ID: 1142250503

View in Genome Browser
Species Human (GRCh38)
Location 16:88989699-88989721
Sequence GGAGGCCTTGAGGGCATCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142250490_1142250503 27 Left 1142250490 16:88989649-88989671 CCTGCCATCTGTCAGGTGGGGCG No data
Right 1142250503 16:88989699-88989721 GGAGGCCTTGAGGGCATCTGAGG No data
1142250491_1142250503 23 Left 1142250491 16:88989653-88989675 CCATCTGTCAGGTGGGGCGAGAC No data
Right 1142250503 16:88989699-88989721 GGAGGCCTTGAGGGCATCTGAGG No data
1142250493_1142250503 1 Left 1142250493 16:88989675-88989697 CCGTGCCAGCTGCCCTGGCCCTG No data
Right 1142250503 16:88989699-88989721 GGAGGCCTTGAGGGCATCTGAGG No data
1142250495_1142250503 -4 Left 1142250495 16:88989680-88989702 CCAGCTGCCCTGGCCCTGAGGAG No data
Right 1142250503 16:88989699-88989721 GGAGGCCTTGAGGGCATCTGAGG No data
1142250489_1142250503 28 Left 1142250489 16:88989648-88989670 CCCTGCCATCTGTCAGGTGGGGC No data
Right 1142250503 16:88989699-88989721 GGAGGCCTTGAGGGCATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142250503 Original CRISPR GGAGGCCTTGAGGGCATCTG AGG Intergenic
No off target data available for this crispr