ID: 1142239515

View in Genome Browser
Species Human (GRCh38)
Location 16:88938849-88938871
Sequence CACCGTTAGCAGGTTGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 45}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142239515_1142239526 18 Left 1142239515 16:88938849-88938871 CCAAAGTCAACCTGCTAACGGTG 0: 1
1: 0
2: 0
3: 7
4: 45
Right 1142239526 16:88938890-88938912 GCCAGCGGAGAGCCCCAAGATGG No data
1142239515_1142239521 -9 Left 1142239515 16:88938849-88938871 CCAAAGTCAACCTGCTAACGGTG 0: 1
1: 0
2: 0
3: 7
4: 45
Right 1142239521 16:88938863-88938885 CTAACGGTGCAGCAGGGAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 171
1142239515_1142239520 -10 Left 1142239515 16:88938849-88938871 CCAAAGTCAACCTGCTAACGGTG 0: 1
1: 0
2: 0
3: 7
4: 45
Right 1142239520 16:88938862-88938884 GCTAACGGTGCAGCAGGGAAGGG No data
1142239515_1142239523 -7 Left 1142239515 16:88938849-88938871 CCAAAGTCAACCTGCTAACGGTG 0: 1
1: 0
2: 0
3: 7
4: 45
Right 1142239523 16:88938865-88938887 AACGGTGCAGCAGGGAAGGGGGG 0: 1
1: 0
2: 1
3: 25
4: 321
1142239515_1142239522 -8 Left 1142239515 16:88938849-88938871 CCAAAGTCAACCTGCTAACGGTG 0: 1
1: 0
2: 0
3: 7
4: 45
Right 1142239522 16:88938864-88938886 TAACGGTGCAGCAGGGAAGGGGG 0: 1
1: 0
2: 2
3: 12
4: 184
1142239515_1142239524 -4 Left 1142239515 16:88938849-88938871 CCAAAGTCAACCTGCTAACGGTG 0: 1
1: 0
2: 0
3: 7
4: 45
Right 1142239524 16:88938868-88938890 GGTGCAGCAGGGAAGGGGGGAGG 0: 1
1: 1
2: 3
3: 114
4: 1220
1142239515_1142239525 3 Left 1142239515 16:88938849-88938871 CCAAAGTCAACCTGCTAACGGTG 0: 1
1: 0
2: 0
3: 7
4: 45
Right 1142239525 16:88938875-88938897 CAGGGAAGGGGGGAGGCCAGCGG 0: 1
1: 0
2: 10
3: 161
4: 1306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142239515 Original CRISPR CACCGTTAGCAGGTTGACTT TGG (reversed) Intronic
911134356 1:94423340-94423362 CCCCATAAGCAGGTGGACTTTGG - Intronic
916977630 1:170098683-170098705 CAGCATTACCAGGTTGAGTTTGG - Intergenic
1074265562 10:111899637-111899659 CACATTTAGCAGTGTGACTTTGG + Intergenic
1076685778 10:132197881-132197903 CACCGTCAGGAGGTTGTCCTGGG + Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1097336208 12:58386232-58386254 CACCTTGAGCAAGTTGATTTTGG + Intergenic
1098662521 12:73114385-73114407 CAGCTTTAGCAGGTGGACTATGG - Intergenic
1101602005 12:106218168-106218190 CACCTCTAGAAGTTTGACTTGGG + Intergenic
1115342055 14:32303149-32303171 CAACATTAGCAGGTTTAGTTGGG + Intergenic
1137616337 16:49849778-49849800 CTCAGTTACCAAGTTGACTTTGG - Intronic
1138202775 16:55102321-55102343 CATCCTTAGCACGTTGACTTTGG - Intergenic
1142239515 16:88938849-88938871 CACCGTTAGCAGGTTGACTTTGG - Intronic
1152563554 17:81090307-81090329 CACCGTGAGAAGGTTGATGTCGG - Intronic
1159547608 18:69859223-69859245 CTCCATTAGAAGCTTGACTTGGG - Exonic
