ID: 1142254661

View in Genome Browser
Species Human (GRCh38)
Location 16:89007896-89007918
Sequence TGCACAGGATGAGGCTCCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142254654_1142254661 8 Left 1142254654 16:89007865-89007887 CCCAGAGGCTGGTTCTGTGAGAC No data
Right 1142254661 16:89007896-89007918 TGCACAGGATGAGGCTCCGATGG No data
1142254650_1142254661 21 Left 1142254650 16:89007852-89007874 CCCACCTGGGCTGCCCAGAGGCT No data
Right 1142254661 16:89007896-89007918 TGCACAGGATGAGGCTCCGATGG No data
1142254653_1142254661 17 Left 1142254653 16:89007856-89007878 CCTGGGCTGCCCAGAGGCTGGTT No data
Right 1142254661 16:89007896-89007918 TGCACAGGATGAGGCTCCGATGG No data
1142254655_1142254661 7 Left 1142254655 16:89007866-89007888 CCAGAGGCTGGTTCTGTGAGACC No data
Right 1142254661 16:89007896-89007918 TGCACAGGATGAGGCTCCGATGG No data
1142254651_1142254661 20 Left 1142254651 16:89007853-89007875 CCACCTGGGCTGCCCAGAGGCTG No data
Right 1142254661 16:89007896-89007918 TGCACAGGATGAGGCTCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142254661 Original CRISPR TGCACAGGATGAGGCTCCGA TGG Intergenic