ID: 1142254969

View in Genome Browser
Species Human (GRCh38)
Location 16:89009308-89009330
Sequence AAGATGAGGTGGGTGTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142254969_1142254976 1 Left 1142254969 16:89009308-89009330 CCCTGACACACCCACCTCATCTT No data
Right 1142254976 16:89009332-89009354 GCAGGAGGACCCATGACACCTGG No data
1142254969_1142254977 7 Left 1142254969 16:89009308-89009330 CCCTGACACACCCACCTCATCTT No data
Right 1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG No data
1142254969_1142254978 8 Left 1142254969 16:89009308-89009330 CCCTGACACACCCACCTCATCTT No data
Right 1142254978 16:89009339-89009361 GACCCATGACACCTGGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142254969 Original CRISPR AAGATGAGGTGGGTGTGTCA GGG (reversed) Intergenic