ID: 1142254966

View in Genome Browser
Species Human (GRCh38)
Location 16:89009285-89009307
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142254966_1142254971 6 Left 1142254966 16:89009285-89009307 CCACCTCATCTGTGCCAGGAGGA No data
Right 1142254971 16:89009314-89009336 CACACCCACCTCATCTTTGCAGG No data
1142254966_1142254972 9 Left 1142254966 16:89009285-89009307 CCACCTCATCTGTGCCAGGAGGA No data
Right 1142254972 16:89009317-89009339 ACCCACCTCATCTTTGCAGGAGG No data
1142254966_1142254977 30 Left 1142254966 16:89009285-89009307 CCACCTCATCTGTGCCAGGAGGA No data
Right 1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG No data
1142254966_1142254976 24 Left 1142254966 16:89009285-89009307 CCACCTCATCTGTGCCAGGAGGA No data
Right 1142254976 16:89009332-89009354 GCAGGAGGACCCATGACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142254966 Original CRISPR TCCTCCTGGCACAGATGAGG TGG (reversed) Intergenic