ID: 1142240383

View in Genome Browser
Species Human (GRCh38)
Location 16:88941934-88941956
Sequence CTCGCCCCCAGCGCGGCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 202}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142240371_1142240383 -3 Left 1142240371 16:88941914-88941936 CCCCCGCCCCCTGCCCCGCGCTC No data
Right 1142240383 16:88941934-88941956 CTCGCCCCCAGCGCGGCGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 202
1142240372_1142240383 -4 Left 1142240372 16:88941915-88941937 CCCCGCCCCCTGCCCCGCGCTCG 0: 1
1: 0
2: 16
3: 129
4: 1093
Right 1142240383 16:88941934-88941956 CTCGCCCCCAGCGCGGCGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 202
1142240373_1142240383 -5 Left 1142240373 16:88941916-88941938 CCCGCCCCCTGCCCCGCGCTCGC 0: 1
1: 0
2: 17
3: 154
4: 1256
Right 1142240383 16:88941934-88941956 CTCGCCCCCAGCGCGGCGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 202
1142240370_1142240383 0 Left 1142240370 16:88941911-88941933 CCGCCCCCGCCCCCTGCCCCGCG 0: 1
1: 6
2: 77
3: 694
4: 3925
Right 1142240383 16:88941934-88941956 CTCGCCCCCAGCGCGGCGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 202
1142240369_1142240383 3 Left 1142240369 16:88941908-88941930 CCGCCGCCCCCGCCCCCTGCCCC 0: 1
1: 27
2: 308
3: 1730
4: 8092
Right 1142240383 16:88941934-88941956 CTCGCCCCCAGCGCGGCGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 202
1142240376_1142240383 -10 Left 1142240376 16:88941921-88941943 CCCCTGCCCCGCGCTCGCCCCCA 0: 1
1: 0
2: 5
3: 56
4: 660
Right 1142240383 16:88941934-88941956 CTCGCCCCCAGCGCGGCGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 202
1142240368_1142240383 10 Left 1142240368 16:88941901-88941923 CCTTCGGCCGCCGCCCCCGCCCC 0: 1
1: 0
2: 38
3: 315
4: 1956
Right 1142240383 16:88941934-88941956 CTCGCCCCCAGCGCGGCGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 202
1142240375_1142240383 -9 Left 1142240375 16:88941920-88941942 CCCCCTGCCCCGCGCTCGCCCCC 0: 1
1: 0
2: 6
3: 122
4: 1133
Right 1142240383 16:88941934-88941956 CTCGCCCCCAGCGCGGCGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 202
1142240374_1142240383 -6 Left 1142240374 16:88941917-88941939 CCGCCCCCTGCCCCGCGCTCGCC 0: 1
1: 0
2: 10
3: 156
4: 1697
Right 1142240383 16:88941934-88941956 CTCGCCCCCAGCGCGGCGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142240383 Original CRISPR CTCGCCCCCAGCGCGGCGCC TGG Intronic
900003601 1:29449-29471 CCCTCCCCGAGCGCGGCTCCAGG + Intergenic
900023319 1:199965-199987 CCCTCCCCGAGCGCGGCTCCAGG + Intergenic
