ID: 1142244718

View in Genome Browser
Species Human (GRCh38)
Location 16:88964783-88964805
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2743
Summary {0: 1, 1: 8, 2: 187, 3: 690, 4: 1857}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142244718 Original CRISPR CTGGATGGATAGATGGTGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr