ID: 1142254967

View in Genome Browser
Species Human (GRCh38)
Location 16:89009288-89009310
Sequence GGGTCCTCCTGGCACAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142254967_1142254971 3 Left 1142254967 16:89009288-89009310 CCTCATCTGTGCCAGGAGGACCC No data
Right 1142254971 16:89009314-89009336 CACACCCACCTCATCTTTGCAGG No data
1142254967_1142254976 21 Left 1142254967 16:89009288-89009310 CCTCATCTGTGCCAGGAGGACCC No data
Right 1142254976 16:89009332-89009354 GCAGGAGGACCCATGACACCTGG No data
1142254967_1142254972 6 Left 1142254967 16:89009288-89009310 CCTCATCTGTGCCAGGAGGACCC No data
Right 1142254972 16:89009317-89009339 ACCCACCTCATCTTTGCAGGAGG No data
1142254967_1142254977 27 Left 1142254967 16:89009288-89009310 CCTCATCTGTGCCAGGAGGACCC No data
Right 1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG No data
1142254967_1142254978 28 Left 1142254967 16:89009288-89009310 CCTCATCTGTGCCAGGAGGACCC No data
Right 1142254978 16:89009339-89009361 GACCCATGACACCTGGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142254967 Original CRISPR GGGTCCTCCTGGCACAGATG AGG (reversed) Intergenic