900366697 1:2314616-2314638 CACCCCCCCAGCGCGGCTTCCGG - Intergenic
901066590 1:6497332-6497354 CCCGCCCCCCGCGCGGCACGGGG - Intronic
902410029 1:16207040-16207062 CTCGCGCCGAGCGCTGCGCCCGG + Exonic
902442584 1:16440750-16440772 CTCTCCTCCATCGCGACGCCTGG - Exonic
903191583 1:21659463-21659485 CTCGCCCTCTCCCCGGCGCCAGG + Intronic
903888498 1:26554961-26554983 CGCGCCCCCACCGCTGCTCCTGG + Intronic
904563360 1:31413219-31413241 CGCGCCCCGCGCCCGGCGCCGGG + Intronic
904563566 1:31413990-31414012 CTGGGCCCCAGCGCGGAGACTGG + Intronic
905670583 1:39788188-39788210 CGCGCCCGCGGAGCGGCGCCTGG - Exonic
906678243 1:47708643-47708665 CTCGCCGCTAGAGCGGCCCCTGG - Intergenic
907442569 1:54488258-54488280 CGCCCCCCCAGCGCCGCCCCAGG - Intergenic
907947196 1:59146883-59146905 CTCCCCACCAGCGCGGCGCGGGG + Intergenic
911052345 1:93681600-93681622 CGAGCGCCCAGCGCCGCGCCGGG - Intronic
912878956 1:113390408-113390430 CCCTCCCGCCGCGCGGCGCCCGG - Intergenic
916212037 1:162367263-162367285 CCCGCCCCCAGCGCAGGGCGAGG + Exonic
917846732 1:179026134-179026156 CCCGCCCCCGGCGCGGCGGGCGG + Intronic
919916840 1:202144315-202144337 CTCCTCCCCCGCCCGGCGCCCGG + Intronic
920171266 1:204073682-204073704 CGAGCCCCGAGCCCGGCGCCTGG + Exonic
921089592 1:211830500-211830522 CCCGCCCCCAGCGCCTCCCCTGG + Intronic
922505128 1:226121852-226121874 CGCGCCCCCAGCGCTGAGCAGGG + Intergenic
922758060 1:228107621-228107643 CTCGACCCCAGCCCGGCACCTGG + Intronic
1064443217 10:15371404-15371426 CGCGCCCCCAGCCCGACCCCCGG + Intergenic
1066665669 10:37780680-37780702 CGCGCACCCCGCGCGGGGCCTGG + Intronic
1067038932 10:42938417-42938439 CTTGCCCCCAGCCCAGCTCCTGG + Intergenic
1074635817 10:115316106-115316128 CTCACCCCCAGCCCGGCAACAGG + Intronic
1077064954 11:637019-637041 CGCGGACCCCGCGCGGCGCCGGG + Intergenic
1077230540 11:1456536-1456558 GGCGCCCCCAGGGCGGCTCCGGG + Intronic
1077247435 11:1546538-1546560 GTCGCCCACACCGCGGCCCCAGG - Intergenic
1078316127 11:10294372-10294394 CGCGCCGCCACCGCGGCCCCTGG + Intergenic
1078345153 11:10541241-10541263 CCCGCCCCCCGCGCGTTGCCGGG + Intergenic
1078474979 11:11622193-11622215 CCCGCCCCCAGGGACGCGCCCGG + Intergenic
1081672808 11:44950962-44950984 CTCGCCCCCAGGGTGGCCGCCGG + Intronic
1082028691 11:47589846-47589868 CTCGCCCCCGCCGCCCCGCCGGG - Exonic
1083613182 11:64014093-64014115 CTGGCACCCAGCTCGGGGCCCGG + Intronic
1084425892 11:69084481-69084503 CTGGCCCCCAGGGAGGGGCCGGG - Intronic
1084978137 11:72814393-72814415 CTCCCGCCCAGGACGGCGCCAGG - Exonic
1085396880 11:76210846-76210868 CCCGCCCCCCGCGCGCGGCCGGG - Intergenic
