ID: 1142251132

View in Genome Browser
Species Human (GRCh38)
Location 16:88992572-88992594
Sequence GCCCCCTGCCCAGTATCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142251132_1142251137 14 Left 1142251132 16:88992572-88992594 CCGAGAGATACTGGGCAGGGGGC No data
Right 1142251137 16:88992609-88992631 CTGTGACAGAGGCAGTTACCCGG No data
1142251132_1142251135 3 Left 1142251132 16:88992572-88992594 CCGAGAGATACTGGGCAGGGGGC No data
Right 1142251135 16:88992598-88992620 GAGCGTTCCTGCTGTGACAGAGG No data
1142251132_1142251138 23 Left 1142251132 16:88992572-88992594 CCGAGAGATACTGGGCAGGGGGC No data
Right 1142251138 16:88992618-88992640 AGGCAGTTACCCGGCCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142251132 Original CRISPR GCCCCCTGCCCAGTATCTCT CGG (reversed) Intergenic
No off target data available for this crispr