAAGG - Intergenic
1061912040 9:133730099-133730121 GCGGGTGTGGAGACTCAGCATGG - Exonic
1062346479 9:136117605-136117627 GCCAGGGTTCAGGCCCAGCAAGG - Intronic
1062379420 9:136280113-136280135 GCGGCAGTTCAGAGCCAGGAAGG - Intergenic
1062561062 9:137142104-137142126 GCGGGTGGTCAGCCCCAGCACGG - Exonic
1189522918 X:41789062-41789084 GATCGTGTTCAAACCCAGCATGG - Intronic
1192400876 X:70834374-70834396 GGGGGTGTTCAGACATAGAATGG - Intronic
1192905162 X:75543774-75543796 CTGGGTGTTTAGACCCAGGAGGG - Intergenic
1195210724 X:102651082-102651104 GCGGGGGTGCAGACACACCAAGG + Intergenic
1195216871 X:102712048-102712070 GCGGGGGTGCAGACACATCACGG + Intergenic
1195221008 X:102745657-102745679 GCGGGGGTGCAGACACACCAAGG + Intronic
1197332225 X:125167722-125167744 GCTGGTGTTCAGATCCAATAAGG + Intergenic