1089533785 11:119148974-119148996 CTCGCCCCCCGCGGGCTGCCGGG + Intergenic
1090780352 11:130002126-130002148 GCCACCCCCAGCCCGGCGCCCGG + Intronic
1091266645 11:134276662-134276684 CCCGGCCCGAGCGCGGCGTCGGG + Intronic
1091377018 12:31503-31525 CCCTCCCCGAGCGCGGCTCCAGG + Intergenic
1092256237 12:6928065-6928087 CCCGCCCCCGCCGCGCCGCCCGG - Intronic
1095752980 12:45730370-45730392 CTCGCGCCCTGCCCGGTGCCCGG + Intronic
1096482339 12:51951282-51951304 CAAGCCCCCAGCGCGTCCCCTGG - Intergenic
1096493187 12:52023905-52023927 CTCGCCCCCGGCCCGGCTCCTGG + Intronic
1100977957 12:100142303-100142325 ATCGCTCCCGGCGCGGCGTCTGG - Intronic
1105472051 13:20703713-20703735 CCCGCCCCCCGTGCGGCCCCCGG + Intronic
1105492607 13:20902931-20902953 CCCCGCCCCAGCGCGGCGGCCGG - Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106264874 13:28100729-28100751 CTCGGCTGCAGCGCTGCGCCAGG - Intergenic
1106308281 13:28532452-28532474 AGCGGCCGCAGCGCGGCGCCAGG + Intergenic
1112290741 13:98142895-98142917 CCCGAGCCCAGCGCGCCGCCGGG - Intronic
1112503028 13:99956760-99956782 CTCTCCCCCAGCCCGCGGCCCGG - Intergenic
1112570396 13:100588631-100588653 GTCGCTCCCTGCGCGGCGTCCGG - Intronic
1113126978 13:106990188-106990210 CTCACCCCCAGCCCAGCACCAGG - Intergenic
1113492840 13:110705979-110706001 CGCGCCCCCCGCTCGCCGCCCGG + Exonic
1113517337 13:110914183-110914205 CTCGTCCGCAGCGCGGCCCTCGG + Intronic
1115853077 14:37602735-37602757 CTCTCCCCCACCGCGGTGACTGG - Intronic
1116928701 14:50668393-50668415 CCCTCCCCCACCGCGGCTCCAGG + Intergenic
1117157007 14:52951212-52951234 CCTCCCCCGAGCGCGGCGCCGGG - Intronic
1119742959 14:77026225-77026247 CGCGCCCCCAGCGCACCCCCGGG - Exonic
1122135283 14:99629123-99629145 CTGGCACCCAGCGCAGTGCCTGG - Intergenic
1122293493 14:100692339-100692361 CTTGGCCCCAGCCCGGCGCCGGG - Intergenic
1122959605 14:105088346-105088368 CCCGCCCCCAGCCCTCCGCCCGG - Intergenic
1123019239 14:105389856-105389878 CGCGGCCCCAGGGCTGCGCCAGG + Intronic
1124249347 15:28096939-28096961 CCCGCTCCCAGCCCGGGGCCAGG + Intronic
1125626877 15:41116127-41116149 CTCGCTCCCTCCGCGGCTCCTGG + Exonic
1126113263 15:45187678-45187700 CGCGCCCCCCGCGCCGCCCCCGG - Intronic
1127606486 15:60592358-60592380 CCCGGCCCCGGCGGGGCGCCCGG + Intronic
1128067649 15:64774956-64774978 CTCGCCCACCGCGGGACGCCCGG + Intronic
1130967073 15:88705491-88705513 CCCGCCCGCCGCGCGCCGCCCGG + Intergenic
1131097468 15:89665705-89665727 CACGCCCGCAGCGCCGCGCCCGG - Exonic
1132449902 15:101961491-101961513 CCCTCCCCGAGCGCGGCTCCAGG - Intergenic
