ID: 1142254968

View in Genome Browser
Species Human (GRCh38)
Location 16:89009299-89009321
Sequence TGGGTGTGTCAGGGTCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142254968_1142254971 -8 Left 1142254968 16:89009299-89009321 CCAGGAGGACCCTGACACACCCA No data
Right 1142254971 16:89009314-89009336 CACACCCACCTCATCTTTGCAGG No data
1142254968_1142254976 10 Left 1142254968 16:89009299-89009321 CCAGGAGGACCCTGACACACCCA No data
Right 1142254976 16:89009332-89009354 GCAGGAGGACCCATGACACCTGG No data
1142254968_1142254978 17 Left 1142254968 16:89009299-89009321 CCAGGAGGACCCTGACACACCCA No data
Right 1142254978 16:89009339-89009361 GACCCATGACACCTGGCCTTGGG No data
1142254968_1142254977 16 Left 1142254968 16:89009299-89009321 CCAGGAGGACCCTGACACACCCA No data
Right 1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG No data
1142254968_1142254972 -5 Left 1142254968 16:89009299-89009321 CCAGGAGGACCCTGACACACCCA No data
Right 1142254972 16:89009317-89009339 ACCCACCTCATCTTTGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142254968 Original CRISPR TGGGTGTGTCAGGGTCCTCC TGG (reversed) Intergenic