ID: 1142239846

View in Genome Browser
Species Human (GRCh38)
Location 16:88940223-88940245
Sequence GCGTCCGCCCGTGTGTGCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142239846_1142239861 23 Left 1142239846 16:88940223-88940245 CCCCAGCACACACGGGCGGACGC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1142239861 16:88940269-88940291 GCAGTGTGTTCGGAGCCCAGCGG 0: 1
1: 1
2: 2
3: 18
4: 197
1142239846_1142239856 13 Left 1142239846 16:88940223-88940245 CCCCAGCACACACGGGCGGACGC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1142239856 16:88940259-88940281 CGCCAGCCCCGCAGTGTGTTCGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142239846 Original CRISPR GCGTCCGCCCGTGTGTGCTG GGG (reversed) Exonic
900215483 1:1479407-1479429 GTGTGGGCCCGTGTGTGCAGGGG - Intronic
900222743 1:1518080-1518102 GTGTGGGCCCGTGTGTGCAGGGG - Intronic
900285130 1:1895432-1895454 GCCTCAGCAGGTGTGTGCTGAGG - Intergenic
900881135 1:5382190-5382212 GCATCAGCCAGTGTGTGCTCAGG - Intergenic
902044331 1:13513721-13513743 GCGTGCGCCCGGGCGTGCGGGGG + Exonic
904118370 1:28178639-28178661 GTGTCTGCCTGTGTGTGATGGGG - Intronic
910765663 1:90779847-90779869 GCGTTAGCCCCTGTGGGCTGAGG - Intergenic
912431293 1:109629804-109629826 GCTTCCACACGTTTGTGCTGAGG + Exonic
923024399 1:230193453-230193475 GCGTGAGCCTCTGTGTGCTGGGG + Intronic
923024407 1:230193505-230193527 GCGTGCGCCTCTGTGTGCTGGGG + Intronic
1062794894 10:337344-337366 GTGTGCGCGCGTGTGTGTTGTGG + Intronic
1067581511 10:47449527-47449549 ACCTCTGCCTGTGTGTGCTGGGG + Intergenic
1068568330 10:58600118-58600140 GCTTCTGCCCATGTGTGTTGGGG + Intronic
1077135706 11:997268-997290 GCGTGTCCCCGGGTGTGCTGGGG + Intronic
1077777581 11:5288442-5288464 GCGTCCCCTCTTGTGTACTGGGG + Intronic
1079240738 11:18720804-18720826 GGGGCAGCTCGTGTGTGCTGTGG + Intronic
1084265729 11:68004201-68004223 GCGCGCGCGCGTGTGTGCAGGGG + Intronic
1089860110 11:121582623-121582645 GCCTCAGCCCATGTGTGCAGAGG + Intronic
1104828936 12:131734809-131734831 ACGTACGCTCGTGTATGCTGAGG + Intronic
1107545122 13:41427843-41427865 GTGTCCACCCGTGTGTATTGGGG - Intergenic
1113788875 13:113016858-113016880 ACGTCCTCCCGTGTGTGGCGTGG + Intronic
1118759951 14:68874741-68874763 GCCTCCACCCGGGTGAGCTGGGG - Exonic
1121328376 14:93034772-93034794 CCCACTGCCCGTGTGTGCTGGGG - Intronic
1122889926 14:104727522-104727544 TCGTCTGCCTGTCTGTGCTGGGG + Intronic
1122925782 14:104899142-104899164 GCTTCCTCGCGTGTGTGCAGGGG - Intergenic
1124707233 15:31976143-31976165 GTGTCCGGCCCTGTGTGCTCAGG + Intergenic
1125775355 15:42207977-42207999 GCGTCCATCCGTGTGGGCTTCGG - Intronic
1127281585 15:57497788-57497810 GCCGCCGCCCGTGTGTGCATGGG - Intronic
1129256323 15:74336066-74336088 GCCTCCTTCCCTGTGTGCTGGGG + Exonic
1130224670 15:82047389-82047411 GCGTCCGCCCTAGTGGGCGGCGG - Intergenic
1130515172 15:84620903-84620925 GGGTCCTCTCGTGTGTGATGAGG - Exonic
1140926204 16:79586369-79586391 GCTTCTGCCGGTGTGTGCTAGGG + Intronic
1142239846 16:88940223-88940245 GCGTCCGCCCGTGTGTGCTGGGG - Exonic
1142296525 16:89226765-89226787 GAGTTCTCACGTGTGTGCTGAGG - Exonic
1144950807 17:18992476-18992498 GCTTCAGGCCGTGTCTGCTGGGG - Intronic
1144976428 17:19141555-19141577 GTGTGCGCTTGTGTGTGCTGGGG + Intronic
1148679451 17:49465419-49465441 GCGTGCGCGTGTGTGTACTGAGG + Intronic
1151436489 17:74100769-74100791 GCCTCCGTCCATGAGTGCTGGGG + Intergenic
1152554806 17:81047582-81047604 ACGTGGACCCGTGTGTGCTGTGG - Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152747372 17:82047631-82047653 GCCTCCTCCCGTGTGTTGTGTGG - Intergenic