1132719777 16:1309882-1309904 CTCGGCCGCGGCGCGGGGCCCGG - Intronic
1132947126 16:2537942-2537964 CCCCGCCCCCGCGCGGCGCCGGG - Exonic
1133171345 16:3984352-3984374 CTGGCCCCCAGCACAGAGCCAGG - Intronic
1136153071 16:28364853-28364875 TTGGCGCCCAGCGCCGCGCCCGG - Intergenic
1136210012 16:28750420-28750442 TTGGCGCCCAGCGCCGCGCCCGG + Intergenic
1136365295 16:29806676-29806698 CTCGGCCGCAGCGGGGCCCCCGG - Exonic
1136996091 16:35188879-35188901 CCTGCCCCCAGCCCGGCGCATGG - Intergenic
1138594241 16:58021244-58021266 CTCACCCCCAGCAAGGTGCCTGG + Exonic
1139528486 16:67530259-67530281 CTGGCTCCCAGCGCGCGGCCAGG + Intronic
1140512276 16:75517041-75517063 CTCACGCCCAGCGGGGCTCCGGG + Intergenic
1141711308 16:85700724-85700746 CAGGCCCCCAGCACCGCGCCCGG - Intronic
1142240383 16:88941934-88941956 CTCGCCCCCAGCGCGGCGCCTGG + Intronic
1143104820 17:4524063-4524085 CTCACTCCCAGCGCGCCGCAGGG - Intronic
1145390809 17:22454218-22454240 CTCGCCTCCAGGGCGGGGCTTGG + Intergenic
1146057761 17:29589618-29589640 TCCGCCCCCTGCGCGGCTCCCGG + Intronic
1146382588 17:32341932-32341954 CCCGCCCCCGGCCCGCCGCCCGG - Intronic
1147400462 17:40177723-40177745 CTGGCCCCCAGTCTGGCGCCTGG + Intronic
1147617064 17:41835987-41836009 CTCGGGCCCAGCGTGGCGCAGGG - Intronic
1148095680 17:45051495-45051517 CCCGCCCCCTCCCCGGCGCCCGG + Intronic
1148262226 17:46193521-46193543 CTCCACCCCGGCGCGCCGCCAGG + Intronic
1150239847 17:63622641-63622663 CGCGCCCCCCGCGCGGAGCCAGG + Exonic
1151554091 17:74837869-74837891 CTTGCCCCCAGCCCTGGGCCTGG + Exonic
1151713883 17:75821742-75821764 CTGGCCCCCAGGGCAGCCCCGGG - Intronic
1152362683 17:79839777-79839799 CTCGCCCACATCCCGGTGCCCGG + Intergenic
1152625746 17:81387213-81387235 CGCGCCCCCAGCACGCTGCCTGG + Intergenic
1152697276 17:81803613-81803635 GTCGCCCCCACCGCGGCTCCCGG - Intergenic
1152808855 17:82371807-82371829 CGCGCCCCCCGCCCCGCGCCGGG - Intergenic
1157683831 18:49627251-49627273 GTTGCCCCCAGCGTGGCCCCTGG + Intergenic
1158137734 18:54224627-54224649 CCCGCCCGCAGCGCGGCGCGCGG + Exonic
1160024096 18:75204701-75204723 CTCAACTCCACCGCGGCGCCGGG - Intronic
1160025379 18:75211630-75211652 TCCGCCCGCAGCCCGGCGCCGGG + Intronic
1160436602 18:78856854-78856876 CTGCCCCCCAGCGCGTCCCCAGG - Intergenic
1160635354 19:71056-71078 CCCTCCCCGAGCGCGGCTCCAGG + Intergenic
1160769182 19:822535-822557 CTCGCCCCCTCCGCCGCGCCGGG + Intergenic
1160868970 19:1268434-1268456 CTCGCTCCCCACGCGGGGCCAGG - Intronic
1160919555 19:1513307-1513329 CGGGCCCTGAGCGCGGCGCCCGG - Intronic
1160981873 19:1819942-1819964 CTGGCCCCCAGCGCTGTGCCCGG - Exonic