1159688995 18:71461337-71461359 CACCCCTAGCAGGGTGAATTGGG + Intergenic
930379324 2:50607662-50607684 CACTGTGTGCAGGTTTACTTTGG - Intronic
934036272 2:88091218-88091240 CAGGTTTAGCAGGTTGACTTTGG - Intronic
935787394 2:106561254-106561276 GAACGTGAGCAGCTTGACTTGGG + Intergenic
936645345 2:114363038-114363060 CCACGTTAGCAGGCAGACTTGGG - Intergenic
937182496 2:120009205-120009227 CACCCTTAGCATGTTGACCTTGG - Intergenic
937879395 2:126853827-126853849 CACAGTAAGCATGTTAACTTTGG + Intergenic
942248618 2:174029163-174029185 CACCTTCTGCAGGTTGAATTTGG - Intergenic
1174141023 20:48413703-48413725 CACCACTAGCTGGGTGACTTTGG - Intergenic
1178794372 21:35730336-35730358 CACCTTTAGCCCGGTGACTTGGG - Intronic
1178825261 21:36010133-36010155 CACCCTTAGGATGTTGACTTGGG + Intergenic
949174088 3:1037405-1037427 CCTCTTTAGCAGGTGGACTTTGG + Intergenic
961796268 3:129411254-129411276 CACCGTCAGTAGGTCCACTTTGG + Exonic
961906233 3:130265409-130265431 CATTGTTAGCAGTTTGTCTTGGG + Intergenic
969072252 4:4548909-4548931 CACCATGAGGAGCTTGACTTAGG + Intergenic
969134855 4:5021326-5021348 CACCTTTAGCAAGATGACATAGG + Intergenic
974683332 4:65193825-65193847 CTCGGTTATCAGATTGACTTTGG + Intergenic
976009656 4:80471972-80471994 CACTGTTAGAATGTTGACTTAGG + Intronic
976568821 4:86584844-86584866 CACCAATAGCAGCTTGAATTGGG - Intronic
977130804 4:93234408-93234430 CTCAGTTAACCGGTTGACTTAGG + Intronic
978938591 4:114410369-114410391 CACCGTTTGAACTTTGACTTAGG + Intergenic
982271266 4:153591567-153591589 CATCCTTAGCGTGTTGACTTCGG + Intronic
992668596 5:79036042-79036064 CACTGTTAGCTGGGTGACCTTGG + Intronic
1000310103 5:160034439-160034461 TACTGTTAGCAGGTTAACATAGG - Intronic
1000745911 5:165033303-165033325 CATTGGTAACAGGTTGACTTAGG + Intergenic
1000897104 5:166868573-166868595 CCTCGTTAGCAGGATGACCTTGG + Intergenic
1002471189 5:179437270-179437292 CATCATCAGCAGGGTGACTTTGG + Intergenic
1016265014 6:142222268-142222290 CACCGTTATCAGTTTCACTTGGG - Exonic
1016300772 6:142628876-142628898 CAGAGATAGCAGTTTGACTTTGG + Intergenic
1017423746 6:154299298-154299320 CACACTTAGCAGTTTCACTTGGG + Intronic
1019282639 7:208054-208076 CAACCTGAGCAGGGTGACTTTGG - Intronic
1022490154 7:30811179-30811201 AACTGTTAACACGTTGACTTGGG - Intronic
1026836773 7:73644932-73644954 CCCCATTAGCAGTGTGACTTTGG - Intergenic
1032856747 7:135841182-135841204 CATGGTTAGCAGGTTGATGTAGG - Intergenic
1042191754 8:66194234-66194256 CACCTGTGTCAGGTTGACTTTGG - Intergenic
1044251258 8:90006162-90006184 CATCCTTAGCAGGTTGACTAAGG + Intronic
1047988115 8:130257925-130257947 CACCCATGGCAGGTTGAATTTGG - Intronic
1052399853 9:27986758-27986780 GACCGTTACCATGTTGATTTTGG - Intronic
1060905213 9:127298798-127298820 CACTGTTAGCAAGTCGACTCTGG - Intronic