1160385621 18:78494644-78494666 TCGTCCACCCGTGTCTGCTTTGG + Intergenic
1162453572 19:10769034-10769056 GCTCCTGCCTGTGTGTGCTGGGG + Intronic
1166330591 19:42076098-42076120 GCGTCCGGCCGTCCGTGCGGCGG + Intronic
1167374817 19:49104973-49104995 GCGTCCGCCCTTGCTAGCTGGGG + Intronic
946335270 2:219031529-219031551 GCAGCTGCCCATGTGTGCTGTGG - Exonic
947746964 2:232512831-232512853 GCATGCGCACGTGTGTGCAGGGG + Intergenic
1169039795 20:2483586-2483608 GCGTCCGCTCGTGTATGATGAGG + Exonic
1171567681 20:26209379-26209401 GTGTCCGCGCGTGGGTCCTGAGG - Intergenic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175875794 20:62228620-62228642 GTGGCCGCCCCCGTGTGCTGGGG + Intergenic
1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG + Intergenic
1176547140 21:8206905-8206927 GTGTCCGCGCGTGGGTCCTGAGG + Intergenic
1176555045 21:8251114-8251136 GTGTCCGCGCGTGGGTCCTGAGG + Intergenic
1176566091 21:8389952-8389974 GTGTCCGCGCGTGGGTCCTGAGG + Intergenic
1176573967 21:8434138-8434160 GTGTCCGCGCGTGGGTCCTGAGG + Intergenic
1179736987 21:43397563-43397585 GCGTGTGCCCGTGTGTGCTTGGG - Intergenic
1182660021 22:31918599-31918621 GCGCAGGACCGTGTGTGCTGCGG + Intergenic
1184523533 22:45009015-45009037 GCGTGCGCGTGTGTGTGTTGGGG - Intronic
1184572620 22:45335868-45335890 GCGTCCTCCTGTGTGTGCGCTGG + Intronic
1184776700 22:46626976-46626998 TCGTCCCCCGGTGTGGGCTGGGG + Intronic
1185295884 22:50054510-50054532 GCCTCCACCTGTGTGTGCAGAGG - Intronic
1203252015 22_KI270733v1_random:123190-123212 GTGTCCGCGCGTGGGTCCTGAGG + Intergenic
1203260069 22_KI270733v1_random:168273-168295 GTGTCCGCGCGTGGGTCCTGAGG + Intergenic
959068090 3:101677826-101677848 GCGTCTCCCAGTGCGTGCTGAGG + Intergenic
960157304 3:114309003-114309025 TCTTCCGGCCGTGTGTGCTGGGG + Exonic
960961189 3:123071650-123071672 GTGGCAGCCCCTGTGTGCTGGGG + Intronic
968660635 4:1797417-1797439 CCATCTGCCCGTGTGTGGTGGGG - Intronic
981120306 4:141042776-141042798 CCTTCCGCCCATGTGTTCTGGGG + Intronic
981894179 4:149777803-149777825 GCGTCAGTCCTTGGGTGCTGAGG - Intergenic
986631804 5:9781423-9781445 GCTTCTGCCCTTGTGTGCTGGGG + Intergenic
989033991 5:37150507-37150529 GTGTGCGCGCGTGTGTGTTGGGG - Intronic
1006458322 6:34144347-34144369 GTGTACGCGCGTGTGTGCTGGGG - Intronic
1017737948 6:157381022-157381044 GCGCCCGCCCGAGGGGGCTGGGG + Intergenic
1019284848 7:218341-218363 GGGTCCCTCCGTGTGTCCTGCGG + Intronic
1022129249 7:27388952-27388974 GGGGCCGCCTGTGTGTGGTGGGG + Intergenic
1033660482 7:143398854-143398876 GCGTCCCCCCGTATCTGCTGGGG + Exonic
1034996138 7:155578274-155578296 GCGCTCGGCCTTGTGTGCTGTGG - Intergenic
1035040271 7:155921838-155921860 GGGTCCGCCCGTGGTCGCTGCGG + Intergenic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1038729009 8:30110379-30110401 GCGTGCGCGCGTGTGTGTAGTGG + Intronic
1045305166 8:100951773-100951795 GCCGCCGCCCGTGTCCGCTGAGG + Intronic
1048303702 8:133268788-133268810 TCCTCCTCCTGTGTGTGCTGGGG - Intronic
1049636085 8:143690180-143690202 CCCTCCCCGCGTGTGTGCTGGGG - Intronic
1050445787 9:5721433-5721455 GTGCACGCGCGTGTGTGCTGGGG - Intronic
1059326809 9:113508651-113508673 GCCTCCGCCCCTGAGTTCTGAGG + Intronic
1060887978 9:127168919-127168941 GCGTGTGCTTGTGTGTGCTGGGG - Intronic
1062696561 9:137878806-137878828 ACGGCCGCCCGGGTGTGCCGAGG + Intronic
1203468418 Un_GL000220v1:106340-106362 GTGTCCGCGCGTGGGTCCTGAGG + Intergenic
1203476239 Un_GL000220v1:150312-150334 GTGTCCGCGCGTGGGTCCTGAGG + Intergenic
1187231640 X:17429200-17429222 GCATCTGCCTGTGTGTACTGGGG + Intronic