1161113708 19:2484914-2484936 CTCTCCCCCAGAGTGGCCCCAGG + Intergenic
1161304079 19:3557393-3557415 CCCGGGCCCATCGCGGCGCCGGG + Exonic
1161849340 19:6730710-6730732 CCCGCCCCCAGAGCGGCCCTGGG + Intronic
1163311744 19:16519127-16519149 CTGGCCACCGGCGCGGCTCCCGG + Exonic
1163708566 19:18832140-18832162 CTAGGCCTCAGCGCGGCGGCGGG + Exonic
1165423276 19:35732688-35732710 CTGGCCCCCAGCGCTACCCCTGG + Exonic
1166347716 19:42176771-42176793 CTCGCCTCCCTCTCGGCGCCCGG - Intronic
1167308887 19:48724869-48724891 ATGGCCCCCAGCTCCGCGCCAGG + Exonic
1168315534 19:55483284-55483306 CTGGCCCCAAGCTCGGGGCCTGG - Exonic
1168405598 19:56108631-56108653 CTAGCACCCAGGGCAGCGCCAGG + Intronic
1168408043 19:56120926-56120948 CTCGCCGCCCGCGGGCCGCCCGG + Intronic
926801836 2:16665907-16665929 CCCGCCCCCAGCCCGGCTCGCGG + Intronic
927198640 2:20565190-20565212 CTAGCCCCCAGCTCAGTGCCCGG + Intronic
929242308 2:39665756-39665778 CCCGCCCCCGGCCCGGCCCCCGG - Intronic
934754439 2:96815968-96815990 CTCGGCCCGTGCGCGGCGCCCGG - Intergenic
936531127 2:113277793-113277815 GACGCCCCGCGCGCGGCGCCCGG + Intronic
936566128 2:113583991-113584013 CCCTCCCCGAGCGCGGCTCCAGG - Intergenic
937044236 2:118842860-118842882 TTCTCCCCCAGCGAGGGGCCGGG + Exonic
938319961 2:130356059-130356081 CTCGCCGCGCGCGCGGCGGCCGG + Exonic
941905578 2:170714677-170714699 CTCGGCCCCACCGCGGCGGGCGG + Intergenic
941987473 2:171522948-171522970 ATCGCCGCGAGCGCGGGGCCGGG + Intronic
942278243 2:174337652-174337674 CTCGCGCCCAGCCCGGGCCCTGG - Exonic
942455649 2:176136682-176136704 CTCGGCTCCCGCCCGGCGCCCGG + Intergenic
942471876 2:176269321-176269343 CGGGCCCCCAGCGCAGAGCCTGG + Intergenic
946406997 2:219497122-219497144 CGCGCCCCGGGCGCAGCGCCAGG + Intronic
947353669 2:229271400-229271422 CTCCCGCCCCGCGCGGCCCCTGG - Intergenic
947860652 2:233354921-233354943 CCCGCCCAGCGCGCGGCGCCCGG - Intronic
948910311 2:240999261-240999283 CTCGCCCCCGCCTCGGTGCCCGG - Intronic
1169143935 20:3240430-3240452 CCCTCCCCCAGCGCGACTCCAGG + Intergenic
1171346666 20:24470479-24470501 CTCGCTCCCATCTCGGCGCCAGG - Intronic
1172474525 20:35226877-35226899 GCCGCCGCCCGCGCGGCGCCCGG - Exonic
1175743523 20:61437000-61437022 CTAGCACCCAGCGCAGGGCCTGG + Intronic
1175859553 20:62143111-62143133 GGCGCCCACAGCGCCGCGCCCGG + Intronic
1176120541 20:63452728-63452750 CTCGCCGGCAGCTCGGCTCCAGG + Intronic
1176148550 20:63576664-63576686 CTCGCCCCCAGCCAGGCTCAAGG + Intergenic
1179375436 21:40846703-40846725 CTCGCCCCCCGCGCTCCGCCCGG + Exonic
1179641120 21:42747710-42747732 CTGGCCCCCAGCACTGTGCCAGG + Intronic
1180967755 22:19799418-19799440 CTCGTCACCACCGCGGCCCCTGG + Intronic
1183220009 22:36506449-36506471 CTCGCACCCGGCCCGGCGGCTGG + Intronic
1183601795 22:38844155-38844177 GGCGCCCCCAGCCGGGCGCCCGG - Intergenic
1183702400 22:39457714-39457736 CCCGCCCCCACCGCGGCCTCCGG - Intronic
1183736985 22:39649669-39649691 CTCGCCACCAGCGGAGCTCCCGG - Exonic
1184302879 22:43572848-43572870 CTGGCACCCAGCTCAGCGCCTGG + Intronic
949988020 3:9554424-9554446 CCTGCCCCCAGCTCAGCGCCTGG + Intergenic
951080477 3:18445329-18445351 CTCCCTCCCAGCGCGCCGGCCGG + Intronic
952867208 3:37862048-37862070 CTCTCCCAGAGCGCGGGGCCGGG + Intronic
960556393 3:119034964-119034986 CGCGGCTCCAGCGCGACGCCTGG + Intronic
960684725 3:120285160-120285182 CCCGCGCCCATCGCCGCGCCGGG + Intergenic
961664337 3:128486751-128486773 CTCGCCTGGCGCGCGGCGCCTGG + Intronic
965390208 3:168095442-168095464 CTCAGCCCCCGCGCGGCGCGGGG + Exonic
968077064 3:195821803-195821825 CTCGCCCCCTGGGCCTCGCCAGG - Intergenic
968459675 4:718268-718290 CCGGCCCCCAGCGCCGCCCCCGG - Intronic
968921143 4:3522768-3522790 CTCACCCCCACCGCGCCCCCAGG - Intronic
969053154 4:4386750-4386772 CTCGCGCCCAGGCCGCCGCCCGG + Exonic
969240437 4:5893303-5893325 CTCGCGCCCTGCGCTCCGCCTGG - Intergenic
969538117 4:7769160-7769182 CTCACCCCCAGAGCGTCTCCTGG + Intronic
976092349 4:81471649-81471671 CTCGCTCCCCGCGCGGCCCAGGG + Intronic
979278177 4:118836140-118836162 CGCGCCCCCAGCGCCGGGCTTGG + Intronic
980541463 4:134201604-134201626 CTCCCGACCCGCGCGGCGCCCGG + Intronic
980969392 4:139555580-139555602 CTGGCCCCGTGCGCTGCGCCGGG + Intronic
986608360 5:9545216-9545238 CCCGCCCCCGGCGCGCCTCCAGG - Intronic
992627573 5:78648918-78648940 CCCGCCCCGCGCGCCGCGCCGGG - Intronic
995199416 5:109410015-109410037 TTCGCCTCCACCGCGGCGCAAGG - Intergenic
997302000 5:132813389-132813411 CCCACCCCCAGCGCCCCGCCGGG - Intergenic
998095820 5:139395006-139395028 CACGGCCCCCGCGCGGCGCCAGG - Exonic
999252370 5:150190415-150190437 CCCGCCCCCAACGAGGCCCCTGG + Intronic
1002123392 5:177022945-177022967 CTCGCCCGCTGCGCGGCTCGCGG + Intronic
1002160939 5:177313728-177313750 CCAGCCCCCAGCACAGCGCCTGG - Intergenic
1002349984 5:178576959-178576981 CCCGGCCCCAGCGCAGCGCCCGG + Intronic
1002466428 5:179411093-179411115 CTTCCCCCCAGCCCTGCGCCTGG + Intergenic
1003058243 6:2841835-2841857 CTCGCACCCAGCTCGGAGCCCGG - Exonic
1003948103 6:11093772-11093794 CTCGCCTCCTCCGCGGCGCGGGG - Intergenic
1005587187 6:27288315-27288337 CCCGACCCCCGCGCTGCGCCCGG - Intronic
1006239418 6:32664717-32664739 CTCGCCCCCATCGCCCCTCCCGG + Intronic
1007380928 6:41489683-41489705 CTGGCCCCCAGCCCAGCCCCAGG + Intergenic
1019536146 7:1530877-1530899 CGCGCCCTCCGCGCGACGCCAGG + Exonic
1019602878 7:1894045-1894067 CACGCCCCCAGCTCAGGGCCTGG - Intronic
1020037729 7:4974681-4974703 CTCGCTCCCTGCCCAGCGCCCGG - Intergenic
1020106354 7:5423938-5423960 CCCCCCCCCAGCCCGGCCCCCGG + Intronic
1020212228 7:6165672-6165694 CTCGGCCCCAGGGCAGCTCCGGG + Intronic
1026840483 7:73667926-73667948 CGCGCCCCCAGCTCGGCTGCTGG - Exonic
1029098383 7:98107155-98107177 CTCGCCCACGGCGCGGCTCCGGG - Exonic
1036454289 8:8893683-8893705 CCCGCCCCCGGGGCGGTGCCGGG - Intergenic
1037482017 8:19313963-19313985 CTCCACCCCTTCGCGGCGCCCGG + Intronic
1038444352 8:27593065-27593087 GTCGGCCCCTGCGCGGGGCCGGG + Intergenic
1039485178 8:37904381-37904403 CTCTTCCCCAGCGTGGCCCCAGG - Intergenic
1047499474 8:125430625-125430647 GCCGCCCCCAGCGAGGCTCCGGG + Exonic
1048571900 8:135663514-135663536 CTCTCCCCCAACCCAGCGCCTGG + Intergenic
1051445454 9:17135098-17135120 TTCGCCCCCAGCGCGACAGCTGG + Exonic
1051894548 9:21974499-21974521 CAAGCCCCCAGGGCGTCGCCAGG + Intronic
1053412430 9:37924329-37924351 CTCGCACCCTGCTCGGCGGCCGG - Intronic
1055090866 9:72364387-72364409 CTCGCCTCCGCGGCGGCGCCCGG - Intronic
1058908261 9:109498366-109498388 CCCGCCCCCCGCCCGGCGCGCGG - Intergenic
1060811571 9:126613754-126613776 CCCGCGCCCCGCGCCGCGCCTGG - Intergenic
1060916951 9:127397490-127397512 CGCGCCCCCGGCCCCGCGCCTGG + Exonic
1061280883 9:129597252-129597274 CTCGCTCCTAGCGCGGGGCTGGG + Intergenic
1061373233 9:130209616-130209638 CTCTTCCCCAACACGGCGCCAGG - Intronic
1061852381 9:133423776-133423798 CCAGCCCCCAGCGTGGCCCCAGG - Intronic
1062230451 9:135479434-135479456 CGCGCCCCCTGCGCGCCCCCCGG + Intronic
1062349898 9:136133456-136133478 ACCGCCCCCAGCCCCGCGCCCGG + Intergenic
1062537773 9:137028375-137028397 CCCGCCGCCCGCGCCGCGCCCGG + Intronic
1062621329 9:137423689-137423711 CTCACCCGCAGCGCGGCCTCGGG - Exonic
1187257436 X:17655711-17655733 CTCGATCCCAGCGTGGCCCCAGG + Intronic
1187388954 X:18873384-18873406 ACTACCCCCAGCGCGGCGCCTGG + Intergenic
1188007115 X:25022963-25022985 CGCGGCCCCAGCAGGGCGCCCGG - Intergenic
1189262554 X:39688952-39688974 CTGGCTCCGAGCGCGCCGCCGGG - Intergenic
1189323437 X:40099191-40099213 CCCGCGCCCAGAGCCGCGCCGGG - Intronic
1190385647 X:49879973-49879995 TCCGCCCCCAGGGCCGCGCCGGG - Exonic
1192440401 X:71169781-71169803 CTAGCCCTCAGCGGGGAGCCGGG + Exonic
1200145852 X:153926316-153926338 CCCGCCCCCAGCGCGGCTCCCGG + Intronic